ID: 1169060507

View in Genome Browser
Species Human (GRCh38)
Location 20:2657465-2657487
Sequence CCAGGTTGAGGACTCCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169060507_1169060518 28 Left 1169060507 20:2657465-2657487 CCTCCCAGGAGTCCTCAACCTGG 0: 1
1: 0
2: 1
3: 19
4: 164
Right 1169060518 20:2657516-2657538 ATCAGACGTGTGTCCGGAGGTGG 0: 1
1: 0
2: 1
3: 1
4: 37
1169060507_1169060516 22 Left 1169060507 20:2657465-2657487 CCTCCCAGGAGTCCTCAACCTGG 0: 1
1: 0
2: 1
3: 19
4: 164
Right 1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 67
1169060507_1169060517 25 Left 1169060507 20:2657465-2657487 CCTCCCAGGAGTCCTCAACCTGG 0: 1
1: 0
2: 1
3: 19
4: 164
Right 1169060517 20:2657513-2657535 ATTATCAGACGTGTGTCCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169060507 Original CRISPR CCAGGTTGAGGACTCCTGGG AGG (reversed) Intronic
900420210 1:2552994-2553016 CCAGGTGGGGGATGCCTGGGTGG + Intergenic
901001077 1:6149089-6149111 CCAGGTGGAGGCACCCTGGGCGG + Intronic
901441711 1:9282150-9282172 CCAGGCTGAGGACTGCAGGAAGG - Intergenic
901681079 1:10913191-10913213 CCAGGCTGTGTGCTCCTGGGTGG - Intergenic
901790177 1:11649822-11649844 GCAGGCTGAGGGCTACTGGGAGG - Exonic
902618936 1:17639359-17639381 CCAGGTTTTGGCCTCCAGGGTGG + Intronic
903061348 1:20670853-20670875 CAAGAGGGAGGACTCCTGGGGGG + Intronic
903320552 1:22540634-22540656 CCTGCTTGAGGATGCCTGGGAGG + Intergenic
903811886 1:26039201-26039223 CCAGATCGAGGACTACTCGGAGG - Exonic
904058177 1:27686047-27686069 CAAGGATGAGGACCCCAGGGTGG + Intergenic
904772660 1:32889012-32889034 CCACATTGAGGATTCCTGTGGGG - Exonic
906273692 1:44500870-44500892 CCACGTTGTGGACTCCAGGGTGG - Intronic
907515345 1:54990228-54990250 CCATGTTTGGGACTCCTGGCTGG + Intronic
908655992 1:66389609-66389631 GCAAGTTGAGGACCCCTGGCTGG + Intergenic
916058663 1:161084727-161084749 CCAGGGAGAGGCCTCCTTGGGGG - Intronic
917968670 1:180193987-180194009 CCAGGTTTAGGAGTTTTGGGGGG + Intronic
922466252 1:225847034-225847056 CCAGCCTCAGGCCTCCTGGGGGG + Exonic
923019237 1:230150058-230150080 CCAGGGTGAGGATGGCTGGGTGG + Intronic
924265247 1:242274955-242274977 CTAGGTGTAGGATTCCTGGGTGG - Intronic
1063388282 10:5630857-5630879 CCAGGTGGATGAAGCCTGGGTGG - Intergenic
1066719574 10:38323535-38323557 CTAGGTGTAGGATTCCTGGGTGG + Intergenic
1067289709 10:44932132-44932154 CCTGGTTGTGGGCTCTTGGGTGG - Intronic
1074772303 10:116742186-116742208 CCAGGGTGCGGACTCCGCGGCGG - Intronic
1077034340 11:487634-487656 CCAGGATCAGGGCTTCTGGGAGG - Intronic
1077347565 11:2070947-2070969 GCAGGTTGAGGTCTCCTAGAAGG - Intergenic
1077356915 11:2122898-2122920 CCAGGATGAGGCCTGCTGAGCGG + Intergenic
1078533682 11:12156520-12156542 CCAGGCTGGGGACACCTGGATGG + Intronic
1078662331 11:13297523-13297545 CCAGCTTGAGGGCTGCTGGTGGG + Intronic
