ID: 1169045618

View in Genome Browser
Species Human (GRCh38)
Location 20:2532546-2532568
Sequence CTCGATATACAGATGAACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169045616_1169045618 25 Left 1169045616 20:2532498-2532520 CCACATAGGAGTTAAGTACTCTT No data
Right 1169045618 20:2532546-2532568 CTCGATATACAGATGAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169045618 Original CRISPR CTCGATATACAGATGAACAG TGG Intergenic
No off target data available for this crispr