ID: 1169057412

View in Genome Browser
Species Human (GRCh38)
Location 20:2635004-2635026
Sequence AAGCTCAGCTGCTCCAGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 286}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169057412_1169057414 7 Left 1169057412 20:2635004-2635026 CCAAAGCTGGAGCAGCTGAGCTT 0: 1
1: 0
2: 3
3: 29
4: 286
Right 1169057414 20:2635034-2635056 ATGGAGAAAAACTACTAATAAGG 0: 1
1: 0
2: 0
3: 21
4: 285
1169057412_1169057415 11 Left 1169057412 20:2635004-2635026 CCAAAGCTGGAGCAGCTGAGCTT 0: 1
1: 0
2: 3
3: 29
4: 286
Right 1169057415 20:2635038-2635060 AGAAAAACTACTAATAAGGATGG 0: 1
1: 0
2: 3
3: 46
4: 454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169057412 Original CRISPR AAGCTCAGCTGCTCCAGCTT TGG (reversed) Intronic
901650340 1:10739487-10739509 AAGCTCAGCTGCGCCCACTCAGG + Intronic
903028947 1:20448993-20449015 AAGCCCAGCGGCACCAGCTGGGG - Intergenic
903830322 1:26170570-26170592 ACGCTCAGCTGCTTCAGCCTGGG - Exonic
904175298 1:28623814-28623836 AGTCTCAGCTGCTCCAGACTAGG - Intronic
904945466 1:34195949-34195971 GAGCTCAGCTGCTGTGGCTTAGG - Intronic
904946962 1:34206376-34206398 AAGCTCAGCTGCTGCAACTTAGG + Intronic
905368639 1:37470625-37470647 TTGCTCAGTTGCTCCAGCTTTGG + Intergenic
906128835 1:43443690-43443712 AAGCTCAGCTCCTTCAGCCAAGG - Exonic
906977317 1:50589367-50589389 CACCTGAGCTGCTCCTGCTTGGG - Intronic
907070686 1:51531897-51531919 AAGCTCAGCTGCTCTTTCTTTGG - Intergenic
907504311 1:54906628-54906650 AATCACAGCTACTCCAGCCTGGG + Intergenic
908006897 1:59737001-59737023 AATCCCAGCTGCTCCAGCCATGG + Intronic
908047366 1:60184977-60184999 CATCTCAGCTGCTCCAGCCATGG - Intergenic
908645971 1:66278316-66278338 CTGCCCAGCTGCTACAGCTTTGG + Intronic
911331393 1:96529567-96529589 CATCTCAGCTGCTCCAGCTGTGG + Intergenic
912493432 1:110075866-110075888 AAGGGCAGCTGTCCCAGCTTTGG + Intergenic
912776541 1:112509288-112509310 AAGCTGCGCAGCTCCCGCTTCGG + Exonic
915815806 1:158963318-158963340 CAGCACAGCTGCCCCATCTTTGG + Intronic
915866271 1:159502814-159502836 AAGCTCAGCTCCACTAGCTGGGG + Intergenic
917022251 1:170601992-170602014 CATCTAAGCTGCTCCAGCTATGG - Intergenic
917082620 1:171272116-171272138 CATCCCAGCTGCTCCAGCTGTGG + Intronic
919343787 1:196348922-196348944 AATCCCAGCTACTCCAGCCTGGG + Intronic
921097695 1:211901469-211901491 CAGCTCTGCAGCCCCAGCTTGGG - Intergenic
921687290 1:218104589-218104611 AACCTCAGCTCCTCCAGTTCAGG + Intergenic
921836618 1:219785010-219785032 AAGCTCAGCTGGTTAAGCTATGG - Intronic
922857846 1:228790367-228790389 GAGCTGAGCAGCTCCAGCTGGGG + Intergenic
924081137 1:240399714-240399736 AAGGGCAGATGCTCCAGCTCAGG + Intronic
1063078235 10:2738308-2738330 GGGCTCTGCAGCTCCAGCTTTGG - Intergenic
1066153643 10:32651286-32651308 GTGCTCAGGTGCTCCAACTTGGG + Intronic
1066262799 10:33745475-33745497 AAGATCAGCACCTCCAGCATGGG + Intergenic
1066963384 10:42241449-42241471 AAGCTCGACTGATCCAACTTGGG + Intergenic