1079374908 11:19883171-19883193 CTAGGTTCAGCACCCCTGGGGGG + Intronic
1079862320 11:25688774-25688796 GCAGGTTGAGGAAGCCTGGCTGG + Intergenic
1081699001 11:45140670-45140692 GCAGCTTTAGGACTGCTGGGTGG - Intronic
1083925559 11:65803987-65804009 CCCCGTTGAGGACTCCAGGCAGG + Intergenic
1084288499 11:68146898-68146920 CCAGGCTGGGGACCCCTGGGAGG - Intergenic
1085298810 11:75446329-75446351 CCAGGCTCAGGACTCCAGGAAGG + Intronic
1088556766 11:111069849-111069871 GCAGGTAGAGGACTCCTGTGGGG - Intergenic
1089780905 11:120872661-120872683 GCAGGTGGAGGCCTCCTGGGAGG - Intronic
1090073862 11:123566894-123566916 CCAGGCTGAGCACTCCATGGGGG - Intronic
1091377747 12:36813-36835 GCAGGTGGAGGACACGTGGGAGG + Intergenic
1095528517 12:43157245-43157267 CTAGGCTGAGGACTCCTTGAGGG - Intergenic
1096869667 12:54585444-54585466 TCAGTTCAAGGACTCCTGGGAGG + Intronic
1098902955 12:76131866-76131888 CCAGGTTGTGGAACCCAGGGAGG - Intergenic
1100118472 12:91339543-91339565 CCAGGTGGATGTCTCCAGGGAGG + Intergenic
1100459032 12:94780372-94780394 CCAGGTTGTGGGGTCCTGGGAGG - Intergenic
1101826667 12:108225700-108225722 CCAGGTTGTGAACTCCCGGAGGG + Intronic
1103043781 12:117718491-117718513 ACAGGTGGAGGTTTCCTGGGTGG - Intronic
1103564269 12:121807688-121807710 CCAGGCTGAGGGCCCCAGGGTGG - Intronic
1105700905 13:22935238-22935260 CCAGGTAGGGGACCCCTGTGGGG - Intergenic
1106248819 13:27968928-27968950 CCAGGTTGAGGCCGCCAGAGTGG + Exonic
1106593081 13:31114579-31114601 CCAGGTGGATGTCTCCTAGGAGG - Intergenic
1112593258 13:100783966-100783988 CCATGGTGAAGCCTCCTGGGTGG + Intergenic
1113861950 13:113491811-113491833 CCAGGGTGTGGACGCCTGCGCGG + Intronic
1119540913 14:75437842-75437864 CCAGGTTGGGGGCTCCAGGAGGG - Intronic
1120552782 14:85891745-85891767 CCAGGTTGAGGAGTTCTGTCTGG + Intergenic
1121571654 14:94951051-94951073 CCAGATGCAGGGCTCCTGGGTGG + Intergenic
1121719264 14:96097850-96097872 CCAGGTTGAGGAGCTCTAGGGGG + Intergenic
1121890404 14:97584779-97584801 CCTGGATGGTGACTCCTGGGAGG + Intergenic
1122642163 14:103166264-103166286 CCAGGGTGAGGATTTCTAGGAGG - Intergenic
1123006877 14:105328039-105328061 GAAGGTTGACGAATCCTGGGGGG - Intronic
1123119020 14:105908483-105908505 CCAGGGTGTGGACTGCAGGGAGG + Intergenic
1125874737 15:43133920-43133942 GCAGGGTGCGGCCTCCTGGGGGG - Exonic
1127977604 15:64009662-64009684 CCAAGGTGAGGATTCCTGGGGGG - Intronic
1130486589 15:84401644-84401666 CCAGCCTGATGACTCCTGGAGGG + Intergenic
1130853191 15:87818193-87818215 GCAGGTTGAGAACTCCATGGTGG - Intergenic
1132404466 15:101533806-101533828 CCACCTTTAGCACTCCTGGGAGG + Intergenic
1132660299 16:1058097-1058119 CCAGGGTGAGGACCCCTGGGGGG + Intergenic
1132677404 16:1126470-1126492 CCAGGTGGGTGAGTCCTGGGTGG - Intergenic
