ID: 1169052867

View in Genome Browser
Species Human (GRCh38)
Location 20:2595410-2595432
Sequence ACACACAAGCTAGAGTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 375}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169052867_1169052870 -8 Left 1169052867 20:2595410-2595432 CCTCCAAACTCTAGCTTGTGTGT 0: 1
1: 0
2: 3
3: 25
4: 375
Right 1169052870 20:2595425-2595447 TTGTGTGTTAGAACCAAGGCTGG 0: 1
1: 0
2: 0
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169052867 Original CRISPR ACACACAAGCTAGAGTTTGG AGG (reversed) Intronic
900471511 1:2857236-2857258 ACACACAACCTCGTGCTTGGAGG - Intergenic
900753599 1:4417249-4417271 ACACCCAGGCTAGAGTTCAGTGG - Intergenic
903870108 1:26427826-26427848 ACACACAAGCGAGGGTTTTGTGG + Exonic
904142510 1:28364924-28364946 TCACACAAGCTGGAGTGTAGTGG + Intergenic
904240409 1:29140947-29140969 TCACCCAAGCTGGAGTGTGGTGG + Intergenic
904735326 1:32628002-32628024 ACACCCAGGCTAGAGTGCGGTGG - Intronic
905055056 1:35086342-35086364 TCACACAGGCTGGAGTGTGGTGG + Intronic
905098368 1:35495690-35495712 TCACCCAGGCTAGAGTGTGGTGG + Intronic
906172501 1:43739260-43739282 TCACCCAGGCTAGAGTTTTGTGG + Intronic
906703736 1:47879063-47879085 TCACCCAGGCTAGAGTGTGGTGG - Intronic
907894651 1:58674885-58674907 TCACCCAGGCTAGAGTATGGTGG - Intronic
909201948 1:72700852-72700874 TCACCCAGGCTAGAGTTTAGGGG - Intergenic
910276332 1:85453135-85453157 ACACACAAGATATAGCTTGTTGG - Intronic
910361292 1:86415631-86415653 TCACTCAAGCTAGAGTGTAGTGG + Intergenic
910654062 1:89602011-89602033 ACACAGATTCTAGAGTTAGGTGG - Intergenic
910762246 1:90745208-90745230 ACACAAAAGGGAGAGGTTGGAGG - Intergenic
910819767 1:91333934-91333956 ACATACAAACTTGAGTATGGAGG + Intronic
911748063 1:101463128-101463150 ACAGACAAGCTACAGAATGGGGG + Intergenic
912351399 1:109017361-109017383 TCACCCAAGCTGGAGTGTGGTGG - Intronic
913184396 1:116355878-116355900 ACACACAAGGCTGAGTGTGGTGG - Intergenic
913435190 1:118840334-118840356 AAACTCAAGATATAGTTTGGAGG - Intergenic
913533703 1:119751404-119751426 TCACCCAGGCTAGAGTGTGGTGG + Intronic
914810919 1:151027416-151027438 AGACACAAGATACATTTTGGAGG - Intronic
914819863 1:151092627-151092649 TCACCCAGGCTAGAGTGTGGTGG + Intronic
915393005 1:155561830-155561852 ACACACAAACTGGACTATGGGGG + Intronic
915409161 1:155687748-155687770 ACACACAAACTGGACTATGGGGG + Intronic
916574177 1:166052429-166052451 AGACACATTCTAGAATTTGGGGG + Intergenic
916817433 1:168367503-168367525 TCACCCAGGCTAGAGTGTGGTGG + Intergenic
920794728 1:209128090-209128112 TCACCCAGGCTAGAGTGTGGTGG - Intergenic
923369912 1:233299565-233299587 AGCCACAAGCCAGAGGTTGGCGG + Intergenic
1062838564 10:652065-652087 CCACACAAGCTTGAGCTTTGTGG - Exonic
1063999365 10:11650521-11650543 TCACCCAAGCTGGAGTGTGGTGG - Intergenic
1065778042 10:29140804-29140826 TCACACAAGCTGGAGTGCGGTGG + Intergenic
1066604241 10:37143612-37143634 TCACACAGGCTAGAGTGTAGTGG - Intronic
1068542746 10:58313513-58313535 AGAGGCAAGCTAGAGTATGGAGG - Intergenic
1069054835 10:63833861-63833883 AGACACAAGCTAGAGTTCTACGG - Intergenic
1070053256 10:72909635-72909657 TCACCCAAGCTACAGTGTGGTGG + Intronic
1070126734 10:73628370-73628392 ACACCCAGGCTGGAGTTCGGTGG + Intergenic
1070150772 10:73803533-73803555 ACACACAGGCTAAAGGTTGGGGG - Intronic
1070499748 10:77061234-77061256 AAACACAAGCTACAGATTAGGGG + Intronic
1071079849 10:81798100-81798122 ACACACAAGACAGAGAATGGTGG - Intergenic
1071332624 10:84574959-84574981 ACACAGAGGTTAGAGTTTGAGGG - Intergenic
1071454597 10:85836375-85836397 ACACACAAGCTAGATTGAAGAGG + Intronic
1073187190 10:101622748-101622770 AAAGACAAGCTACAGATTGGGGG + Intronic