1067382718 10:45789814-45789836 CAGCTCCACTGGTCCAGCTTGGG + Intronic
1067812326 10:49439400-49439422 CATCCCAGCTGCTCCAGCTGTGG - Intergenic
1067890421 10:50130359-50130381 CAGCTCCACTGGTCCAGCTTGGG + Intronic
1069073269 10:64012160-64012182 CAGCCCAGCTGCTCCTGTTTAGG + Intergenic
1069799676 10:71074301-71074323 AGGCTGAGCTGCTCCAGTGTGGG + Intergenic
1072504990 10:96056730-96056752 CTGTTGAGCTGCTCCAGCTTAGG - Exonic
1072733187 10:97861824-97861846 AAGCCCTGCTGCTCCACCCTGGG - Intronic
1072786319 10:98285534-98285556 CGGGTCAGCTGCTCCAGCTTTGG - Intergenic
1073979853 10:109142402-109142424 CATCTCAGCTGCTCCAGCCATGG + Intergenic
1076791687 10:132780174-132780196 AGTCTCAGATGCTCCAGCTGTGG + Intronic
1077141372 11:1026347-1026369 GAGCTCAGCTCCTCCAGGGTAGG + Exonic
1077979583 11:7286349-7286371 CATCTCAGCTGCTCCAGCCATGG - Intronic
1078201648 11:9189107-9189129 CATCCCAGCTGCTCCAGCTGTGG + Intronic
1078443863 11:11389636-11389658 AGCCCCAGCTCCTCCAGCTTAGG + Intronic
1078502261 11:11892422-11892444 AAGCTTCTGTGCTCCAGCTTGGG - Intronic
1082072964 11:47953903-47953925 AATCCCAGCTACTCCAGCTGAGG + Intergenic
1083544790 11:63540150-63540172 AAGCTGGGCTGCTTCAGCATTGG + Intronic
1083571079 11:63762756-63762778 AAGCGCAGCTGGTCCAGCCCGGG + Exonic
1083897104 11:65625430-65625452 AAGCTGCGCTCCTCCAGCTCAGG - Exonic
1084173998 11:67414126-67414148 AATCCCAGCTACTCCAGCCTGGG + Intronic
1084467501 11:69334574-69334596 AAGCTCAGTGTCTTCAGCTTGGG + Intronic
1086580381 11:88391986-88392008 TGTCTCAGCTGCTCCAGCTGTGG - Intergenic
1089568792 11:119388504-119388526 AAGCTGGGCTGCTCAAGCTGAGG + Intergenic
1090105513 11:123850969-123850991 TATCTCAGCTGCTCCAGCAAAGG - Intergenic
1091811877 12:3406192-3406214 AATCCCAGCTGCTCCATCCTTGG - Intronic
1093590465 12:20896024-20896046 CATCCCAGCTGCTCCAGCTGTGG - Intronic
1095919375 12:47514073-47514095 CATCTCAGCTGCTCCAGCCATGG + Intergenic
1096244906 12:49979132-49979154 AATCTCAGTAGCTCCAGCTGGGG + Intronic
1098240499 12:68462503-68462525 AACATCAGCTGCTTCATCTTGGG + Intergenic
1098443612 12:70543806-70543828 AATTTCAGCTGCACCATCTTGGG + Intronic
1098774869 12:74600192-74600214 CATCCCAGCTGCTCCAGCTGTGG + Intergenic
1099492774 12:83307143-83307165 CATCCCAGCTGCTCCAGCTGTGG + Intergenic
1099802453 12:87474285-87474307 CATCTTAGCTGCTCCAGCCTAGG + Intergenic
1100239125 12:92693023-92693045 AAGATCAGGGACTCCAGCTTGGG - Intergenic
1100778436 12:97997776-97997798 AAGCTCAGATGTGCCAACTTGGG - Intergenic
1100885217 12:99062656-99062678 AAGCTGAGCTGCCCTAGGTTGGG + Intronic
1102046135 12:109831551-109831573 AAGCTCACCTGTGCCAGCTCTGG - Intronic
1102408270 12:112693380-112693402 AAGCTCATCTTCTCCATTTTTGG + Intronic
1104143146 12:126007232-126007254 AACCTCAGATGGTGCAGCTTTGG - Intergenic
1105821981 13:24087942-24087964 CAGCCCAGCTCTTCCAGCTTTGG + Intronic
1105861226 13:24415830-24415852 AATCCCAGCTACTCCAGCTGAGG + Intergenic
