ID: 1169045176

View in Genome Browser
Species Human (GRCh38)
Location 20:2529268-2529290
Sequence CACAGGGCGTTCAAATCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169045176_1169045184 25 Left 1169045176 20:2529268-2529290 CCCCTGGATTTGAACGCCCTGTG No data
Right 1169045184 20:2529316-2529338 ATTTTTGTTGTTGTCGTATTGGG No data
1169045176_1169045183 24 Left 1169045176 20:2529268-2529290 CCCCTGGATTTGAACGCCCTGTG No data
Right 1169045183 20:2529315-2529337 TATTTTTGTTGTTGTCGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169045176 Original CRISPR CACAGGGCGTTCAAATCCAG GGG (reversed) Intergenic
No off target data available for this crispr