ID: 1169055909

View in Genome Browser
Species Human (GRCh38)
Location 20:2620833-2620855
Sequence CTTTAAAACTTAATGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 284}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169055906_1169055909 -2 Left 1169055906 20:2620812-2620834 CCCAGAGGATTATTCTCAGGACT 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1169055909 20:2620833-2620855 CTTTAAAACTTAATGGAGCTTGG 0: 1
1: 0
2: 0
3: 21
4: 284
1169055907_1169055909 -3 Left 1169055907 20:2620813-2620835 CCAGAGGATTATTCTCAGGACTT 0: 1
1: 0
2: 0
3: 14
4: 128
Right 1169055909 20:2620833-2620855 CTTTAAAACTTAATGGAGCTTGG 0: 1
1: 0
2: 0
3: 21
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169055909 Original CRISPR CTTTAAAACTTAATGGAGCT TGG Intronic
900170267 1:1264474-1264496 CTTTAAAACTAATGGGGGCTGGG + Intronic
901392264 1:8954318-8954340 TTATAAAACTTAATGGAGCATGG - Intronic
906586185 1:46980890-46980912 ATTTAAAAATAAATGGTGCTGGG + Intergenic
907632275 1:56094774-56094796 CTTCAGAAATTAATGGAGATGGG + Intergenic
909418844 1:75439420-75439442 ATTAAAAACTCAATGGATCTAGG + Intronic
910067467 1:83170607-83170629 CTTCAAAAATTAATGAATCTAGG + Intergenic
910082058 1:83353390-83353412 CTTCAAAAATTAATGAATCTAGG - Intergenic
910955641 1:92701167-92701189 CTTTAAAACTCAAAGCAGTTGGG + Intronic
911369056 1:96974546-96974568 CTTTAAATCTTAATGATGTTCGG - Intergenic
911537322 1:99116059-99116081 CTTAAAATTTTGATGGAGCTAGG - Intergenic
911733524 1:101313307-101313329 GTTTTAAACTGAATGGTGCTAGG - Intergenic
912986036 1:114432038-114432060 CATTAAAAAATAATGGAGATAGG + Intronic
913006558 1:114638461-114638483 CTTAAAAATTAAATGGAGCTGGG + Intronic
913252607 1:116924439-116924461 CTTTAAAACTACATGCAGGTTGG - Intronic
914363020 1:146952393-146952415 CTTCAAAACATAATTGAGCGAGG + Intronic
914371907 1:147032957-147032979 CTTTAAAACTTACTGAACCCAGG + Intergenic
915628096 1:157128968-157128990 TCTTAAAACTTAATGGAGAATGG + Intronic
916292928 1:163186362-163186384 CTTTAAAAAGAAATGGGGCTGGG - Intronic
916510950 1:165471966-165471988 CTTTAAAACTTAATGCACACTGG - Intergenic
917171645 1:172183036-172183058 CTTTTTAACTAAAGGGAGCTAGG + Intronic
917644702 1:177018557-177018579 GATTAAAACTTAATTTAGCTGGG + Intronic
919520012 1:198576487-198576509 CTTTCCAACTTAATATAGCTGGG + Intergenic
920317655 1:205090147-205090169 TTTTAAAAATCAATGTAGCTGGG - Intronic
920922949 1:210313214-210313236 TTTTAAAACAGAATGGGGCTGGG - Intergenic
921728438 1:218550232-218550254 CTTCAGAACTTAGTGGAGCCTGG - Intergenic
1064527538 10:16273474-16273496 GTTTAAAACTGAATGTGGCTGGG + Intergenic
1065135603 10:22666121-22666143 CATCAAAACTTATTGGAGTTAGG - Intronic
1065410073 10:25416285-25416307 AATGAATACTTAATGGAGCTTGG - Intronic
1065653850 10:27925511-27925533 CTTTAAAAATTAGTTGAGCATGG - Intronic