1108184349 13:47873468-47873490 CATCCCAGCTGCTCCAGCTGTGG - Intergenic
1108418663 13:50227031-50227053 AAGTGCAGTTACTCCAGCTTGGG + Intronic
1110379964 13:74839161-74839183 AAGCTTAGTTGCCCCAGCTGAGG - Intergenic
1111047712 13:82836625-82836647 AAGCTCAGTTGCTTCAGCTATGG + Intergenic
1111103032 13:83611897-83611919 ACTCTCAGCTGCTTCAGCTGTGG - Intergenic
1111606676 13:90547665-90547687 CATCCCAGCTGCTCCAGCTGTGG - Intergenic
1115090415 14:29567649-29567671 CATCCCAGCTGCTCCAGCTGCGG - Intergenic
1115563661 14:34606237-34606259 AATCCCAGCTACTCCAGCCTGGG - Intronic
1118069587 14:62231720-62231742 CATCCCAGCTGCTCCAGCTGTGG + Intergenic
1118460058 14:65979476-65979498 CATCCCAGCTGCTCCAGCCTTGG + Intronic
1118845749 14:69546824-69546846 AAGATCAGCTGTTTCAGTTTTGG + Intergenic
1123776698 15:23587847-23587869 AGGATCATCTGTTCCAGCTTGGG + Intronic
1126544375 15:49856738-49856760 AAGCTCTGTTGCTTCAACTTCGG + Intergenic
1127649725 15:60995322-60995344 AAGCTCAGCTGCCACACCTGAGG - Intronic
1127976157 15:63998638-63998660 AACCTCAGCTGCTCCTGCCTGGG - Intronic
1128413887 15:67425957-67425979 ATGCTCAGTTGTTCCAGATTTGG + Intronic
1129079097 15:73023835-73023857 AACCTCAACTGCTCCTGCTGGGG - Intergenic
1130104479 15:80919254-80919276 AAGCACACCTGCCCCAGCTCAGG + Intronic
1132583512 16:695733-695755 AGGCTCAGCTCCGCCAGGTTGGG + Exonic
1133916956 16:10117705-10117727 AAGCTCAGGGGCTACAGCTGGGG + Intronic
1134418977 16:14069266-14069288 CAGCCCAGGTTCTCCAGCTTTGG + Intergenic
1135254147 16:20927130-20927152 AAGCTCAGCTGCCCCAGCCATGG - Intergenic
1137554479 16:49461870-49461892 CAGCTCAGCTTCCCCAGCCTGGG + Intergenic
1137588001 16:49675695-49675717 CAGCTCCTCTGCTCCAGCCTGGG + Intronic
1137783209 16:51115090-51115112 AAGCTATGAAGCTCCAGCTTTGG - Intergenic
1138265997 16:55660111-55660133 AAGCTCAGCTGCTCTGGATGGGG + Intronic
1138556918 16:57776186-57776208 CAGCTCAGCAGCTTCAGCCTGGG - Intronic
1139041292 16:63002029-63002051 CATCCCAGCTGCTCCAGCTGTGG + Intergenic
1139363506 16:66418627-66418649 AAACTCAGCTGCTCCAGGCCAGG + Intergenic
1139654138 16:68377156-68377178 AAGTCCAGCAGCTCCAGCCTAGG - Intronic
1140203164 16:72911141-72911163 AAGCTCAGCTTCACCAGACTTGG + Intronic
1141341996 16:83212118-83212140 AGGCTCAGCTGCTGCAGCTGTGG + Intronic
1141842604 16:86583774-86583796 AAGCTCAGGCTCTCCACCTTGGG + Intergenic
1142887686 17:2922992-2923014 AATCCCAGCTACTCCAGCTGAGG - Intronic
1142887759 17:2923445-2923467 AATCCCAGCTACTCCAGCTAAGG - Intronic
1143089299 17:4439582-4439604 AAAGGCAGCTGCTCCAGGTTTGG - Intronic
1143171489 17:4933094-4933116 AGACTGAGCTTCTCCAGCTTGGG - Exonic
1144025311 17:11271896-11271918 CAGCTCTGCTCCTCCAGCCTGGG + Intronic
1144141920 17:12357680-12357702 AAGCTCAGGAGCTGCAGCCTGGG - Intergenic
1144778723 17:17797443-17797465 AGGCCCAGCTCCTCCATCTTTGG - Exonic
1145781959 17:27569268-27569290 ACACACAGCTACTCCAGCTTTGG - Intronic