1073597618 10:104816917-104816939 ATACAGCTGCTAGAGTTTGGAGG + Intronic
1073620654 10:105044366-105044388 TCACCCAAGCTAGAGTACGGTGG - Intronic
1074228495 10:111511333-111511355 ACACCCAAAGTAAAGTTTGGAGG + Intergenic
1074964347 10:118476025-118476047 TCACCCAAGCTGGAGTGTGGTGG + Intergenic
1076056667 10:127380241-127380263 ACGTATAAGGTAGAGTTTGGTGG + Intronic
1078077045 11:8171587-8171609 TTACCCAAGCTAGAATTTGGTGG - Intergenic
1078592148 11:12651804-12651826 TCACCCAGGCTAGAGTGTGGTGG + Intergenic
1079229442 11:18637005-18637027 TCACTCAAGCTGGAGTATGGTGG + Intergenic
1080464943 11:32487858-32487880 TCACCCAGGCTAGAGTGTGGTGG + Intergenic
1081566406 11:44263780-44263802 ACACATAAGCTAGAGCTTGGGGG - Exonic
1082034541 11:47634113-47634135 TCACACAGGCTGGAGTATGGTGG + Intronic
1083931321 11:65847434-65847456 TCACTCAGGCTGGAGTTTGGTGG - Intronic
1084076485 11:66782099-66782121 ACAGAGGAGATAGAGTTTGGAGG - Intronic
1085573753 11:77583861-77583883 TCCCCCAAGCTAGAGTTCGGTGG - Intronic
1085609894 11:77937702-77937724 ACACCCAGGCTAGAGTGTAGTGG - Intronic
1085796397 11:79544103-79544125 ACATACAAGCATGAATTTGGTGG + Intergenic
1085946061 11:81274956-81274978 ACATTCAAACTGGAGTTTGGAGG + Intergenic
1086610788 11:88753161-88753183 ACAGACAACCTACAGATTGGGGG + Intronic
1087166297 11:95007149-95007171 ACAACCAAGAAAGAGTTTGGAGG + Intergenic
1087369194 11:97259834-97259856 GCACACAAGGTAGGGTGTGGTGG - Intergenic
1089761921 11:120733775-120733797 TCACCCAGGCTAGAGTATGGTGG + Intronic
1090783080 11:130024727-130024749 TCACCCAGGCTAGAGTGTGGTGG + Intergenic
1094332103 12:29305171-29305193 TCACCCAAGCTGGAGTATGGTGG + Intronic
1094571049 12:31641401-31641423 CCACCCAGGCTAGAGTGTGGTGG - Intergenic
1096624769 12:52887784-52887806 ACACCCAGGCTGGAGTGTGGTGG - Intergenic
1097059467 12:56271831-56271853 AAACACAGGCAGGAGTTTGGAGG + Exonic
1097538255 12:60901053-60901075 ACAGACAACCTAGAGAATGGGGG + Intergenic
1098536747 12:71601927-71601949 TTACCCAGGCTAGAGTTTGGTGG + Intergenic
1099083679 12:78218406-78218428 ACACAGAAGCCAGATTTTGGTGG + Intergenic
1100454274 12:94736858-94736880 ACACAAAATCTAGAGGTAGGCGG - Intergenic
1100745472 12:97640976-97640998 TCACCCAAGCTAGAGTTCAGTGG + Intergenic
1102121208 12:110442566-110442588 TCACCCAGGCTTGAGTTTGGTGG - Intronic
1102560847 12:113761365-113761387 TCACACAGGCTGGAGTATGGTGG - Intergenic
1102840022 12:116109108-116109130 TCACCCAGGCTAGAGTGTGGTGG + Intronic
1102970180 12:117160272-117160294 GCCCACAAGCTATAGTTTGCTGG + Intronic
1103373261 12:120435553-120435575 TCACCCAAGCTGGAGTGTGGTGG - Intergenic
1103579507 12:121903792-121903814 TCACCCAGGCTAGAGTGTGGTGG + Intronic
1104805897 12:131589001-131589023 TCACCCAGGCTAGAGTGTGGTGG + Intergenic
1105221211 13:18329521-18329543 TCACCCAGGCTAGAGTGTGGTGG - Intergenic
1105525115 13:21170217-21170239 TCACCCAGGCTAGAGTGTGGTGG + Intronic
1106453184 13:29903191-29903213 ACACCCAGGCTGGAGTGTGGTGG + Intergenic
1108338380 13:49470803-49470825 TCACCCAAGCTAGAGTGCGGAGG - Intronic
1109581769 13:64348534-64348556 TCACCCAGGCTAGAGTTCGGTGG - Intergenic
1109738032 13:66512547-66512569 ACACAGAATCTAGAATCTGGGGG - Intronic
1110366512 13:74692397-74692419 TCACCCAAGCTGGAGTGTGGTGG - Intergenic
1110415862 13:75251600-75251622 TCACACAGGCTAGAGTGTAGTGG + Intergenic
1110776465 13:79413476-79413498 TCACACAGGCTAGAGTGCGGTGG + Intergenic
1110790920 13:79585701-79585723 TCACCCAAGCTGGAGTGTGGTGG - Intergenic
1111675412 13:91381039-91381061 AAGCACCAGCTAGAATTTGGGGG + Intergenic
1112483133 13:99795612-99795634 TCACCCAGGCTGGAGTTTGGTGG - Intronic