1066289951 10:34004752-34004774 CTTTAAAACTTAGTGTGGCTTGG - Intergenic
1066762376 10:38768035-38768057 CTTTAAAAGTTAAAGTGGCTGGG + Intergenic
1068846461 10:61681454-61681476 TTTTATAACTCAATGGAGATAGG - Intronic
1068891655 10:62154600-62154622 CTTTAAAACTTTCTGGAACTGGG - Intergenic
1070631092 10:78085312-78085334 CTTTAAAAATTAGCTGAGCTTGG - Intergenic
1070671363 10:78379822-78379844 TTTGAAAACTTAATGGTGCCTGG + Intergenic
1072174288 10:92901670-92901692 CATTAATACTAAAAGGAGCTAGG - Intronic
1072917056 10:99544200-99544222 CTTTAAAAAATAATTCAGCTTGG - Intergenic
1073015266 10:100393906-100393928 CTTAAAAACTCAATAGGGCTGGG - Intergenic
1075534216 10:123256565-123256587 CTTTAAAACCTTCTGGGGCTGGG - Intergenic
1076069343 10:127474180-127474202 CATTAAACATTAAAGGAGCTAGG + Intergenic
1078703379 11:13713081-13713103 CATTAAAACTTCAGGGAACTTGG - Intronic
1081703936 11:45169407-45169429 CTTTAACACTTTATGCAACTGGG + Intronic
1082570993 11:54739951-54739973 CTTTATAAATTAATGAATCTGGG + Intergenic
1083211344 11:61189037-61189059 ATTTAAAAATTAATGGGGCATGG - Intergenic
1084813147 11:71627943-71627965 GCTTAAAACTTTATGAAGCTGGG + Intergenic
1085175450 11:74482842-74482864 TCTTAAAACTTATTGGAGATTGG + Intergenic
1085380769 11:76115978-76116000 CTGAAAAACTTCATGGAGCATGG + Exonic
1087892404 11:103550372-103550394 CTTTAAAAATTAATGGGCTTAGG - Intergenic
1087905767 11:103695153-103695175 CCTTACAACATCATGGAGCTGGG - Intergenic
1088345673 11:108822023-108822045 TCTTAAAACTTAATGGAAATTGG - Intronic
1089244487 11:117109059-117109081 CTTAAAAACTAAATGGGGCCAGG - Intergenic
1089757516 11:120697318-120697340 CTATAAGAGTTTATGGAGCTGGG + Intronic
1089799410 11:121013020-121013042 CCTTAAAACTGAATGAGGCTGGG + Intergenic
1089906785 11:122048220-122048242 GTTTAAAATTTAATGGGGCCGGG - Intergenic
1090797270 11:130146045-130146067 GGTTAAGACTAAATGGAGCTGGG - Intergenic
1094566964 12:31607872-31607894 CTTTAAAAATTAGTAGAGATTGG + Intergenic
1095775985 12:46010747-46010769 CTTTAAAACTTACTTGGGATTGG - Intergenic
1096303317 12:50451400-50451422 CTTTAAGACTGAATGGGTCTGGG + Intronic
1096304012 12:50458423-50458445 TATTAAAACTTAAAGTAGCTGGG - Intronic
1099979573 12:89583058-89583080 CTTTAAAACATACTGGTGCCAGG - Intergenic
1100316362 12:93448500-93448522 CTATAAAAGTAAATGGAGCCGGG + Intergenic
1101097623 12:101359359-101359381 CTTTAAAAAATACTGGGGCTGGG - Intronic
1101377965 12:104187402-104187424 TTTTAAAATTTAATGTAGCAAGG - Intergenic
1103347142 12:120258762-120258784 ATTTAAAACTAAGTTGAGCTGGG + Intronic
1105012358 12:132764230-132764252 CTTAATAACTTAATGGAGAGTGG - Intergenic
1105860060 13:24401312-24401334 TCTTAAAACTTATTGGAGATTGG + Intergenic
1106877762 13:34093512-34093534 CTTTAAAACCTAATGGAAATTGG + Intergenic
1107057754 13:36125480-36125502 CTTTTAAAATTAATGCAGCATGG + Intronic