1148049784 17:44764166-44764188 AAGCTCATCTGAGCCAGCTAGGG + Intronic
1148199664 17:45741422-45741444 AAGCACAGATGCTCCAACTGTGG - Intergenic
1148640732 17:49185364-49185386 CATCCCAGCTGCTCCAGCTGAGG + Intergenic
1149116031 17:53097597-53097619 CATCCCAGCTGCTCCAGCTGTGG + Intergenic
1149366770 17:55952996-55953018 TGTCTCAGCTGCTCCAGCTATGG + Intergenic
1149393161 17:56212738-56212760 TAGCTCAGCTGATCCAGCTTGGG - Intronic
1150439499 17:65179735-65179757 GAGCTGAGCTGCTCCATCCTGGG + Intronic
1151767222 17:76138759-76138781 AAGCGCAGCTGCACAGGCTTAGG + Intronic
1152112211 17:78363235-78363257 GAGCTGAGCTGCTGCAGCTTGGG + Intergenic
1152447938 17:80356639-80356661 AGGCTCAGCGGCTCCAGATAGGG + Intronic
1152490821 17:80632089-80632111 AAACACAGCTGCTCCATCATGGG - Intronic
1153504463 18:5781440-5781462 AACCTTAGATGCTCCAGTTTAGG + Intergenic
1153596688 18:6732562-6732584 AAGCTGAGCTGCTCCATCATGGG + Intronic
1153836966 18:8971984-8972006 TAGCTCTGCTGTTCCAGCTCTGG - Intergenic
1154169457 18:12039828-12039850 AATCTCAGCTCCTGCAGCCTTGG - Intergenic
1154315641 18:13301308-13301330 AAGCTCATCTGGTCCAGCACAGG - Intronic
1155675620 18:28425661-28425683 TGTCTCAGCTGCTCCAGCTGTGG + Intergenic
1155679638 18:28474017-28474039 TGTCTCAGCTGCTCCAGCTGTGG + Intergenic
1157407576 18:47435994-47436016 AAGTTGAGCTGCTCCAGGGTCGG + Intergenic
1157424690 18:47574932-47574954 CAACTCACCTGCTCCACCTTGGG - Intergenic
1159895963 18:73996406-73996428 CACCCCAGCTGCTCCAGCTATGG + Intergenic
1160828765 19:1093068-1093090 AATCTCAGCTACTCAAGCTGAGG + Intronic
1163032696 19:14554636-14554658 AGGCTCAGCTCTTCCAGCCTTGG + Intronic
1163154561 19:15432734-15432756 GCGCTCAGCTGCTCCCGCCTGGG - Intronic
1164648910 19:29878087-29878109 AAGCCCATCTGTTCCAGCTGAGG - Intergenic
925098627 2:1227633-1227655 AAGCTCAGCTTCCCCAGCTGCGG - Intronic
925781980 2:7389604-7389626 TGTCTCAGCTGCTCCAACTTTGG - Intergenic
926145327 2:10393735-10393757 GTGCTCACCTGCTCCAGCTGGGG + Intronic
926987925 2:18644335-18644357 CAGCTCAGCTGCCTCACCTTAGG - Intergenic
928842022 2:35620729-35620751 AAACTAATCTGCTCCTGCTTAGG - Intergenic
929053276 2:37855808-37855830 CAGCTCTGCTGCACCGGCTTCGG - Intergenic
929528843 2:42732407-42732429 TGTCTCAGCTGCTCCAGCTGTGG - Intronic
930228879 2:48823545-48823567 AAGTTCAGCTCTTCCAGCTGTGG + Intergenic
930442982 2:51432249-51432271 CATCCCAGCTGCTCCAGCTGTGG + Intergenic
931033531 2:58211334-58211356 CATCCCAGCTGCTCCAGCTGTGG - Intronic
932867169 2:75355858-75355880 AACTTCAGGTTCTCCAGCTTTGG - Intergenic
936466095 2:112752234-112752256 AAGATAAGCTCCTCCAGCTTTGG - Intronic
936493768 2:112999365-112999387 AACCTCAGCTGCTGCAATTTTGG - Intergenic
939508328 2:143075979-143076001 CATCCCAGCTGCTCCAGCTGTGG + Intergenic
939811320 2:146836266-146836288 AAGGTGAGCAGCTCCAGCTGAGG + Intergenic
939855392 2:147352852-147352874 AATCGCTGCTGCTGCAGCTTTGG - Intergenic