1132718030 16:1301733-1301755 CCAGGCTGAGGGCTCAGGGGTGG - Intergenic
1133028502 16:2998768-2998790 CCAGGCCAAGGCCTCCTGGGTGG + Intergenic
1133339183 16:5025706-5025728 CCAAGTGGGGGACTGCTGGGTGG + Intronic
1134043950 16:11087932-11087954 CCAGGTGGAGGAGCCCAGGGCGG - Intronic
1135396627 16:22136601-22136623 CTGGATTGTGGACTCCTGGGAGG + Intronic
1136295070 16:29296950-29296972 CCAGGCTGAGGATTCATGGCCGG + Intergenic
1137557675 16:49482984-49483006 ACAGCCTGAGGACTCCTGGCTGG - Intergenic
1144646881 17:16981132-16981154 ACAGGCTGAGCACTCCTGGCAGG - Intergenic
1144947760 17:18978459-18978481 CCAGGTGAAGCAGTCCTGGGTGG + Exonic
1145262108 17:21360697-21360719 CCAAGATGAGGCCTCCAGGGAGG + Intergenic
1146474617 17:33153014-33153036 CCAGGAAGGGGCCTCCTGGGAGG - Intronic
1147917441 17:43897123-43897145 CCATGTGGAGGACTGTTGGGGGG - Intronic
1148399042 17:47337659-47337681 CCAGGTTGAGGACTGCAGCCTGG + Intronic
1148754881 17:49968379-49968401 CCAGTTGGATGGCTCCTGGGCGG - Intergenic
1150484234 17:65532924-65532946 CCAGGTTTAGGGCTCCAGGCTGG - Intronic
1150657795 17:67051677-67051699 CCAGGTTGTGAGCTTCTGGGGGG - Intronic
1151757505 17:76083112-76083134 CCACCTAGGGGACTCCTGGGAGG + Exonic
1152196554 17:78921859-78921881 CCCGGCTGAGGATTTCTGGGAGG - Intronic
1152310734 17:79548225-79548247 CCAGGCTGGGCCCTCCTGGGTGG - Intergenic
1153772344 18:8426030-8426052 CCAGGAAGAGGCCTCCTCGGGGG + Intergenic
1155724831 18:29067927-29067949 CCAGGCTGATGCCTCATGGGAGG + Intergenic
1156187006 18:34675097-34675119 CCAGGTTGAGGAACCCTGGTAGG - Intronic
1157472794 18:48002954-48002976 CCAGTTTCAGGCCTCCTGGGTGG + Intergenic
1158534156 18:58292346-58292368 CCAGGTTGTCCTCTCCTGGGTGG + Intronic
1159016531 18:63105491-63105513 CCATGTTGCCCACTCCTGGGTGG - Intergenic
1161106197 19:2445228-2445250 CCAGGTTGCAGAGGCCTGGGGGG - Intronic
1161170593 19:2810632-2810654 GCAGGTTGAAGAGGCCTGGGCGG - Exonic
1161703399 19:5806500-5806522 CCGGGCTGAGGAAGCCTGGGTGG + Intergenic
1166257479 19:41616898-41616920 CCAGGATGTGGTCTCTTGGGGGG - Intronic
926088653 2:10036095-10036117 CCCACATGAGGACTCCTGGGAGG + Intergenic
926089834 2:10043054-10043076 CCAGGTTGAGGCCTCTAGGTGGG + Intronic
927519325 2:23689582-23689604 TCTGCCTGAGGACTCCTGGGTGG + Intronic
928276828 2:29908883-29908905 CTAGTTTGTGAACTCCTGGGAGG + Intronic
929231589 2:39565825-39565847 CCAGGATGAGGACACATGGAAGG + Intergenic
932297814 2:70641645-70641667 ACAGTGTGAAGACTCCTGGGGGG - Intronic
933252993 2:80049735-80049757 ACAGCTTCAGGAGTCCTGGGGGG - Intronic
934636076 2:95991426-95991448 CCAGGCTGAGGGCTGCGGGGCGG - Intronic
934797570 2:97114000-97114022 CCAGGCTGAGGGCTGCGGGGCGG + Intronic
936398632 2:112149365-112149387 CCAGGGTGAGCAGACCTGGGAGG - Intronic
938394333 2:130931269-130931291 CAAGTCTGAGGACTCCTGGCCGG - Intronic
