ID: 1169060511

View in Genome Browser
Species Human (GRCh38)
Location 20:2657468-2657490
Sequence ACCCCAGGTTGAGGACTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169060511_1169060517 22 Left 1169060511 20:2657468-2657490 CCCAGGAGTCCTCAACCTGGGGT 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1169060517 20:2657513-2657535 ATTATCAGACGTGTGTCCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 25
1169060511_1169060516 19 Left 1169060511 20:2657468-2657490 CCCAGGAGTCCTCAACCTGGGGT 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 67
1169060511_1169060518 25 Left 1169060511 20:2657468-2657490 CCCAGGAGTCCTCAACCTGGGGT 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1169060518 20:2657516-2657538 ATCAGACGTGTGTCCGGAGGTGG 0: 1
1: 0
2: 1
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169060511 Original CRISPR ACCCCAGGTTGAGGACTCCT GGG (reversed) Intronic
900843056 1:5071261-5071283 ACCCCAGGTTCAGGCCTTCAAGG + Intergenic
900976496 1:6020066-6020088 ACCCCAGGTACAGGGCTCCGGGG - Intronic
902254428 1:15178369-15178391 ACCCCAGGATGAGGACTCTGAGG + Intronic
902512200 1:16972534-16972556 ACCCCAGCTTGAGGCCCCCAAGG - Exonic
902681213 1:18045174-18045196 ACCCCTGGTTGAGAACCACTGGG + Intergenic
902961722 1:19968352-19968374 CCCCTAGAGTGAGGACTCCTAGG + Intergenic
903064865 1:20693743-20693765 ACTCCAGGATGAGGACTCCTGGG + Intronic
905105713 1:35562459-35562481 ACGCAAGGATGAGGTCTCCTCGG - Exonic
906273696 1:44500873-44500895 GCCCCACGTTGTGGACTCCAGGG - Intronic
907122009 1:52016390-52016412 ACCCCAGATTGAAAACTCCTGGG + Intergenic
912520277 1:110240352-110240374 GCCTCAGGTTAAGGAATCCTGGG - Intronic
919924615 1:202185938-202185960 TTCCCAGGTTGTGCACTCCTGGG + Intergenic
922528976 1:226328534-226328556 AGCCCTGGTTGAGGAAGCCTGGG + Intergenic
923019233 1:230150055-230150077 ACCCCAGGGTGAGGATGGCTGGG + Intronic
923728878 1:236531778-236531800 ACCCCATGTTGAGGTCCCCAAGG + Intronic
1066000715 10:31102181-31102203 ACCCCAGGTTAAGGTCTTCGGGG - Intergenic
1067465974 10:46499152-46499174 TCCACAGGCTGAGGTCTCCTAGG - Intergenic
1067621213 10:47885454-47885476 TCCACAGGCTGAGGTCTCCTAGG + Intergenic
1067774514 10:49153267-49153289 ACCCCAGGTTCGGGAGTCATTGG - Intergenic
1072221917 10:93333953-93333975 GGCCCAGGTAGAGGGCTCCTGGG + Intronic
1074208994 10:111311055-111311077 ATCCAAGAATGAGGACTCCTTGG + Intergenic
1077608352 11:3627337-3627359 ACCTCAGGCTGAGGATTCCCAGG - Intergenic
1079622248 11:22568097-22568119 GCCCCAGTTTGGGGACTCATGGG + Intergenic
1080653778 11:34242733-34242755 ACCACAGGATGATGTCTCCTGGG + Intronic
1081515018 11:43820373-43820395 CTCCCAGGTTTAGGACTCTTTGG + Intronic
1084618470 11:70252107-70252129 ACCCCAGGCTCAGGCCTTCTGGG + Intergenic
1084957567 11:72699402-72699424 ACCCATGGGTGAGTACTCCTGGG - Exonic
1085013710 11:73158736-73158758 AGCCCAGTTTGAGAAATCCTGGG - Intergenic
1088902233 11:114127051-114127073 ACCCCAGGGTTAGCACTCCCTGG + Intronic
1092972945 12:13716109-13716131 TCACCAGGTTGAAAACTCCTTGG + Intronic
1097052207 12:56230372-56230394 TCCCCAGGTTAGGGACACCTGGG + Intronic
1101747115 12:107551016-107551038 ACCCCAATGTAAGGACTCCTTGG + Intronic