941977713 2:171424014-171424036 CACCCCAGCTGCTCCAGCTGTGG + Intronic
942880748 2:180857863-180857885 CATCCCAGCTGCTCCAGCTGTGG - Intergenic
947165117 2:227253829-227253851 AAGATCTGAGGCTCCAGCTTGGG + Intronic
947864819 2:233389163-233389185 AAGCTCAGCTCCTTCTACTTTGG - Intronic
1168829108 20:834569-834591 TAGGTCAGCTGCTCCACCTGGGG - Intronic
1168848214 20:959524-959546 CAGCTCACCTGATCCGGCTTGGG + Exonic
1169057412 20:2635004-2635026 AAGCTCAGCTGCTCCAGCTTTGG - Intronic
1169311784 20:4548797-4548819 CAGCTCAGCTGTTCCACCTAAGG - Intergenic
1170474990 20:16705993-16706015 CATCCCAGCTGCTCCAGCTATGG + Intergenic
1172773283 20:37393668-37393690 AAGTCCATCTGATCCAGCTTTGG + Intronic
1175100305 20:56574636-56574658 TAGCTCACCTGCTCCAACGTTGG - Intergenic
1175103894 20:56600274-56600296 AATCCCAGCTACTCCAGCTGAGG + Intergenic
1177266989 21:18798361-18798383 CATCCCAGCTGCTCCAGCTGTGG + Intergenic
1177333794 21:19697510-19697532 TTGCTCAGCTACTTCAGCTTTGG - Intergenic
1177412995 21:20755088-20755110 GAGCTCACCTGCCCCAGCTGGGG + Intergenic
1177857926 21:26420184-26420206 CATCCCAGCTGCTCCAGCTGTGG - Intergenic
1179332051 21:40412931-40412953 CATCTCAGCTGCTCCAGCTGTGG + Intronic
1179922816 21:44516348-44516370 AGGCAGAGCTGCTCCTGCTTAGG + Intronic
1180089287 21:45525571-45525593 AGGCTCAGCTGCTCCCACTGAGG + Intronic
1180156540 21:45980407-45980429 AGTCTCAGCAGCTCCAGCTTTGG + Intergenic
1180956961 22:19745534-19745556 CAGCCCAGCTGCCCCTGCTTGGG - Intergenic
1181784957 22:25220407-25220429 AAGCTCAGTTGGTCCAGTTCAGG - Intronic
1182322662 22:29488570-29488592 AAGACCAGCTGTTCCAGCCTGGG + Intronic
1182602503 22:31477311-31477333 AAGCTGAGATTCTCCAGCCTCGG + Intronic
1183781825 22:40003644-40003666 AAGGGCAGCAGCTCCAGCTGAGG - Intronic
1184448386 22:44567817-44567839 CATCTCAGCAGCTCCAGCCTTGG - Intergenic
949538466 3:5013623-5013645 GACTTCAGCAGCTCCAGCTTAGG - Intergenic
950094479 3:10320941-10320963 GAGCTGAACGGCTCCAGCTTGGG + Intronic
951656942 3:25019804-25019826 AAGCTCAGATCATCCAGCGTTGG - Intergenic
952818747 3:37467925-37467947 AAGCTCAGCCGCTACAGCAAGGG + Intronic
953480366 3:43246347-43246369 AACCTCAGCTGCTGCCGCCTGGG - Intergenic
953960612 3:47263250-47263272 CAGCTGAGCACCTCCAGCTTGGG - Intronic
954516911 3:51186704-51186726 CATCTCAGCTGCTCCAGCTGTGG + Intronic
956336901 3:68174970-68174992 CAGCCCAGCTGCTCCAGCCATGG + Intronic
958154062 3:89730566-89730588 AGACTCAGCTGCTCCAGCCATGG + Intergenic
958914467 3:100033360-100033382 AAGCTCAGCAGCTGCAGCTCTGG + Intronic
959968380 3:112381420-112381442 CATCCCAGCTGCTCCAGCTGTGG + Intergenic
960486487 3:118259180-118259202 CATCTCAGCTGCTCCAGCCATGG + Intergenic
962421613 3:135233891-135233913 TATCTCAGCTGCTCCAGCTATGG - Intronic
962672857 3:137726737-137726759 CAGCTCAGCTGCTCCAGTCATGG - Intergenic
965028749 3:163335844-163335866 CATCCCAGCTGCTCCAGCTGTGG - Intergenic
965962099 3:174441139-174441161 CAGCTCAGTCGCGCCAGCTTGGG - Intronic