1107155061 13:37156217-37156239 CTTTAAAACATAATGTTGATTGG - Intergenic
1107603215 13:42034065-42034087 GTTTAAAAATTAGTGAAGCTTGG - Intergenic
1107631175 13:42344138-42344160 CTCCAAAACTCAATGGACCTGGG - Intergenic
1108185659 13:47886050-47886072 CTTTAAAAAAAAATGGAGTTAGG + Intergenic
1109684500 13:65798185-65798207 ATTTAAAACAGAATGGAGATAGG + Intergenic
1111450193 13:88405273-88405295 ATTTAAGACATAATGAAGCTGGG + Intergenic
1113418702 13:110152764-110152786 CTTTAAACTCTAATGAAGCTGGG - Intronic
1114497414 14:23142654-23142676 ATTTAAAAATTAATGGGGCATGG - Intronic
1115323677 14:32113554-32113576 CCTTATAACTTTATGGACCTTGG + Intronic
1115695404 14:35892516-35892538 TCTTAAAACTTATTGGAGATTGG - Intronic
1115705772 14:35996541-35996563 ATTTATACCTTAATAGAGCTGGG - Intergenic
1116552814 14:46264096-46264118 TTTAAAAAATTAATGGATCTAGG - Intergenic
1117584630 14:57187686-57187708 CATTAAATCTTAATGAAGATTGG - Intergenic
1120630845 14:86888184-86888206 CTTTACAACAAAATGGTGCTGGG + Intergenic
1120889903 14:89482611-89482633 CTAAAAAAATGAATGGAGCTGGG + Intronic
1122496460 14:102159536-102159558 TCTTAAAACTTAATCCAGCTGGG + Intronic
1123216621 14:106814011-106814033 CTCTAATGCTTAATGAAGCTAGG + Intergenic
1125221769 15:37345380-37345402 ATTTTAAACTTAATGCAACTAGG - Intergenic
1126029690 15:44483963-44483985 ATGGAAAACTTAATGGACCTTGG + Intronic
1126222631 15:46232064-46232086 CTTGAAGACTTAAAGGAGGTAGG - Intergenic
1127603136 15:60558654-60558676 CCTTAAAACCTATTGGAGATTGG + Intronic
1128499217 15:68215625-68215647 ATTTAAAAATTAATGGTGCTTGG - Intronic
1129549784 15:76435770-76435792 CTTCAAAACTTAAAGGATATGGG - Intronic
1130788290 15:87124097-87124119 ATTTTAAACTCAATGGAGCCCGG + Intergenic
1131211879 15:90504632-90504654 CTTTAAAAATGAATGAAGGTGGG - Intergenic
1131819874 15:96261376-96261398 CTTAAAAACTTGATGGTGTTTGG + Intergenic
1133911756 16:10072451-10072473 CTTTAAAAACTACTGAAGCTGGG + Intronic
1134447509 16:14342177-14342199 CTTTAAAAAATAATAGAGATGGG + Intergenic
1135595107 16:23736284-23736306 CTTTAAAAATTAGCGGAGCTTGG - Intergenic
1135796897 16:25454021-25454043 TCTTAAAACTTACTGGAGATTGG - Intergenic
1137496383 16:48972270-48972292 CTTTAAGAAGTACTGGAGCTGGG + Intergenic
1139382618 16:66543172-66543194 CTTTAAAAGTTACTGAGGCTTGG - Intronic
1142578392 17:924769-924791 TTTTAAAACTGAATGAGGCTTGG - Intronic
1143341843 17:6217422-6217444 CTTTATAACTAAATGCATCTTGG + Intergenic
1145000109 17:19298663-19298685 CTTTAAAACTAAGTGTTGCTGGG - Intronic
1145850377 17:28088319-28088341 CTTAACAAATTAATGGATCTAGG - Intronic
1146083131 17:29801158-29801180 AATTAATACTTAATGGAGCCAGG - Intronic
1146178665 17:30683365-30683387 TTTTAAAAATTAGTGGGGCTTGG - Intergenic
1146267403 17:31461964-31461986 CTTTAAAAACTAATGTGGCTGGG + Intronic
