ID: 1169048777

View in Genome Browser
Species Human (GRCh38)
Location 20:2558982-2559004
Sequence CCGCGCGGGGGAGTGGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169048765_1169048777 4 Left 1169048765 20:2558955-2558977 CCCAGAACCGGGATGAAGATCGC 0: 1
1: 0
2: 0
3: 7
4: 30
Right 1169048777 20:2558982-2559004 CCGCGCGGGGGAGTGGCCGCGGG No data
1169048769_1169048777 -3 Left 1169048769 20:2558962-2558984 CCGGGATGAAGATCGCGGGTCCG 0: 1
1: 0
2: 0
3: 2
4: 16
Right 1169048777 20:2558982-2559004 CCGCGCGGGGGAGTGGCCGCGGG No data
1169048761_1169048777 28 Left 1169048761 20:2558931-2558953 CCCACTCTGCGGTGGGTTCTTCA 0: 1
1: 1
2: 0
3: 6
4: 122
Right 1169048777 20:2558982-2559004 CCGCGCGGGGGAGTGGCCGCGGG No data
1169048766_1169048777 3 Left 1169048766 20:2558956-2558978 CCAGAACCGGGATGAAGATCGCG 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1169048777 20:2558982-2559004 CCGCGCGGGGGAGTGGCCGCGGG No data
1169048762_1169048777 27 Left 1169048762 20:2558932-2558954 CCACTCTGCGGTGGGTTCTTCAT 0: 1
1: 0
2: 0
3: 14
4: 116
Right 1169048777 20:2558982-2559004 CCGCGCGGGGGAGTGGCCGCGGG No data
1169048760_1169048777 29 Left 1169048760 20:2558930-2558952 CCCCACTCTGCGGTGGGTTCTTC 0: 1
1: 0
2: 1
3: 10
4: 98
Right 1169048777 20:2558982-2559004 CCGCGCGGGGGAGTGGCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169048777 Original CRISPR CCGCGCGGGGGAGTGGCCGC GGG Intronic