966074427 3:175919530-175919552 CATCCCAGCTGCTCCAGCTCTGG - Intergenic
966983743 3:185161317-185161339 AAGTCCAGCTGCTCCAGCTGAGG + Intergenic
968223054 3:196952765-196952787 AAGATCAGCTGCACCAGTGTGGG + Intronic
970868190 4:20782597-20782619 CATCCCAGCTGCTCCAGCTGTGG - Intronic
971175751 4:24280956-24280978 ATGCTGGGCTTCTCCAGCTTTGG - Intergenic
973078627 4:45962188-45962210 CATCCCAGCTGCTCCAGCTGTGG - Intergenic
975072451 4:70158674-70158696 AGGCTCAGCTGCTACAGGTGTGG - Exonic
975939199 4:79621026-79621048 AAGTGCAGCTGCTACAACTTTGG - Intergenic
976259907 4:83135663-83135685 AGGCCCAGCTGCTCCAGCCATGG - Intronic
976600020 4:86929471-86929493 AAGAGAAGCTGCTGCAGCTTTGG + Intronic
979473226 4:121125427-121125449 ACACTGAGCTGCTCCAGCTATGG - Intergenic
980256015 4:130381989-130382011 CATCTCAGCTGCTCCAGCCATGG + Intergenic
980586054 4:134817296-134817318 CCTCTCAGCTGCTTCAGCTTTGG - Intergenic
982309980 4:153974659-153974681 CATCCCAGCTGTTCCAGCTTTGG + Intergenic
982436171 4:155384725-155384747 TAGCTCATATGGTCCAGCTTTGG - Intergenic
982458580 4:155639456-155639478 AATCCCAGCTACTCCAGCTGAGG + Intergenic
984442530 4:179791451-179791473 CATCCCAGCTGCTCCAGCTGTGG + Intergenic
985675184 5:1227254-1227276 AAACTCAGCTGCTCCACGCTGGG + Intronic
986861237 5:11928915-11928937 CAGCCCATCTGCTCCAGTTTTGG + Intergenic
988070770 5:26285380-26285402 TGTCTCAGCTGCTCCAGCTCTGG - Intergenic
988379014 5:30477265-30477287 TGTCTCAGCTGCTCCAGCCTTGG - Intergenic
990329568 5:54712750-54712772 CATCCCAGCTGCTCCAGCTGTGG + Intergenic
990595529 5:57309282-57309304 TGTCTCAGCTGCTCCAGCTATGG + Intergenic
991340343 5:65601867-65601889 AGTCCCAGCTGCTCCAGCTGTGG - Intronic
993260708 5:85655167-85655189 TGTCTCAGCTGCTCCAGCTGTGG + Intergenic
994111730 5:96012997-96013019 AAACTCAGCTGATCCAAGTTAGG - Intergenic
994895621 5:105698246-105698268 CATCTCAGCTGCTCCAGCCATGG - Intergenic
994910759 5:105903162-105903184 AAGCTGCGCTGCTACAGCTCCGG - Intergenic
995936029 5:117515544-117515566 AAGCCCAGCTCCTACATCTTTGG - Intergenic
996030947 5:118703353-118703375 CATCCCAGCTGCTCCAGCCTTGG - Intergenic
996543722 5:124655821-124655843 AAGCTTCGCTGTTCCAGCCTCGG + Intronic
997207440 5:132058085-132058107 AAGCTCAGGTGCACCTGCTGTGG - Intergenic
997698997 5:135883220-135883242 AAGCTCCGCTGCCCCAGCCGGGG - Intronic
998759058 5:145411962-145411984 CATCCCAGCTGCTCCAGCTATGG - Intergenic
998871526 5:146557348-146557370 CATCCCAGCTGCTCCAGCTGTGG - Intergenic
998889327 5:146729635-146729657 TATCCCAGCTGCTCCAGCTGTGG + Intronic
1000270628 5:159680096-159680118 CATCCCAGCTGCTCCAGCTGTGG + Intergenic
1002498978 5:179634950-179634972 AAGCTCAGCTGTGCAAGCTGGGG - Intergenic
1002502698 5:179657574-179657596 AAGCTCAGCTGTGCAAGCTGGGG + Intergenic
1002960605 6:1911256-1911278 AAGTTCAGCTGTTCTATCTTTGG + Intronic
1003312105 6:4978388-4978410 AAGCTAAGCTTCTCCAGCTTGGG + Intergenic