1148151823 17:45401457-45401479 CTCTAGAACTGAATGGAGCTTGG + Intronic
1148995902 17:51709455-51709477 CTTTAAATCTTCATGTGGCTGGG - Intronic
1149675854 17:58460921-58460943 ATTTAAAACATAATGGGGCCAGG + Intronic
1150410674 17:64938471-64938493 TTCTAGAACTGAATGGAGCTTGG - Intergenic
1152237322 17:79145374-79145396 CTTTAAAACATACTGGTGCCTGG + Intronic
1153143709 18:2003696-2003718 ATTTTAAACTAAATGGAGATGGG + Intergenic
1153912251 18:9714569-9714591 CTTTAAAATTTAATTAAGCCTGG + Intronic
1154130929 18:11736387-11736409 CTTTAAAAAATAATAGAGATAGG - Intronic
1154360332 18:13655427-13655449 CTTTGAATCTTAATAGACCTGGG + Intergenic
1158139123 18:54238459-54238481 TTTTAAAACTAGATGGACCTAGG - Intergenic
1159503253 18:69300801-69300823 TCTTAAAACTTATTGGAGATTGG + Intergenic
1162047156 19:8007636-8007658 ATTTAACATTTAATTGAGCTAGG - Intronic
1162244788 19:9390883-9390905 TATTAAAAATTAATGGATCTAGG + Intergenic
1162979947 19:14232207-14232229 TTTTAAAAATTAGTGGGGCTTGG + Intergenic
1164923595 19:32108451-32108473 TTTTAAAATTTAATAGAGCCAGG + Intergenic
926438287 2:12859986-12860008 CTATTAAACTTAAAGGAGCCAGG + Intergenic
927337615 2:21943263-21943285 CTTTAAAAATTACTGGTGTTTGG - Intergenic
929965637 2:46533572-46533594 CTTTAAAACATAATTGACCTTGG - Intronic
931311139 2:61082033-61082055 TTTTAAAATTAAATGGAGATGGG + Intronic
933192926 2:79357029-79357051 ATTAAAAACTCAATAGAGCTGGG + Intronic
933900995 2:86849997-86850019 TTTAAAAACTTAGTTGAGCTAGG - Intronic
934918925 2:98325943-98325965 CTTTTAAATTTATTGGAACTTGG - Intergenic
935514223 2:104016370-104016392 ATTAAAAAATTAATGGAGATAGG - Intergenic
935744325 2:106177494-106177516 CTTTAAAAATGCATGTAGCTAGG - Intronic
935779549 2:106499235-106499257 TTTAAAAACTTAGTTGAGCTAGG + Intergenic
936057711 2:109273353-109273375 CGTTAAGGCTCAATGGAGCTTGG - Intronic
936327845 2:111521180-111521202 CTCTAAAACTTAAAGAAGCTAGG + Intergenic
936666399 2:114601654-114601676 CTTTGAAACTTCGTGAAGCTTGG + Intronic
937400160 2:121575400-121575422 ATTAAAAAATTAATGTAGCTGGG - Intronic
938815486 2:134899826-134899848 TTTTAAAATTTAATGTATCTTGG - Intronic
940800244 2:158125042-158125064 CGTTAAAAGTTAATTGAGATGGG + Intronic
940990805 2:160094405-160094427 CTTCAAAAATAAATGGTGCTGGG + Intergenic
941015023 2:160345857-160345879 ATTTAAAACTTAAAGAAGGTTGG + Intronic
941101032 2:161295502-161295524 CTTCAAAACATAATTGGGCTGGG - Intergenic
942568532 2:177290174-177290196 CTTAAAAACTGAATGGAGTGGGG + Intronic
942637294 2:178021256-178021278 CATTAAGACTTAATGGAGGCTGG - Intronic
943794891 2:191979987-191980009 CTTTAAAATTTTATGTAGTTTGG + Intronic
945005583 2:205401827-205401849 CTTCACAACTAAATGGAGCTTGG + Intronic
946441474 2:219700694-219700716 TTTTAAAAATTATTGGGGCTGGG + Intergenic
947381120 2:229546327-229546349 TTTTAAAACTGAATGGTGGTTGG - Intronic