1113265155 13:108608680-108608702 TCACCCAGGCTAGAGTGTGGTGG + Intronic
1114185403 14:20397791-20397813 TCACCCAGGCTAGAGTGTGGTGG + Intronic
1114391049 14:22308979-22309001 TCACCCAAGCTGGAGTGTGGTGG - Intergenic
1114509861 14:23249503-23249525 TTACACAAGCTGGAGTATGGTGG - Intronic
1116013233 14:39375655-39375677 TCACACAAGCTGGAGTGTAGTGG - Intronic
1116523574 14:45877838-45877860 ACACAAAACCTATTGTTTGGAGG + Intergenic
1117393420 14:55284654-55284676 TCACCCAAGCTAGAGTGTAGTGG + Intronic
1118290813 14:64520352-64520374 TCACACAAGCTAGAGTACAGTGG + Intronic
1119100869 14:71878923-71878945 ACACAAAAGCAAAAGTTTGGTGG - Intergenic
1120920888 14:89754638-89754660 ACAGACAAGCTACAGAATGGGGG + Intergenic
1122104220 14:99439829-99439851 TCACCCAGGCTAGAGTATGGTGG + Intronic
1123433919 15:20241117-20241139 TCACCCAGGCTAGAGTGTGGTGG + Intergenic
1123700693 15:22912879-22912901 TCACACAGGCTAGAGTGTAGTGG - Intronic
1123786720 15:23682191-23682213 TCACCCAGGCTAGAGTTTAGTGG + Intergenic
1124185360 15:27521199-27521221 ACACAGAAGCTAGAATTTCACGG + Intronic
1124235465 15:27985730-27985752 CCACCCAGGCTGGAGTTTGGTGG + Intronic
1124379501 15:29153235-29153257 AAAGACAAGCTACAGTCTGGGGG - Intronic
1125800388 15:42441301-42441323 ACACTCAGGCTGGAGTATGGTGG - Intronic
1127723357 15:61724564-61724586 TCACAAAAGCTTGAGTTTGATGG - Intergenic
1129040074 15:72678333-72678355 TCACCCAGGCTGGAGTTTGGTGG + Intronic
1130638332 15:85646385-85646407 CCACCCAGGCTAGAGTTTAGTGG - Intronic
1131297109 15:91158842-91158864 ATACACAGCCTAGAGATTGGGGG - Intronic
1131841663 15:96443701-96443723 ACACACAACCTACAGAATGGGGG - Intergenic
1133567705 16:7010587-7010609 TCACCCAGGCTAGAGTGTGGTGG + Intronic
1134272890 16:12749627-12749649 ACACCCAGGCTAGAGTGTAGTGG + Intronic
1134289087 16:12888925-12888947 TCACCCAAGCTGGAGTGTGGTGG - Intergenic
1134371118 16:13625869-13625891 TCACACAGGCTGGAGTGTGGTGG + Intergenic
1134747089 16:16596714-16596736 TCACCCAAGCTGGAGTGTGGTGG - Intergenic
1135516798 16:23142605-23142627 ACCCACTAGCTAGAGGTTGAGGG - Intronic
1135560667 16:23474395-23474417 TCACCCAGGCTAGAGTGTGGTGG + Intronic
1135623746 16:23977784-23977806 ACAGACAAGCTAGAGTTCAGGGG - Intronic
1136513697 16:30755200-30755222 TCACACAGGCTGGAGTGTGGTGG - Intronic
1137266117 16:46870369-46870391 TCACCCAAGCTGGAGTTCGGTGG - Intergenic
1137474641 16:48797147-48797169 ACTCAGTAGTTAGAGTTTGGGGG - Intergenic
1137657413 16:50171998-50172020 TCACACAGGCTAGAGTGTGGTGG - Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1141866892 16:86756533-86756555 TCACCCAGGCTAGAGTGTGGTGG + Intergenic
1142967230 17:3589244-3589266 TCACACAGGCTAGAGTGCGGTGG + Intronic
1143534910 17:7532271-7532293 TCACACAGGCTGGAGCTTGGTGG - Intergenic
1144574259 17:16418989-16419011 ACACCCAGGCTGGAGTATGGTGG - Intronic
1145907236 17:28523232-28523254 AGTCACAGGTTAGAGTTTGGAGG + Intronic
1146008009 17:29173809-29173831 TCACCCAGGCTGGAGTTTGGTGG + Intronic
1146033527 17:29386985-29387007 ACACACATGCTAGAGTTCTCTGG - Intergenic
1146340497 17:32015181-32015203 ACACAGAAGATAGGGATTGGGGG + Intronic
1146418108 17:32655848-32655870 ACACACATGCTAGAGTAAGGTGG + Intronic
1147174882 17:38648930-38648952 TCACCCAAGCTAGAGTTCAGTGG + Intergenic
1147540682 17:41356159-41356181 ACAGACAAGCTAGAATGTGAAGG + Intergenic
1148121567 17:45215469-45215491 TCACACAGGCTGGAGTGTGGTGG + Intergenic
1148188339 17:45660796-45660818 TCTCCAAAGCTAGAGTTTGGGGG - Intergenic
1148738510 17:49878804-49878826 TCACCCAGGCTAGAGTGTGGTGG - Intergenic
1148787761 17:50153755-50153777 ACACAGAAGATAGGGTGTGGGGG + Intergenic
1149207892 17:54269306-54269328 ACACACTAGCTTTAGATTGGTGG + Intergenic