1004141475 6:13021984-13022006 CAGCTCAGCTGCAGCAGCATGGG - Intronic
1006866784 6:37215069-37215091 CAGCTCTGCTGCCCCAGCCTTGG + Intronic
1007094135 6:39203087-39203109 CAGCCCATCTGCTTCAGCTTTGG - Intronic
1007485033 6:42175041-42175063 CTGCTCACCTGCTCCCGCTTCGG - Intronic
1009982431 6:70741955-70741977 CATCCCAGCTGCTCCAGCTGCGG - Intronic
1010381804 6:75233775-75233797 AAGCTAGGCTGCTACAGCTTTGG + Intergenic
1012514166 6:100039406-100039428 CATCCCAGCTGCTCCAGCTGTGG + Intergenic
1012569065 6:100700228-100700250 CATCCCAGCTGCTCCAGCTATGG + Intronic
1013908502 6:115246295-115246317 AAGCTGAGCTTCTCCAGGTTAGG - Intergenic
1014610957 6:123545517-123545539 AATCTCAGATGCTCTATCTTGGG - Intronic
1017387964 6:153907910-153907932 CATCCCAGCTGCTCCAGCTGTGG + Intergenic
1017578693 6:155836378-155836400 AAGCTCAGCTGCTACAACAGAGG - Intergenic
1018589646 6:165405258-165405280 AAGCTCAGAAGTTCCATCTTAGG + Intronic
1021107657 7:16656988-16657010 AATCTCCCCTGCTCCAGCCTTGG + Intronic
1022341105 7:29469012-29469034 AAGGCCAGCTGCTCCATTTTGGG - Intronic
1022957070 7:35390750-35390772 AAACTCATCTGTTCTAGCTTTGG + Intergenic
1023025687 7:36047863-36047885 AATCCCAGCTACTCCAGCCTGGG + Intergenic
1027584828 7:80044912-80044934 CATCCCAGCTGCTCCAGCTGTGG - Intergenic
1028066583 7:86391969-86391991 CATCACAGCTGCTCCAGCTGTGG - Intergenic
1028485843 7:91356294-91356316 GAGCTCAGCAGCTCCAGCTCTGG - Intergenic
1028770613 7:94616135-94616157 GAGCTCAGATGCTGCAGGTTGGG + Intronic
1030012952 7:105189434-105189456 CAGAGCAGCTGCTCCAGCTGAGG + Intronic
1030587238 7:111435768-111435790 AATCACAGCTGCCACAGCTTGGG + Intronic
1032179232 7:129661126-129661148 TATCCCAGCTGCTCCAGCTGTGG - Intronic
1032229679 7:130063802-130063824 AGTCTCAACTGCTCCAGCTTAGG + Intergenic
1032739489 7:134724439-134724461 AACCTCAGCTCCTCCAGCTGTGG + Intergenic
1033885012 7:145933993-145934015 CATCCCAGCTGCTCCAGCTTTGG + Intergenic
1034237892 7:149586770-149586792 TATCCCAGCTGCTCCAGCTATGG + Intergenic
1034245932 7:149644329-149644351 TATCCCAGCTGCTCCAGCTATGG + Intergenic
1034740072 7:153465691-153465713 CATCCCAGCTGCTCCAGCTGTGG + Intergenic
1035050078 7:155993681-155993703 AAATTCATCTGCTCCAGCTGTGG + Intergenic
1036171303 8:6488259-6488281 AAGCACAGCGGCTCCAACCTGGG - Intronic
1036390739 8:8322410-8322432 GACCTCAGGTGATCCAGCTTGGG + Intronic
1036680646 8:10870439-10870461 AAGCTAAGCCCCTACAGCTTTGG - Intergenic
1037465138 8:19152415-19152437 AAGCTCAGGTGCTCCTTCTCTGG - Intergenic
1038294893 8:26282310-26282332 TAGCTCATCTGCTGCAGATTTGG + Intergenic
1041162530 8:55059953-55059975 CTGTGCAGCTGCTCCAGCTTGGG + Intergenic
1046606074 8:116373575-116373597 TGGCTCAGCTGCTCTAGCTATGG - Intergenic
1047026834 8:120833716-120833738 AAAGTCACCTGATCCAGCTTGGG - Intergenic
1047222811 8:122932133-122932155 AAGCTGAGCTGCTCTTTCTTGGG - Intronic
1047941467 8:129830946-129830968 AATCCCAGCAGCTCCAGCTGTGG - Intergenic