1169055909 20:2620833-2620855 CTTTAAAACTTAATGGAGCTTGG + Intronic
1171450939 20:25235932-25235954 CATTAAAACTCCATGGAGCCAGG - Intergenic
1173114894 20:40231744-40231766 CTTTAAATTCTAATGGAGGTGGG + Intergenic
1173690560 20:44957796-44957818 CTTTAAAAATTAACTGGGCTTGG - Intronic
1174497494 20:50958747-50958769 CTAAAAAACTTTATGGAGCTTGG - Intergenic
1176418697 21:6496999-6497021 GTTTAAAACATAATGGCACTTGG - Intergenic
1179333653 21:40429562-40429584 CTTTAAAACTTGATGCAGGCTGG - Intronic
1179433336 21:41340841-41340863 ATTAAAAAATTAATGGAGATGGG - Intronic
1179694191 21:43105321-43105343 GTTTAAAACATAATGGCACTTGG - Intronic
1180300166 22:11030983-11031005 CTTTTAAAATTAATGGTGCATGG + Intergenic
1181315463 22:21968221-21968243 CTGTAAGACTTAATACAGCTAGG - Intronic
1182954238 22:34406370-34406392 TTTTAAAAATTAATTGGGCTGGG - Intergenic
1184549003 22:45194368-45194390 CTTTAAGACATATTGGGGCTGGG - Intronic
1184622023 22:45687599-45687621 CTTCAAAACTTCATGCAGATGGG + Intronic
949650682 3:6155565-6155587 CTTTAGAGCTAAAGGGAGCTTGG - Intergenic
949902052 3:8823744-8823766 CTTTAATACTTAAAGCAGCGTGG + Intronic
950059447 3:10057657-10057679 TCTTAAAACTTAATGGAGGCCGG - Intronic
950248248 3:11441536-11441558 CTTTAAAACATAATGCAGGCTGG - Intronic
950762146 3:15240907-15240929 CTTAAAAACATAATGGTGCCAGG + Intronic
950816759 3:15712043-15712065 TTTTAAAAATTAATGCAGATGGG - Intronic
951601833 3:24385327-24385349 CTTTAAATATTAGTGGAGGTTGG - Intronic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
954551470 3:51485208-51485230 CTTTAAGAATTAACAGAGCTGGG - Intronic
955375353 3:58390813-58390835 TTTTAATACTTAATGAACCTTGG + Intronic
956526554 3:70169382-70169404 CTTCAAAACTTTATGGATCTAGG + Intergenic
957007862 3:74971365-74971387 CTTTAAGAATGAATGGGGCTGGG - Intergenic
957360337 3:79148334-79148356 ATTTAAAAATTAAAGGAGCTGGG + Intronic
957575028 3:81996242-81996264 TTTAAAAAGTTATTGGAGCTGGG - Intergenic
957747390 3:84363230-84363252 CTTTAAAAATTAATGAATCCAGG - Intergenic
957783043 3:84844502-84844524 CTTTAAAACTTGATGCTGTTTGG - Intergenic
959244685 3:103850185-103850207 ATTTAAGACTTAATGGGGCTGGG - Intergenic
961320665 3:126071929-126071951 CTTTAAAAAATAATTTAGCTGGG - Intronic
961971137 3:130970014-130970036 CTTTAAAAAATATTGAAGCTTGG + Intronic
962131659 3:132685070-132685092 CTTTAAAAATTATTAGACCTAGG + Intronic
963775705 3:149436985-149437007 ATTTATAACTTAAGGCAGCTTGG - Intergenic
964045601 3:152321715-152321737 CTTTAAAATTTGATGGAGAAAGG - Intronic
964854946 3:161136716-161136738 TTTTAAAAATTAATTGAGCATGG + Intronic
967326718 3:188248008-188248030 CTTTAAAATGTAACTGAGCTTGG - Intronic
967398193 3:189030388-189030410 ATTTAAAACTTATTGGAGAAAGG - Intronic
969381656 4:6803252-6803274 CATTTGAACTTAAGGGAGCTGGG - Intronic