1102094480 12:110225888-110225910 AACCCAGGCGGAGGCCTCCTGGG - Intergenic
1102883950 12:116507898-116507920 ACCCAAGGCTGGGGACTCCAAGG - Intergenic
1103864166 12:124038204-124038226 ACCTGAGGATGAGGCCTCCTGGG + Intronic
1104797881 12:131532242-131532264 AACCCAGGTTGCAAACTCCTGGG - Intergenic
1106179073 13:27355729-27355751 GCCCCAGGTGGAGGACTGCAGGG + Intergenic
1106564807 13:30874962-30874984 ACTCCAGGTACTGGACTCCTGGG - Intergenic
1107272659 13:38638478-38638500 ACCCCAGGCAGAAGATTCCTTGG + Intergenic
1109004548 13:56855202-56855224 ATCCCTGGTTGAGAACTACTGGG + Intergenic
1111701783 13:91698991-91699013 ACCTGAGGGTGAGGACCCCTGGG + Intronic
1112609846 13:100945618-100945640 AGCCCAGGTTGAGGACTGTCGGG - Intergenic
1116342738 14:43745934-43745956 ACCCCAAATTTAGGAATCCTAGG - Intergenic
1118726051 14:68629684-68629706 ACCACAGAAGGAGGACTCCTGGG - Intronic
1118865753 14:69702340-69702362 ACCCCAGGTGGTGGACTGCCGGG - Intronic
1121719258 14:96097847-96097869 CCCCCAGGTTGAGGAGCTCTAGG + Intergenic
1122992025 14:105240998-105241020 ACCCCAGGTTGCCTACTTCTGGG - Intronic
1124189860 15:27565412-27565434 TGCCCAGGTTGAGAGCTCCTGGG - Intergenic
1125953649 15:43775129-43775151 TCCCCAGGCTGGAGACTCCTGGG - Intronic
1126412741 15:48388720-48388742 ACTCCAGGTTCAGAACTGCTGGG - Intergenic
1127378036 15:58402944-58402966 ACCCCAGGTTCTGGGCTCCCAGG - Intronic
1128349462 15:66879529-66879551 TGCCCAGTTTGAGAACTCCTGGG + Intergenic
1132660294 16:1058094-1058116 GTCCCAGGGTGAGGACCCCTGGG + Intergenic
1134240532 16:12502624-12502646 ACCCCAGGATAAGAATTCCTTGG - Intronic
1139701442 16:68710359-68710381 ACCCCTGGTTGAGAACCACTCGG - Intronic
1143946656 17:10598590-10598612 ACCCCAGGTTGAGAGCTTCTGGG + Intergenic
1145989081 17:29067479-29067501 ACCCTTGCTTGAGGACTGCTGGG - Intergenic
1147250416 17:39149855-39149877 ACACCAGGTTGAGGATTCAAAGG + Intronic
1147946349 17:44082465-44082487 ACCCGAGGATGAGGACGACTGGG + Intronic
1147988465 17:44319677-44319699 ACACCAGGCTGAGGGCTTCTTGG + Exonic
1150549102 17:66192340-66192362 ACCCCAGCTTGTGGGCCCCTTGG + Intergenic
1152063745 17:78098478-78098500 ACCCCAGGTGGAGGAGGGCTTGG - Exonic
1152135148 17:78499343-78499365 ACCCCAGGATGGGGACTTCCTGG + Intronic
1152145932 17:78568875-78568897 CCCCCACGTTCAGGACGCCTGGG - Intronic
1152462712 17:80449844-80449866 TCCCCAGGTTGAAGAGGCCTGGG + Intergenic
1156034916 18:32755175-32755197 ACCCTAGGTGGAGGGCTCCGTGG + Intronic
1157472790 18:48002951-48002973 GCCCCAGTTTCAGGCCTCCTGGG + Intergenic
1160846737 19:1169336-1169358 GCCCCAGGCTGAGGCCTCCGTGG + Intronic
1161050416 19:2160951-2160973 ACCCCTGGTTGAGACCGCCTGGG + Intronic
1161105097 19:2439570-2439592 ACCCCAGGATGGGGACAACTGGG + Intronic
1161138684 19:2635562-2635584 ACCCCAAGTTGAGACCTCCTGGG - Intronic
1161195565 19:2984318-2984340 ACTCCAGGCTGATGCCTCCTGGG - Intronic
1161505339 19:4640608-4640630 TCCCCAAGTTGAGGGCTGCTGGG + Intronic
1162912945 19:13859478-13859500 AACCCAGGTTGAGGCCTCAATGG + Intergenic
1163476054 19:17526867-17526889 TCCCCAGCCTGGGGACTCCTAGG + Intronic
1163616629 19:18332963-18332985 AGCCCAGTTTGAGGACTGCAGGG - Intergenic