1149668435 17:58383327-58383349 TCACCCAGGCTAGAGTGTGGTGG + Intronic
1149824369 17:59814018-59814040 TCACCCAGGCTAGAGTGTGGTGG + Intronic
1150316783 17:64175624-64175646 TCACCCAGGCTGGAGTTTGGTGG + Intronic
1150737354 17:67751885-67751907 TCACACAGGCTGGAGTGTGGTGG - Intergenic
1150749587 17:67847745-67847767 ACACAGAAGATAGGGATTGGGGG + Intronic
1151021046 17:70617758-70617780 ACACACCAGATGGAGGTTGGAGG + Intergenic
1151231302 17:72687065-72687087 TCACCCAGGCTGGAGTTTGGTGG + Intronic
1152559315 17:81069999-81070021 TCACTCAGGCTAGAGTGTGGTGG + Intronic
1152591497 17:81215449-81215471 TCACCCAGGCTAGAGTGTGGTGG + Intronic
1153002753 18:470713-470735 TCACTCAAGCTAGAGTTCAGTGG - Intronic
1153562770 18:6387957-6387979 ACACACTATCTAGAGTGTGGAGG + Intronic
1154247147 18:12709364-12709386 TCACACAGGCTGGAGTGTGGTGG + Intronic
1155299182 18:24413092-24413114 ACAGTCAAGCTCGAGTTTGAAGG - Intergenic
1155793072 18:29998035-29998057 TCCCACGAGCTAGAGTTTAGTGG - Intergenic
1157586962 18:48807149-48807171 ACACACAGGCTGGGTTTTGGTGG + Intronic
1158128213 18:54125090-54125112 TCACCCAGGCTAGAGTTTAGTGG - Intergenic
1158212580 18:55067719-55067741 ACACAAAAGCCAGAGGTTGGAGG + Intergenic
1159280498 18:66278889-66278911 TCACCCAGGCTAGAGTGTGGTGG + Intergenic
1159405515 18:67997633-67997655 AAACACAAGCCAGCCTTTGGAGG + Intergenic
1159774026 18:72583416-72583438 ACACTCATGCTATACTTTGGGGG + Intronic
1160463549 18:79057291-79057313 ATACACAGGCTTGAGGTTGGAGG - Intergenic
1161087640 19:2342611-2342633 TCACCCAGGCTGGAGTTTGGTGG - Intronic
1161274867 19:3410284-3410306 ACACACATGCTAGTGTTGAGAGG - Intronic
1161292783 19:3504452-3504474 ACACCCAAGGTGGAGTGTGGTGG + Intergenic
1161902421 19:7129362-7129384 ACACCCAGGCTAGAGTTCAGTGG + Intronic
1162203878 19:9041189-9041211 TCACTCAAGCTAGAGTGCGGTGG - Intergenic
1162209791 19:9082159-9082181 TCACCCAAGCTGGAGTGTGGTGG + Intergenic
1162215915 19:9133766-9133788 ACACCCAGGCTTGAGTGTGGTGG - Intergenic
1162537355 19:11271014-11271036 TCACCCAAGCTGGAGTGTGGTGG + Intergenic
1163412996 19:17168502-17168524 ACACACGAGCTTGGGTTTTGTGG - Intronic
1163563205 19:18033272-18033294 AAACACAGGCAGGAGTTTGGAGG - Intergenic
1165219349 19:34302332-34302354 TCACACAAGCTGGAGTGTAGTGG + Intronic
1165242354 19:34479014-34479036 TCACCCAGGCTAGAGTGTGGTGG + Intergenic
1167089379 19:47332932-47332954 CTACACATGCTACAGTTTGGTGG - Intronic
1167688953 19:50973787-50973809 TCATCCAGGCTAGAGTTTGGTGG - Intergenic
1167884725 19:52491407-52491429 TCACCCAAGCTGGAGTGTGGTGG - Exonic
1167914445 19:52728726-52728748 TCACCCAAGCTGGAGTGTGGTGG + Exonic
1167994537 19:53391670-53391692 TCACTGAAGCTAGAGTGTGGTGG - Intronic
1168003065 19:53464332-53464354 ACACCCAGGCTAGAGTGTGGTGG - Intergenic
926035777 2:9634557-9634579 ACCCACAGGCCAGAGTTGGGGGG - Intergenic
926555846 2:14356872-14356894 CTACACAGGCTAGAGTGTGGTGG - Intergenic
927003817 2:18826844-18826866 ACACACCAGGAACAGTTTGGGGG - Intergenic
927511259 2:23645086-23645108 CCACCCAGGCTTGAGTTTGGAGG - Intronic
927603219 2:24462643-24462665 TCACTCAAGCTGGAGTGTGGAGG - Intergenic
927629535 2:24760548-24760570 ACTGCCAAGCTAGAGTTTAGGGG - Intronic
928136953 2:28694981-28695003 CTACACAGGCTAGAGTGTGGTGG - Intergenic
929134121 2:38606405-38606427 ACACCCAGGCTAGAGTGTAGTGG - Intergenic
929342554 2:40839103-40839125 ACACACAATCTAGAATTTTATGG + Intergenic
930712554 2:54562681-54562703 ACACACAAAGCAGGGTTTGGTGG - Intronic
931619932 2:64199690-64199712 ACAAACTGGCTAGAGTTTGATGG + Intergenic
931717226 2:65038686-65038708 ACACCCAAGCTGGAGTTCAGTGG - Intergenic
932175714 2:69599074-69599096 ACACACAGACTAGAGACTGGAGG + Intronic