939524072 2:143270299-143270321 CAAGGTTGAAGACTACTGTGTGG - Intronic
943612604 2:190051427-190051449 CCAGGATGAGGAATCTTTGGTGG + Intronic
944679645 2:202065367-202065389 CAAGATGGAGGAGTCCTGGGAGG - Intergenic
948206769 2:236166789-236166811 ACTGGTTGAGGACTGATGGGGGG + Intronic
948465795 2:238151049-238151071 CCTGGTTTAGTGCTCCTGGGTGG - Exonic
948805527 2:240452230-240452252 CCAGGCTGGGGGCACCTGGGTGG + Intronic
1169060507 20:2657465-2657487 CCAGGTTGAGGACTCCTGGGAGG - Intronic
1171258446 20:23710048-23710070 CCAGGTCATGGCCTCCTGGGTGG + Intergenic
1171394555 20:24823422-24823444 CATGGTTGATGAGTCCTGGGGGG + Intergenic
1175137663 20:56836943-56836965 CCCGGTTGAGCAGACCTGGGAGG + Intergenic
1176048487 20:63104614-63104636 ACATGGTGAGGGCTCCTGGGGGG - Intergenic
1178250840 21:31001774-31001796 CCAGGCTGACGCCTCCTGGTTGG - Intergenic
1178902283 21:36606968-36606990 CCAGCCTGAGGACTCCCGGGGGG + Intergenic
1178950026 21:36978572-36978594 GCAGCCTGAGGACTGCTGGGTGG + Intronic
1181038697 22:20181930-20181952 GCTGGCTGAGGGCTCCTGGGCGG + Intergenic
1181579121 22:23817230-23817252 CCAGGCTGAGTGCTCCAGGGGGG + Intronic
1184450331 22:44578707-44578729 CCAGCCTGGGGATTCCTGGGAGG + Intergenic
1184470391 22:44692485-44692507 CCAGGTGGAGGAGCCCTGGGAGG - Intronic
1184527688 22:45035227-45035249 CCAGGATGTGCCCTCCTGGGGGG + Intergenic
952003234 3:28810221-28810243 CCAGGGTGAGGATTTCTAGGAGG + Intergenic
952774603 3:37032711-37032733 CCAGGGTGAGATCTCCTGAGAGG + Intronic
952829087 3:37548698-37548720 CCTGGCTGAGGACCCCTGAGAGG + Intronic
953237877 3:41121826-41121848 CTTGGTGGAGGACTACTGGGAGG + Intergenic
955317094 3:57948122-57948144 GCAGGCTGTGGACTCCTGGTGGG - Intergenic
955340650 3:58122730-58122752 CCAGGTTGAGGGCTCATGGAAGG - Intronic
957506487 3:81127420-81127442 CCAGGTTTAGGACTCCCTTGAGG - Intergenic
965238121 3:166155514-166155536 GAAGGCTGAGGCCTCCTGGGAGG + Intergenic
968505752 4:970658-970680 GCAGCGTGAGGGCTCCTGGGGGG - Intronic
968655446 4:1776622-1776644 CGAGGTTGAGGACAGCAGGGCGG - Intergenic
973550858 4:52034752-52034774 GCAGGGTGGGGAGTCCTGGGAGG + Intronic
976246783 4:83012755-83012777 CCGGGATGGGGGCTCCTGGGCGG - Intronic
977177474 4:93834746-93834768 CGAGGTTGAGGAGGCCGGGGAGG - Intergenic
981507239 4:145515852-145515874 CCAGGATCAGGATTTCTGGGAGG - Intronic
982460743 4:155666890-155666912 CCAGGCGGAGGACACCTGTGGGG + Intronic
983070818 4:163265735-163265757 CCAAGTTGTGGAATTCTGGGAGG - Intergenic
983497612 4:168461022-168461044 CCAGGTTGGGAAGTCCTGGGAGG - Intronic
985629710 5:1008296-1008318 CCAGGCTTGGGGCTCCTGGGAGG + Intergenic
985666156 5:1182514-1182536 GCAGGGTGGGGGCTCCTGGGTGG - Intergenic
985992593 5:3575640-3575662 CCTGGTTGAGGGCACCTGGGAGG - Intergenic
987101302 5:14593491-14593513 CCAGGCTGAGGAGGCCTGTGTGG + Intronic