1166248338 19:41546839-41546861 ACCCCAGGCTTTGGACTCCTTGG + Intergenic
1166803194 19:45470336-45470358 ACCCCGGGTTGGTGACTCTTAGG - Intronic
1167653630 19:50748565-50748587 ACACCAGGTTGACGTCTACTTGG + Intergenic
1168662267 19:58176570-58176592 GCCACAGTTTGGGGACTCCTAGG + Intergenic
926088303 2:10033626-10033648 GCCCTAGCTTGAGGACTTCTGGG + Intergenic
927493348 2:23535314-23535336 AGGCCAGGGTGAGGTCTCCTGGG - Intronic
928445173 2:31327663-31327685 ACCCCCAGTTGAGGACCACTGGG + Intergenic
930024520 2:47021993-47022015 TCCCCAAGTAGAGGCCTCCTGGG - Intronic
935152044 2:100446398-100446420 ACCCCAGCTTCAGGGTTCCTTGG - Intergenic
937455746 2:122040256-122040278 ACCCTAACTGGAGGACTCCTGGG - Intergenic
939710371 2:145509644-145509666 ACCCAAGGATGGGAACTCCTAGG - Intergenic
940871034 2:158860369-158860391 ACCCCGAATTGATGACTCCTTGG - Intronic
943687705 2:190836612-190836634 ACCACAGATTGATAACTCCTAGG - Intergenic
947266482 2:228287982-228288004 ACCCCACTTTGAGAACTACTAGG - Intergenic
947530027 2:230902910-230902932 TCCCCAGGTTGAGAACTTTTGGG - Intergenic
948519286 2:238525218-238525240 ACCCCAGGATAAAGCCTCCTAGG - Intergenic
1168831196 20:846107-846129 ACCCCAGGGTGAGTTCTGCTGGG - Exonic
1169060511 20:2657468-2657490 ACCCCAGGTTGAGGACTCCTGGG - Intronic
1169091098 20:2861926-2861948 AACCCAAGGTGGGGACTCCTCGG + Intronic
1169603686 20:7291125-7291147 ACCAGAGGTTGGGGACCCCTGGG + Intergenic
1174422510 20:50408837-50408859 CAGCCAGGTTGAGAACTCCTGGG + Intergenic
1175789180 20:61731043-61731065 ACCCCAGGGTGAGGTCTCTGGGG - Intronic
1178837148 21:36108316-36108338 ACCCCAGGCTGAATAATCCTGGG - Intergenic
1179901787 21:44397959-44397981 ACCCCAGGGTGAGGGCACATGGG - Intronic
1181388808 22:22564370-22564392 ACCCCAGATTCAGGCCTCCTGGG + Exonic
1181773410 22:25142994-25143016 TCTCCAGTGTGAGGACTCCTTGG + Intronic
1182424128 22:30263341-30263363 ACCCCCGGATCAGGGCTCCTGGG + Exonic
1183606406 22:38868981-38869003 AGCCCAGGCTGGGGCCTCCTGGG + Intronic
1185053121 22:48563998-48564020 ACCCCACGCTGAGGAACCCTTGG - Intronic
1185277347 22:49955514-49955536 ACCCCGGGAGGAGGGCTCCTGGG - Intergenic
950668503 3:14511507-14511529 ACCCCAGGCTGAGGCCACCAAGG - Intronic
951624967 3:24649747-24649769 ACCCCCAGTTGAGAACTGCTAGG - Intergenic
952016027 3:28958771-28958793 ATCCCAGGCTGAAGACTCCACGG + Intergenic
953237874 3:41121823-41121845 ACCCTTGGTGGAGGACTACTGGG + Intergenic
953686392 3:45081511-45081533 GCCCCAGCTGGAGAACTCCTGGG - Intergenic
954613434 3:51957970-51957992 ACCCCAGGGTGGAGTCTCCTTGG + Exonic
955324691 3:58000872-58000894 GCCCTGGGGTGAGGACTCCTGGG + Intergenic
959906171 3:111713186-111713208 ACCTCAGGCTGAGAACTCTTAGG - Intronic
960974451 3:123161156-123161178 ACCCCCAGCTCAGGACTCCTTGG - Intronic
961469352 3:127101550-127101572 AACCCAGGGTGGGGAGTCCTGGG + Intergenic
965104421 3:164339682-164339704 ACGCCAGCCTGAGGTCTCCTGGG + Intergenic
966642291 3:182204275-182204297 ACCCTTGGTTAAGGATTCCTGGG - Intergenic
966647002 3:182257437-182257459 AGCCTAAGCTGAGGACTCCTTGG - Intergenic
967198716 3:187052087-187052109 ACCCCATGCCCAGGACTCCTAGG - Intronic
969440926 4:7216309-7216331 ACCCCAGGTGGAGCAGTGCTGGG - Intronic