933388819 2:81645366-81645388 ACACATGAGCCAGAGTTTGGAGG + Intergenic
934015303 2:87874150-87874172 ACAGACAACCTAGAGAATGGGGG - Intergenic
935338605 2:102039467-102039489 ACACACAATCTATAGAATGGGGG - Intergenic
936060791 2:109294519-109294541 TCACACAAGCTGGAGTGTAGTGG - Intronic
936927698 2:117754580-117754602 ACACACATGCTGGAGTTGGTGGG + Intergenic
936941079 2:117884772-117884794 TCACCCAGGCTAGAGTGTGGTGG - Intergenic
937378317 2:121353175-121353197 AAACACAAGCTAGGTGTTGGTGG + Intronic
937882277 2:126877373-126877395 AAACACAAGAGAGAGTTTGAAGG + Intergenic
938826694 2:135012934-135012956 ACAAACAAACAAGGGTTTGGGGG - Intronic
939286665 2:140140196-140140218 AGATAAAAGCTAGAGTTTTGAGG + Intergenic
939577714 2:143916063-143916085 ACACACATGAAAGTGTTTGGGGG - Intergenic
940007138 2:149018247-149018269 TCACCCAGGCTAGAGTGTGGTGG - Intronic
941395261 2:164965997-164966019 CCACAGAAGCTAGTTTTTGGTGG + Intergenic
942230222 2:173853902-173853924 TCACCCAGGCTAGAGTTTAGTGG - Intergenic
944204571 2:197144063-197144085 AAACAGAAGCTAGAGTCAGGAGG + Intronic
944993778 2:205270525-205270547 TCACACAGGCTGGAGTGTGGTGG - Intronic
946056908 2:216910539-216910561 ACTCACAGCCTAGATTTTGGTGG - Intergenic
946815582 2:223575175-223575197 ACACATGAGCTAGACTTTGAAGG + Intergenic
1169052867 20:2595410-2595432 ACACACAAGCTAGAGTTTGGAGG - Intronic
1169565775 20:6852127-6852149 TCACACAAGGGAGAATTTGGAGG + Intergenic
1169602034 20:7272611-7272633 AAACACAAGCTGGAGTTTAGTGG - Intergenic
1170695426 20:18653352-18653374 TCACCCAGGCTGGAGTTTGGTGG - Intronic
1174407784 20:50313228-50313250 AGAGACGAGCTAGAGTTTGCTGG + Intergenic
1175130647 20:56786983-56787005 TCACCCAAGCTGGAGTGTGGTGG + Intergenic
1175834315 20:61983623-61983645 TCACCCAGGCTGGAGTTTGGTGG - Intronic
1176729636 21:10480335-10480357 TCACCCAGGCTAGAGTGTGGTGG - Intergenic
1177909448 21:27012545-27012567 TCACCCAGGCTAGAGTGTGGTGG - Intergenic
1179006247 21:37517931-37517953 TCACGCAAGCTGGAGTTTGGTGG + Intergenic
1180624463 22:17184887-17184909 TCACCCAGGCTAGAGTGTGGTGG - Intronic
1181862109 22:25827020-25827042 TCACCCAGGCTAGAGTGTGGTGG - Intronic
1182467758 22:30528461-30528483 TCACTCAAGCTGGAGTTTAGTGG + Intronic
1183892813 22:40944635-40944657 ACACACAAACATGAGTGTGGTGG - Intergenic
1184923022 22:47618886-47618908 ACACACAACTCAGATTTTGGAGG + Intergenic
949327452 3:2882324-2882346 TCACCCAGGCTAGAGTGTGGTGG - Intronic
949462224 3:4305125-4305147 TCACCCAGGCTAGAGTGTGGTGG + Intronic
949824422 3:8150359-8150381 TCACCCAAGCTGGAGTGTGGTGG + Intergenic
950370390 3:12524489-12524511 ACAGACAAGGTAGAGACTGGAGG - Intronic
951040394 3:17982892-17982914 ACACATAAGCAAAAGTTTGGTGG + Intronic
952443145 3:33353846-33353868 TCACCCAGGCTAGAGTATGGTGG - Intronic
952797259 3:37251722-37251744 TCACCCAGGCTAGAGTGTGGTGG + Intronic
954313542 3:49787995-49788017 TCACCCAGGCTAGAGTGTGGTGG - Intergenic
957575832 3:82007177-82007199 ACACACAACCTACAGAATGGGGG - Intergenic
958538531 3:95436281-95436303 ATACAAAAGCTAGAGGTTGAAGG - Intergenic
958539501 3:95452010-95452032 TCACCCAGGCTAGAGTGTGGTGG - Intergenic
959521392 3:107326559-107326581 AAACACAGGCAGGAGTTTGGAGG + Intergenic
960426264 3:117511478-117511500 TCACCAAGGCTAGAGTTTGGTGG + Intergenic
962878823 3:139556964-139556986 GCACATAAGGTAGAGTCTGGAGG + Intergenic
964156722 3:153594563-153594585 ACACACAATATAGAATTTGTAGG - Intergenic
965145281 3:164893539-164893561 ACACTCAAGCTTCAGTATGGGGG + Intergenic
966405792 3:179596689-179596711 TCACCCAGCCTAGAGTTTGGTGG + Intronic
966616335 3:181917301-181917323 ACCAACAACCTAGACTTTGGAGG + Intergenic