970462267 4:16286764-16286786 CTTTAAAAATTAATTTGGCTGGG + Intergenic
970590131 4:17552820-17552842 TTTAAAAACTAAATGGGGCTGGG + Intergenic
973036209 4:45410642-45410664 TTTAAAAACATAATGGGGCTGGG - Intergenic
975424242 4:74207904-74207926 CTTTGAAACCTAAAAGAGCTTGG - Intronic
977484670 4:97627153-97627175 CTTTATAACTTAATAAAGATTGG - Intronic
978192880 4:105935808-105935830 TTTTAAAACATAATGGAACTTGG + Intronic
978572354 4:110152154-110152176 CTTTAAAACTTAATATTGGTTGG + Intronic
979024317 4:115548600-115548622 CATTAAAATTTTATGGAGGTGGG + Intergenic
980621677 4:135314947-135314969 CTTTAAAACATAATTGAGCCAGG - Intergenic
980740086 4:136939137-136939159 CTTTCAAAATTACAGGAGCTTGG - Intergenic
982738389 4:159031158-159031180 CTTTCTAACCTATTGGAGCTTGG - Intronic
983614242 4:169684037-169684059 CTTTAAAATTTAATGTAGGCCGG - Intronic
984494864 4:180484064-180484086 CTTTTAAACTGAAAGGAACTGGG - Intergenic
984898375 4:184562379-184562401 CTTTAAAACTTTTTGTAGCCAGG - Intergenic
985659663 5:1150757-1150779 CTTAAATATTTCATGGAGCTCGG - Intergenic
986016247 5:3760062-3760084 GTTTAAAAGTTATTGGAGCTGGG + Intergenic
986780816 5:11064075-11064097 CTTTAGAACTTCAGGGAACTTGG + Intronic
988162272 5:27534148-27534170 CTTTCAAATAAAATGGAGCTTGG + Intergenic
991446501 5:66705882-66705904 CTTTAATACTTCTTGGAGGTAGG + Intronic
993432354 5:87847425-87847447 CTTTAAAAAAAAATGTAGCTTGG - Intergenic
993709801 5:91213549-91213571 CTTTAAAAGTTACTGGAGCCAGG - Intergenic
994729739 5:103477498-103477520 CTCTAAAAGTAAATGGAGATAGG - Intergenic
996093158 5:119370838-119370860 CATTAAAACTTTAGAGAGCTGGG + Intronic
996479293 5:123955537-123955559 TTTTAAAAATTAATAGTGCTTGG - Intergenic
999582319 5:153052591-153052613 CTTTAAAAAAGCATGGAGCTGGG + Intergenic
999611338 5:153373123-153373145 TTTTAAAAATTAATTGAGGTCGG + Intergenic
1000414751 5:160972118-160972140 CTTTAAAAAAAAATGGAGCCAGG - Intergenic
1001385971 5:171339009-171339031 CTTTAAAAATTACTGTAGCCGGG - Intergenic
1002078708 5:176725254-176725276 CTTAAAAGGTAAATGGAGCTGGG - Intergenic
1003627140 6:7752074-7752096 CCTTAAAACTTATTGGTCCTTGG + Intronic
1005002631 6:21258416-21258438 ATTTAAAACAGAGTGGAGCTAGG - Intergenic
1006240473 6:32673350-32673372 CTTTAAAATTGACTGCAGCTGGG + Intergenic
1006469590 6:34220368-34220390 TCTTAAAACTTACTGGAGATTGG + Intergenic
1006562809 6:34928161-34928183 CTGTAAATCTTGATGGAGATTGG + Intronic
1006669335 6:35720026-35720048 CTTTAAAACTAGAAGCAGCTCGG + Intronic
1006799899 6:36753096-36753118 CTTCAAAACAAAAGGGAGCTTGG + Intronic
1007976578 6:46107738-46107760 AGATAAAACTTAATGGGGCTGGG + Intergenic
1008366103 6:50682412-50682434 TTTTAAAACTCCATGGACCTGGG - Intergenic
1008804299 6:55409049-55409071 CATTGAAACTTGATGGAACTGGG + Intergenic
1008843282 6:55930386-55930408 GTTTAAAAAGTAATGGAGGTTGG - Intergenic