973636976 4:52869629-52869651 ACCCCAGGTTTAGGAGCCATGGG + Intergenic
977622640 4:99154589-99154611 ACCACAGCTTTAGGTCTCCTAGG - Intronic
978367307 4:107995859-107995881 ATCCCAGGTTGACGTCTCCTTGG + Intronic
983281504 4:165686634-165686656 TCCCCTCGATGAGGACTCCTGGG - Intergenic
994052572 5:95379544-95379566 TCCCCAGGTATAGGACTCATAGG - Intergenic
997657056 5:135563085-135563107 CCCCCAGGTTTAAGATTCCTTGG + Intergenic
1001990846 5:176114354-176114376 CCCCCTGGTTCAGGCCTCCTGGG + Exonic
1002226028 5:177723786-177723808 CCCCCTGGTTCAGGCCTCCTGGG - Exonic
1002267818 5:178047424-178047446 CCCCCTGGTTCAGGCCTCCTGGG + Exonic
1006925922 6:37655077-37655099 ACCCCAGGCTCAGGACCCCTGGG - Intronic
1007226378 6:40318300-40318322 ACCTCAGGTAGGGGAATCCTCGG - Intergenic
1010843273 6:80674365-80674387 TATCCAGATTGAGGACTCCTAGG + Intergenic
1011780871 6:90787961-90787983 ACCCCATGTAGTGAACTCCTAGG - Intergenic
1016696409 6:147001269-147001291 ACCTCAGCTGCAGGACTCCTGGG + Intergenic
1020355935 7:7275665-7275687 ACTCCAGGATGAGAACACCTGGG - Intergenic
1020698975 7:11453378-11453400 GACACAGGGTGAGGACTCCTAGG + Intronic
1021745183 7:23733489-23733511 ACAACAGGTTGAGGATACCTGGG - Intronic
1022495797 7:30852395-30852417 ATCCCAGGATGAGGATTCCTGGG - Intronic
1025248311 7:57334614-57334636 TAGCCAGGTTGAGAACTCCTCGG - Intergenic
1025757734 7:64360569-64360591 ACCCTGGGTTGGAGACTCCTGGG + Intergenic
1027308114 7:76923489-76923511 ACCCCAGATTCACCACTCCTGGG - Intergenic
1028869160 7:95748464-95748486 ATCCAAGGTTGAGGATTCCTGGG - Intergenic
1033600643 7:142886062-142886084 TCCCAATGTTGAGGACTCCCAGG + Intergenic
1037890493 8:22621553-22621575 CCCCCAGGTTGTGTACTACTCGG - Exonic
1037904806 8:22709829-22709851 ACTCCAGGTTGAGCCATCCTGGG - Intergenic
1041396716 8:57399148-57399170 TGCCCAGGCTGAGGACTCCTGGG + Intergenic
1041906372 8:63038004-63038026 ACCCCAGGATGATTTCTCCTAGG + Intronic
1045652088 8:104350774-104350796 ATCCAAGGTTGAGGACCTCTGGG - Intronic
1046635425 8:116670085-116670107 ATCCCAGGATAAGGATTCCTGGG - Intronic
1047430964 8:124791321-124791343 GCCAGAGGTTGGGGACTCCTGGG - Intergenic
1048200919 8:132373243-132373265 ACCCCAGGTGTAGGTCTCCAGGG - Intronic
1048886442 8:138913706-138913728 CCCCCAGGAGGAGGATTCCTGGG - Exonic
1051491459 9:17670986-17671008 ACCACATTTTGAGGACTACTAGG + Intronic
1057746802 9:97758894-97758916 ATTCCAGCTTGAGGTCTCCTAGG + Intergenic
1058849605 9:108998121-108998143 GCCCCCAGTTGAGAACTCCTGGG - Intronic
1060973892 9:127754038-127754060 ACCTGAGGGTGAGGAATCCTAGG + Intronic
1061883113 9:133577849-133577871 CACCCAGGCTGAGGTCTCCTGGG - Intergenic
1188504782 X:30870671-30870693 ACCCCTGGTTGGGAACTACTGGG - Intronic
1189910900 X:45809831-45809853 AGCCCTGGGTGAGGACTCCTAGG + Intergenic
1192022683 X:67410610-67410632 CCCCAGAGTTGAGGACTCCTCGG + Intergenic
1192055354 X:67768348-67768370 CCCCCAGGTTGAGAACCACTGGG - Intergenic
1192326083 X:70133506-70133528 TCCCTAGGTTGAGGAGTCCAGGG - Exonic
1198640165 X:138747628-138747650 ACGCCAGGCTGATGTCTCCTGGG + Intronic
1198787569 X:140305572-140305594 CATCCAGGTTTAGGACTCCTTGG - Intergenic
1199997000 X:153031720-153031742 ACCCCAGGAGGAGGGATCCTAGG + Intergenic