966696803 3:182798095-182798117 TCACCCAGGCTAGAGTGTGGTGG - Intronic
966816183 3:183891913-183891935 TCACCCAGGCTAGAGTGTGGTGG + Intergenic
967765974 3:193279947-193279969 ACACAGAAGCTAGAGAGTGTTGG - Intronic
968796075 4:2705627-2705649 TCACCCAGGCTAGAGTGTGGTGG + Intronic
969416660 4:7064832-7064854 TCACCCAAGCTACAGTATGGTGG + Intronic
970870630 4:20812910-20812932 ACACACAAACAAGAAATTGGAGG - Intronic
971168420 4:24208241-24208263 TCACCCAGGCTGGAGTTTGGTGG - Intergenic
971228333 4:24776262-24776284 TCACCCAGGCTAGAGTGTGGTGG - Intergenic
971672427 4:29579968-29579990 TCACACAGGCTGGAGTGTGGTGG - Intergenic
972267410 4:37475163-37475185 ACACAAAAGGTTGGGTTTGGAGG + Intronic
972470455 4:39398879-39398901 TCACCCAGGCTGGAGTTTGGTGG + Intergenic
973280948 4:48360550-48360572 TCACCCAAGCTAGAGTGTAGTGG - Intronic
973903421 4:55501455-55501477 TCACTCAGGCTAGAGTGTGGTGG + Intronic
975685177 4:76913574-76913596 ACATTCCAGCTAGTGTTTGGGGG - Intergenic
975692832 4:76982790-76982812 ACAAACTAGCTAGCCTTTGGAGG - Intronic
975698455 4:77038177-77038199 ACATACAAACTAGACTTTGTAGG - Exonic
976109192 4:81652844-81652866 ACACATAAACTAGTGTTTGATGG + Intronic
976776673 4:88714141-88714163 TCACCCAGGCTAGAGTCTGGTGG + Intergenic
977073366 4:92421656-92421678 AAAAACAAGCTAGAGTTTGCTGG + Intronic
977259958 4:94786404-94786426 TCACCCAAGCTAGAGTGTGGTGG + Intronic
977391772 4:96419081-96419103 TCACCCAGGCTAGAGTATGGTGG + Intergenic
977690040 4:99895330-99895352 TCACACAAGCTGGAGTTCAGTGG - Intergenic
979416386 4:120445541-120445563 ACACCCAGGCTGGAGTGTGGTGG + Intergenic
980269523 4:130565785-130565807 ACACTCAAGCTATAGTTTGCTGG - Intergenic
980907893 4:138966217-138966239 TCACCCAGGCTAGAGTGTGGTGG + Intergenic
982015830 4:151152873-151152895 TCACCCAAGCTAGAGTGTAGTGG + Intronic
982604655 4:157499126-157499148 AAACAAATGCTATAGTTTGGAGG + Intergenic
983427415 4:167604086-167604108 ACACCAAATCTAGAGTTTGCTGG + Intergenic
984492090 4:180447028-180447050 TCACCCAGGCTGGAGTTTGGTGG - Intergenic
985948228 5:3202903-3202925 ACACAAAAATTAGAGTTTGAGGG - Intergenic
986088535 5:4478708-4478730 TTGCCCAAGCTAGAGTTTGGTGG + Intergenic
988081354 5:26418429-26418451 TCACCCAAGCTAGAATTTGGGGG - Intergenic
988476583 5:31591309-31591331 TCACCCAGGCTGGAGTTTGGTGG - Intergenic
988682612 5:33498462-33498484 TCACCCAAGCTGGAGTGTGGTGG - Intergenic
989585066 5:43068071-43068093 ACACTCATGGTAGAGTCTGGAGG - Intronic
989802342 5:45558806-45558828 TCACCCAGGCTAGAGTGTGGTGG + Intronic
990973136 5:61531609-61531631 ACACACAAGAGAAAGTTTGCCGG + Exonic
992272542 5:75080056-75080078 TCACACAGGCTGGAGTGTGGTGG - Intronic
992842935 5:80714173-80714195 TCACCCAGGCTAGAGTGTGGTGG + Intronic
992850650 5:80804377-80804399 ACAAACAAGCTAGACTGTGAAGG - Intronic
994088063 5:95781808-95781830 TCACCCAAGCTTGAGTGTGGTGG - Intronic
994433738 5:99702111-99702133 TCACCCAAGCTAGAGTGTAGTGG + Intergenic
994668760 5:102740748-102740770 TCACCCAGGCTAGAGTGTGGTGG - Intergenic
995425997 5:112023390-112023412 ACAAATAAGCTGGAGTCTGGTGG - Intergenic
995448553 5:112274238-112274260 TCACACAGGCTAGAGTGTAGTGG - Intronic
996394495 5:122999721-122999743 ACACACATGCTAGGGATTGCCGG - Intronic
997299312 5:132790850-132790872 TCACACAGGCTATAGTTTAGTGG + Intronic
997403557 5:133622837-133622859 AAAAACAAGCTAGAGACTGGAGG - Intergenic
998452009 5:142241948-142241970 TCACCCAAGCTGGAGTATGGTGG + Intergenic
998465051 5:142337039-142337061 TCACCCAGGCTAGAGTGTGGTGG - Intergenic
998885105 5:146685895-146685917 ACATACAAGCTAGATTTTGGTGG - Intronic
999461644 5:151761900-151761922 TCACACAGGCTGGAGTGTGGTGG - Intronic
999641259 5:153675429-153675451 ACAAACAAAATAGATTTTGGTGG - Intronic