1008971854 6:57377673-57377695 ATTTAAAACTCAATGGAGTCAGG - Intronic
1009160773 6:60279197-60279219 ATTTAAAACTCAATGGAGTCAGG - Intergenic
1009501789 6:64422480-64422502 CTTTAAAACCTTATGGTACTTGG + Intronic
1009892075 6:69697259-69697281 CTTAAAAACATAAAGGAGTTTGG - Intronic
1010967047 6:82222766-82222788 ACTTAAAACTTTATGAAGCTGGG + Intronic
1011393104 6:86876006-86876028 CTTTAAAAATTAATGAATCCAGG + Intergenic
1011533957 6:88355557-88355579 CTTCAAAAATTAATGAATCTGGG + Intergenic
1011683409 6:89804525-89804547 CTTCAAGAGTTAAAGGAGCTGGG - Intronic
1015568814 6:134601206-134601228 TTTTAAAAATTAATTGAGCAAGG + Intergenic
1016700737 6:147051220-147051242 CTTTAAAAAGTAAAGAAGCTAGG - Intergenic
1017147403 6:151247086-151247108 CTTTAAAAATTAATTGGGCAGGG - Intronic
1018910827 6:168100260-168100282 CCTTAATACTTAATGGGGCAGGG + Intergenic
1019912639 7:4110072-4110094 CTTTAAATCTTAAGGGGACTGGG + Intronic
1021373595 7:19880601-19880623 CTTCAAAAATTAATGAATCTAGG - Intergenic
1021884247 7:25123383-25123405 TCTTAAAACTTACTGGAGATTGG - Exonic
1026120771 7:67535019-67535041 CCTTGAAACTTAATGCAGTTGGG + Intergenic
1027276638 7:76564149-76564171 CTTCAAAAATTAATGAATCTAGG - Intergenic
1028444601 7:90906321-90906343 CTTTATAAATTTATGGAGATAGG + Intronic
1028581640 7:92415224-92415246 CTTTGAAACTTACTGTAGCAGGG - Intergenic
1028692516 7:93669538-93669560 CTTTATAACCTTATGGAGCTGGG - Intronic
1028768411 7:94586796-94586818 ATTTAAAACTAAATGGAGGCTGG - Intronic
1028815067 7:95133982-95134004 ATTTAAAATTTAATGCACCTAGG - Intronic
1030285638 7:107824116-107824138 TTTTAAAACCTATTTGAGCTGGG - Intergenic
1030355830 7:108541046-108541068 TATTAAAACTCAATGGTGCTGGG - Intronic
1030758745 7:113323985-113324007 CTTTAAAACTTATTTTAGTTGGG + Intergenic
1030768306 7:113439978-113440000 CTTTGTGATTTAATGGAGCTTGG + Intergenic
1033712678 7:143964960-143964982 CCTAAAAAATTAATAGAGCTAGG - Intergenic
1034082772 7:148295785-148295807 CTTTAAAAATTAATTGAGGCCGG - Intronic
1034215145 7:149399525-149399547 CTTTAAAACTTACTTTAGATCGG - Intergenic
1035616811 8:1008058-1008080 CTTTAAAACTTATTCTAGCCTGG - Intergenic
1036093661 8:5698282-5698304 CTTTCAAAGTTAATGTAGGTGGG + Intergenic
1037499897 8:19475464-19475486 CTTCAAAACTTTATGGTGATTGG - Intronic
1038042844 8:23740565-23740587 CTTTAAAAAGAAATGCAGCTGGG + Intergenic
1038769169 8:30460759-30460781 CAATTAAAATTAATGGAGCTGGG + Intronic
1040754979 8:50762174-50762196 TCTTAAAACTTACTGGAGATTGG - Intronic
1040944140 8:52864706-52864728 TTTTAAAACTTCTTGGGGCTAGG - Intergenic
1041587648 8:59540482-59540504 TCATAAAACATAATGGAGCTGGG + Intergenic
1043408976 8:79971993-79972015 CATTAAAAAGTAATGGGGCTGGG - Intronic
1045203962 8:100017124-100017146 TTTTAAAAATTAGTGGAGCATGG - Intronic
1046500956 8:115076215-115076237 CTTGATAACTTGATGGATCTGGG + Intergenic