1048210649 8:132451675-132451697 ATCCTCTGCTGCTCCAGCGTTGG - Intronic
1048215010 8:132486245-132486267 AAGCTCAGGTGATCTAACTTTGG + Intergenic
1048578719 8:135713361-135713383 ACGCTCCCCTACTCCAGCTTAGG + Intergenic
1050745256 9:8868549-8868571 AAGCAAAGTTGCTCCAACTTTGG - Intronic
1051015825 9:12474839-12474861 CATCCCAGCTGCTCCAGCTGTGG + Intergenic
1052187805 9:25620211-25620233 CATCCCAGCTGCTCCAGCTGTGG - Intergenic
1052414256 9:28157348-28157370 CATCTCAGCTGCTCCAGCTGTGG - Intronic
1053200444 9:36148462-36148484 AAGCTCAGCCACACTAGCTTGGG + Intronic
1058004602 9:99901956-99901978 TGTCTCAGCTGCTCCAGCTGTGG - Intergenic
1058065671 9:100545428-100545450 CATCTCAGCTGCTCCAGCCATGG - Intronic
1058314449 9:103547245-103547267 TCCCTCAGCTGCACCAGCTTAGG - Intergenic
1059628290 9:116091520-116091542 AATCCCAGCTCCTCCAGCTATGG + Intergenic
1060091057 9:120743991-120744013 AAGCCCAGCTGTCCCAGCTGAGG + Intergenic
1060283048 9:122226879-122226901 AAGAACATCTGCTCCAGCTGCGG - Exonic
1060493051 9:124098924-124098946 AGCCTCAGCTGCTCCGGCTTTGG + Intergenic
1061844142 9:133377157-133377179 AAGCTCATCTGCTTCACCTCTGG - Intronic
1186412710 X:9357961-9357983 AAGCTCAGATGGTCCCACTTGGG - Intergenic
1186992416 X:15084425-15084447 CATCCCAGCTGCTCCAGCTTTGG + Intergenic
1187704125 X:21992827-21992849 AAGCCCTGGTTCTCCAGCTTAGG + Intronic
1187894447 X:23967121-23967143 CATCCTAGCTGCTCCAGCTTTGG - Intergenic
1187940798 X:24379035-24379057 AATCCCAGCTACTCCAGCTGAGG - Intergenic
1189088025 X:38047453-38047475 CATCTCAGCTGCTCCAGCTGTGG - Intronic
1189216310 X:39327747-39327769 GTGCTCAGTTCCTCCAGCTTGGG + Intergenic
1190167809 X:48087733-48087755 AAGCACAGCAGCTTCTGCTTTGG + Intergenic
1191721257 X:64230563-64230585 AGCCCCAGCTGCTCCAGGTTGGG - Exonic
1192340520 X:70259795-70259817 AAGCTCCCTTGGTCCAGCTTGGG + Intergenic
1192697903 X:73437586-73437608 CATCCCAGCTGCTCCAGCCTTGG - Intergenic
1193388171 X:80895077-80895099 AGTCCCAGCTGCTCCAGCTATGG + Intergenic
1193938519 X:87652133-87652155 AATTACAGCTGCTCCAGCTGTGG - Intronic
1194484487 X:94471119-94471141 TGTCTCAGCTGCTCCAGCTGTGG + Intergenic
1195473583 X:105260229-105260251 AAACTTAGCTGTTCCAACTTTGG - Intronic
1196061306 X:111410901-111410923 AAGGTTAGCATCTCCAGCTTAGG + Exonic
1196168934 X:112565837-112565859 AATCTTGGCAGCTCCAGCTTCGG - Intergenic
1196565190 X:117196755-117196777 CATCTCAGCTGCTCCAGCCGTGG + Intergenic
1196820124 X:119694550-119694572 CTCCTCAGCTGCTCCAGCCTTGG - Intergenic
1196844609 X:119888289-119888311 AAGCTCAGCCCCTCCCTCTTCGG - Intergenic
1197567188 X:128101792-128101814 TGTCTCAGCTGCTCCAGCTGTGG - Intergenic
1198231543 X:134694421-134694443 GTGCTCAGCTGATCCAGCTAGGG - Intronic
1198755041 X:139973813-139973835 AAGCTCTGCTGGTCTATCTTGGG - Intergenic
1199776139 X:151013493-151013515 CACCCCAGCTGCTCCAGCCTTGG - Intergenic
1200074460 X:153544248-153544270 AAGCCCAGCTGCCCCTGCCTGGG + Intronic