999754833 5:154656651-154656673 TCACTCAAGCTGGAGTGTGGTGG + Intergenic
999888740 5:155953319-155953341 ACAGACAGGCTATAGTTTGCAGG - Intronic
1002185656 5:177453702-177453724 CCACTCAGGCTAGAGTTTTGTGG + Intronic
1004037330 6:11935938-11935960 TCACCCAGGCTAGAGTGTGGTGG - Intergenic
1004576183 6:16897471-16897493 TCACCCAAGCTAGAGTTCGGTGG - Intergenic
1004670575 6:17792618-17792640 ACACACAAGGAAAAGTCTGGTGG + Intronic
1005168416 6:22952815-22952837 ACACACACCCTTGAGTCTGGAGG - Intergenic
1005497149 6:26397739-26397761 TCACACAGGCTAGAGTTCAGTGG + Intergenic
1005564024 6:27070744-27070766 ACGCACAAACTTGAGTTTGGAGG - Intergenic
1006498849 6:34444267-34444289 TCACCCAGGCTAGAGTGTGGTGG - Intergenic
1007299070 6:40852683-40852705 ACACAAAATCTTGAGTTTGGAGG + Intergenic
1007900488 6:45407071-45407093 AAACACAATCTTGAATTTGGGGG + Intronic
1008814888 6:55553396-55553418 TCACCCAGGCTGGAGTTTGGTGG - Intronic
1009473462 6:64057869-64057891 TCACCCAGGCTGGAGTTTGGTGG + Intronic
1010799944 6:80163484-80163506 GAAAACAAGCCAGAGTTTGGAGG - Intronic
1011099295 6:83704808-83704830 GCACAAAATATAGAGTTTGGGGG - Intronic
1011292829 6:85794120-85794142 TCACACAAGAAAGAATTTGGGGG + Intergenic
1011679919 6:89773252-89773274 ACACACAAGGCAGAGCATGGTGG + Intronic
1012936061 6:105368528-105368550 ACATACAAGTGAGAGTATGGGGG - Intronic
1013498360 6:110721374-110721396 ACAAACCATCCAGAGTTTGGAGG + Intronic
1013779016 6:113709919-113709941 TCACCCAGGCTAGAGTGTGGTGG - Intergenic
1015283582 6:131459707-131459729 TCACCCAGGCTAGAGTGTGGTGG - Intergenic
1015453698 6:133400466-133400488 TCACCCAAGCTAGAGTTCAGTGG - Intronic
1016439356 6:144067537-144067559 TCACTCAGGCTGGAGTTTGGTGG + Intergenic
1017385190 6:153874965-153874987 TCACACAAGCTAGAGTGCAGTGG + Intergenic
1017664910 6:156710164-156710186 TCACCCAGGCTGGAGTTTGGTGG - Intergenic
1018163688 6:161073753-161073775 ACACACAAGCTATACTTTCAGGG - Intronic
1018563535 6:165127730-165127752 ACACACATCTTACAGTTTGGTGG - Intergenic
1020828891 7:13067836-13067858 ACAGAGAAGCTACATTTTGGAGG + Intergenic
1021551654 7:21877422-21877444 ATACACATGCCAAAGTTTGGAGG - Intronic
1021618415 7:22526288-22526310 ACACACAACCTAGAGAATGCGGG + Intronic
1021952863 7:25792281-25792303 ACAGAAAAGCTAAATTTTGGGGG - Intergenic
1022289096 7:28984104-28984126 ACAAACAACCCACAGTTTGGTGG - Intergenic
1024781069 7:52848520-52848542 TCACACAAGCTAGAGTGCAGTGG - Intergenic
1026848988 7:73713191-73713213 ACATCCAAGCTAGAGCCTGGTGG + Intronic
1026995872 7:74616099-74616121 TCACTCAAGCTGGAGTTTGGTGG + Intergenic
1027290654 7:76707045-76707067 TCACCCAGGCTAGAGTGTGGTGG + Intergenic
1027402923 7:77827392-77827414 TCACCCAGGCTAGAGTGTGGTGG + Intronic
1028374267 7:90129833-90129855 ACACACAACCTACAGAATGGGGG - Intergenic
1029642017 7:101826867-101826889 ACACACAAGGCAGAGAGTGGGGG - Intronic
1030437807 7:109547356-109547378 TCACCCAAGCTAGAGTGTAGTGG + Intergenic
1032335675 7:131022407-131022429 TCACCCAGGCTAGAGTGTGGTGG + Intergenic
1032412129 7:131703329-131703351 ACAGACAAGCTACAGACTGGAGG + Intergenic
1032962839 7:137059256-137059278 TCACCCAGGCTAGAGTTTAGTGG - Intergenic
1033229865 7:139588276-139588298 TCACCCAGGCTAGAGTGTGGTGG - Intronic
1034356824 7:150457317-150457339 ACACACACGCTGGAGGTTGCTGG - Intronic
1034641502 7:152607642-152607664 TCACCCAAGCTAGAGTGTAGTGG + Intergenic
1035822444 8:2608035-2608057 ACACACAATTTAGGGTTTTGTGG - Intergenic
1036940308 8:13045375-13045397 TCACCCAGGCTAGAGTGTGGTGG - Intergenic
1037060623 8:14505107-14505129 ACACCCAGGCTGGAGTGTGGTGG - Intronic
1037353968 8:17997994-17998016 TCACCCAGGCTAGAGTGTGGTGG - Intronic