1046641553 8:116737358-116737380 TTTTAAAAATTAATAGGGCTGGG + Intronic
1047510943 8:125514951-125514973 CTTTTAAAAATAATGGTGCTTGG + Intergenic
1051591963 9:18785168-18785190 AAAAAAAACTTAATGGAGCTGGG + Intronic
1051720861 9:20035807-20035829 GTTTAAAAGTTGATGGTGCTAGG + Intergenic
1053067786 9:35080275-35080297 ATTTCAAATTAAATGGAGCTAGG + Intergenic
1055892487 9:81138213-81138235 GCTTTAAATTTAATGGAGCTGGG - Intergenic
1057323646 9:94038639-94038661 TCTTAAAACTTACTGGAGTTTGG + Intronic
1058160365 9:101563983-101564005 TTATAAAACATAATGCAGCTGGG - Intergenic
1058909657 9:109509020-109509042 CTTTAAAAATAAATAGAGATGGG - Intergenic
1059181137 9:112213626-112213648 CCCTAAAAATTAATGGATCTAGG + Intergenic
1060449665 9:123725125-123725147 CTTTAACAATTAGTGAAGCTTGG - Intronic
1185541608 X:906957-906979 GTTTAAAAATTAATGGGGCATGG - Intergenic
1186005340 X:5064335-5064357 TTTAAAAACTTAATGGAGAAGGG - Intergenic
1186808860 X:13167211-13167233 AGTTAAAACTCAAAGGAGCTGGG - Intergenic
1187014523 X:15312916-15312938 CTTTAAATATTAATGCAACTAGG - Intronic
1187203696 X:17160773-17160795 CCTTGAAACCTAATGGAGTTTGG + Intergenic
1189141389 X:38610574-38610596 CTTTAAAAACTACTGGTGCTTGG - Intronic
1190030851 X:46971464-46971486 TTTTAAAAGTTATTGGAACTGGG + Intronic
1190317444 X:49160307-49160329 CTTCAAAACTTAAAACAGCTGGG - Intergenic
1190623379 X:52311540-52311562 TTTAAAAAATTAATGGAGCTAGG + Intergenic
1191177467 X:57519778-57519800 TTTTAAACCTTAAGGGATCTAGG - Intergenic
1191660126 X:63641054-63641076 GTTTGAAACTAAATGAAGCTGGG + Intronic
1192625295 X:72720609-72720631 ATTAAAAAATTAATGGAGCATGG - Intergenic
1193039589 X:76990520-76990542 CTTCAAAAATCAATGGATCTAGG + Intergenic
1194370675 X:93067197-93067219 GTTTATAACTCAATGGAGCCTGG - Intergenic
1194709639 X:97219521-97219543 TTATAAAACTTAATGGATATAGG - Intronic
1194755394 X:97733165-97733187 CTGTAAAACAAAATGGAGCCAGG + Intergenic
1195226549 X:102800730-102800752 CTATAAAACTTCATGGTGTTCGG - Intergenic
1195710026 X:107766336-107766358 CTTTGAGACTTCATGGAGCGTGG + Intronic
1195946834 X:110223385-110223407 CTTTAAAACTCAATATAACTGGG + Intronic
1196289107 X:113917532-113917554 CTTTGAAACTCAATGAGGCTGGG - Intergenic
1197957127 X:131963634-131963656 CTTCAAAAATTAATGAATCTAGG + Intergenic
1199208475 X:145177197-145177219 TCTTAAAACTTATTGGAGTTTGG + Intergenic
1200130569 X:153841864-153841886 TCTTAAAACTTACTGGAGATTGG + Intergenic
1200678466 Y:6179087-6179109 GTTTATAACTCAATGGAGCCTGG - Intergenic
1201226224 Y:11821289-11821311 CTTTAAAACTTAAATCAGATCGG - Intergenic
1201526487 Y:14941234-14941256 TCTTAAAACTTACTGGAGATTGG - Intergenic
1201527799 Y:14955932-14955954 CTTCAAAAATTAATGAAGCCAGG + Intergenic
1202596936 Y:26550044-26550066 TCTTAAAACTTAATGAAGATTGG + Intergenic