1000969551 5:167698515-167698537 CCAGGTCCTGGTCTCCTGGGTGG + Intronic
1002099123 5:176848685-176848707 CCAGGTGGGGGACTCCAGAGAGG - Intronic
1002173153 5:177386357-177386379 CCGGGTGGAGGAGACCTGGGAGG + Intronic
1004244871 6:13964752-13964774 AGAGGGTGGGGACTCCTGGGAGG + Intronic
1006521491 6:34573676-34573698 GCAGGGTGTGGCCTCCTGGGAGG + Intergenic
1006794367 6:36722370-36722392 CCAGGCTGAGCCCCCCTGGGAGG - Exonic
1007228835 6:40334058-40334080 CCAGGCTCAGTCCTCCTGGGAGG + Intergenic
1012401458 6:98845380-98845402 CCCGGCTGAGGAGTCCTCGGGGG + Intergenic
1013601892 6:111712758-111712780 ACAGGAGGAGGACTCCTGGGGGG + Intronic
1015163171 6:130175314-130175336 CCAGGCTGAGGGCCCGTGGGAGG - Intronic
1016696413 6:147001272-147001294 TCAGCTGCAGGACTCCTGGGGGG + Intergenic
1017719529 6:157235219-157235241 CCAGGCTGATGCCTCCAGGGAGG - Intergenic
1019496214 7:1341706-1341728 GCAGGGAGAGGGCTCCTGGGGGG + Intergenic
1019534381 7:1520991-1521013 CCGGGTGGTGGACTCCTGGGCGG + Intergenic
1019554442 7:1621727-1621749 GCAGGTGGGGAACTCCTGGGGGG + Intergenic
1019938390 7:4270975-4270997 CCAGCTTGATCACTCCTGGGAGG + Intergenic
1029507236 7:100969713-100969735 CCAGGTCCAGTGCTCCTGGGTGG + Intronic
1033600646 7:142886065-142886087 CAATGTTGAGGACTCCCAGGAGG + Intergenic
1035082012 7:156224173-156224195 CCAGGTTGAGCACCACTGTGTGG - Intergenic
1036569807 8:9970284-9970306 CCAGGTGGAGGAGCCCTGGGAGG + Intergenic
1044486409 8:92759617-92759639 CCATGTTGAAAACTCCTGGGAGG + Intergenic
1046974750 8:120261928-120261950 GCAGGGTGAGGACTCCTTGGTGG + Intronic
1048407027 8:134133918-134133940 CCAGGTTGAGAACTCCCATGTGG + Intergenic
1049230921 8:141480732-141480754 CTATGTTGGAGACTCCTGGGTGG - Intergenic
1049332702 8:142063649-142063671 CAGGGCTGAGGGCTCCTGGGAGG + Intergenic
1049437916 8:142596164-142596186 CCAGGGTGGGGACTCCAGGACGG + Intergenic
1053055894 9:34992889-34992911 CCAGACTGAGGACCCCTGAGAGG - Intronic
1054755215 9:68950656-68950678 CCAGCTAGAGGACCTCTGGGTGG - Intronic
1057419477 9:94899129-94899151 CCAAGTGGAGGACTGATGGGAGG + Intronic
1060983263 9:127805743-127805765 CCACGTTAAGGTCTCCTAGGCGG + Intronic
1061043521 9:128152638-128152660 CCAGGGTGACGAGGCCTGGGAGG - Intronic
1061378119 9:130238112-130238134 ACACTTTGAGGACCCCTGGGAGG + Intergenic
1186393074 X:9180840-9180862 ACTGGTTGAGGGCTGCTGGGGGG - Intergenic
1192212991 X:69139584-69139606 GCAGGTTGACGGCTGCTGGGAGG + Intergenic
1195364612 X:104114182-104114204 CCATGTTGAGGTCTCTGGGGAGG + Exonic
1197783605 X:130179460-130179482 CAAGAGTGAAGACTCCTGGGGGG + Intronic
1199728196 X:150605340-150605362 CTAGGTTCAGGACTGCTGGCAGG + Intronic
1202369120 Y:24185495-24185517 CCAGCCTGATGACTCCTGGAGGG + Intergenic
1202501665 Y:25484622-25484644 CCAGCCTGATGACTCCTGGAGGG - Intergenic