1037486176 8:19349007-19349029 AAACACAAGCTAGAATTTCGAGG + Intronic
1037609073 8:20461297-20461319 TCACACAAGCTAGAGTGCAGTGG + Intergenic
1037632275 8:20668994-20669016 ACATACAAGCAATAGTTTGGAGG - Intergenic
1037724826 8:21474451-21474473 TCACCCAGGCTAGAGTTTAGTGG + Intergenic
1039656474 8:39413852-39413874 TCACCCAAGCTGGAGGTTGGTGG - Intergenic
1040504611 8:48035988-48036010 TCACCCAGGCTAGAGTGTGGTGG + Intronic
1042166993 8:65955406-65955428 TCACCCAAGCTGGAGTGTGGTGG - Intergenic
1044270082 8:90231482-90231504 TCACTCAGGCTAGAGTGTGGTGG - Intergenic
1045159122 8:99516746-99516768 TCACCCAGGCTGGAGTTTGGTGG - Intronic
1045910104 8:107397426-107397448 ACACACAAGCAACATTTTTGAGG - Intronic
1046130657 8:109964057-109964079 ACAGACAACCTACAGATTGGGGG + Exonic
1046158259 8:110322681-110322703 TCACACAGGCTAGAGTTCAGTGG - Intergenic
1046473110 8:114704755-114704777 TCACCCAGGCTAGAGTTTAGTGG - Intergenic
1049678650 8:143905142-143905164 TCACCCAAGCTGGAGTCTGGTGG - Intergenic
1050390755 9:5141652-5141674 ACACACAACCTACAGAATGGGGG - Intronic
1051106656 9:13587949-13587971 ACAGACAAGGCAGAGTGTGGGGG + Intergenic
1052733101 9:32312457-32312479 TCACACAGGCTGGAGTGTGGTGG - Intergenic
1053349504 9:37403720-37403742 TCACCCAGGCTAGAGTGTGGTGG + Intergenic
1055031891 9:71778704-71778726 TCACCCAGGCTAGAGTGTGGTGG - Intronic
1055622449 9:78140763-78140785 TCACTCTGGCTAGAGTTTGGTGG + Intergenic
1055623197 9:78147136-78147158 TCACACAGGCCAGAGTGTGGTGG + Intergenic
1055777079 9:79778174-79778196 ACACACAGGCTAGAGTGCAGTGG - Intergenic
1055900283 9:81226365-81226387 TCACCCAGGCTAGAGTATGGTGG - Intergenic
1059367647 9:113799212-113799234 TCACCCAAGCTCGAGTTCGGTGG - Intergenic
1059535118 9:115073561-115073583 AGAATCAACCTAGAGTTTGGAGG + Intronic
1060569158 9:124622174-124622196 TCACCCAAGCTGGAGTGTGGTGG - Intronic
1061494964 9:130968090-130968112 TCACACAGGCTGGAGTGTGGTGG + Intergenic
1061550699 9:131333018-131333040 TCACCCAAGCTGGAGTGTGGTGG + Intergenic
1203584636 Un_KI270746v1:53740-53762 TCACCCAGGCTAGAGTGTGGTGG + Intergenic
1186463785 X:9768638-9768660 TCACCCAAGCTGGAGTTTGGTGG - Intronic
1187867114 X:23733616-23733638 TCACCCAGGCTAGAGTTCGGTGG + Intronic
1188323197 X:28765992-28766014 ACAGACATGCTACACTTTGGTGG - Intronic
1188961410 X:36496852-36496874 TCACACAAGCTGGAGTGTAGTGG - Intergenic
1189894369 X:45638905-45638927 ACACACAACCTACAGAATGGGGG + Intergenic
1190323708 X:49193618-49193640 ACACACAAGCTCAAGCTGGGAGG - Intronic
1190825353 X:54013076-54013098 TCACCCAAGCTGGAGTGTGGTGG - Intronic
1192118930 X:68436654-68436676 TCACCCAGGCTAGAGTGTGGTGG + Intergenic
1192387406 X:70685324-70685346 ACACCCAAGCTAGAGTGTGGTGG - Intronic
1193782985 X:85725880-85725902 ACTAACAAGCTAGAGACTGGAGG - Intergenic
1194202616 X:90973326-90973348 ACACCCAGGCTGGAGTGTGGTGG - Intergenic
1194889296 X:99357420-99357442 ACAGACAACCTAGAGAATGGGGG + Intergenic
1195616491 X:106916582-106916604 ACAAAAAAGCTAAATTTTGGAGG + Intronic
1195731403 X:107971680-107971702 ACTCACTAGCTATAGTTTGCTGG - Intergenic
1196178770 X:112668149-112668171 ACACAAGAGAAAGAGTTTGGGGG - Intronic
1196353457 X:114760554-114760576 TCACCCAGGCTAGAGTGTGGTGG + Intronic
1196391862 X:115215719-115215741 TCACCCAGGCTAGAGTTTTGTGG - Intronic
1198743571 X:139866677-139866699 TCACCCATGCTAGAGTGTGGTGG - Intronic
1199129179 X:144164359-144164381 ACAGACAACCTAGAGAATGGGGG + Intergenic
1200248658 X:154540596-154540618 TCACCCAGGCTGGAGTTTGGTGG - Intronic
1201109451 Y:10788557-10788579 ACAAACAGGCTAGAGTGTAGTGG + Intergenic
1201517819 Y:14836522-14836544 TCACACAGGCTGGAGTGTGGTGG + Intronic