ID: 1169060512

View in Genome Browser
Species Human (GRCh38)
Location 20:2657469-2657491
Sequence TACCCCAGGTTGAGGACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169060512_1169060518 24 Left 1169060512 20:2657469-2657491 CCAGGAGTCCTCAACCTGGGGTA 0: 1
1: 0
2: 1
3: 18
4: 165
Right 1169060518 20:2657516-2657538 ATCAGACGTGTGTCCGGAGGTGG 0: 1
1: 0
2: 1
3: 1
4: 37
1169060512_1169060517 21 Left 1169060512 20:2657469-2657491 CCAGGAGTCCTCAACCTGGGGTA 0: 1
1: 0
2: 1
3: 18
4: 165
Right 1169060517 20:2657513-2657535 ATTATCAGACGTGTGTCCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 25
1169060512_1169060516 18 Left 1169060512 20:2657469-2657491 CCAGGAGTCCTCAACCTGGGGTA 0: 1
1: 0
2: 1
3: 18
4: 165
Right 1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169060512 Original CRISPR TACCCCAGGTTGAGGACTCC TGG (reversed) Intronic
900287226 1:1907498-1907520 CACCCCTGCTTGAGGACTCCTGG - Intergenic
900976497 1:6020067-6020089 GACCCCAGGTACAGGGCTCCGGG - Intronic
901100989 1:6718625-6718647 TGCCCCTGGTTGAGGACCACAGG + Intergenic
902398353 1:16144379-16144401 TCCCCCAGGTGGAAGACTCTGGG - Intronic
903064864 1:20693742-20693764 TACTCCAGGATGAGGACTCCTGG + Intronic
905858100 1:41328297-41328319 CACCCCAGGATGGGGCCTCCTGG - Intergenic
906208433 1:43999275-43999297 TACCCCAAGGAGAGGACTCTAGG + Intronic
906273697 1:44500874-44500896 AGCCCCACGTTGTGGACTCCAGG - Intronic
907122008 1:52016389-52016411 TACCCCAGATTGAAAACTCCTGG + Intergenic
908251726 1:62271230-62271252 TTCCCCAGGGCCAGGACTCCAGG - Intronic
908639890 1:66210940-66210962 CCACCCAGGTTGAGGACTTCTGG - Intronic
911181713 1:94866659-94866681 TAGCCTAGGATGAGGACCCCAGG - Intronic
913085285 1:115431263-115431285 TACCCAGGATTGAGAACTCCTGG + Intergenic
914491341 1:148152262-148152284 TACCCCGCGTTTAGGACTGCAGG + Exonic
915719704 1:157975816-157975838 TACCCCAGCTTGAGCAGTCTTGG - Intergenic
918824766 1:189309972-189309994 GCCCCCGGGTTGAGGACCCCTGG + Intergenic
920737973 1:208552592-208552614 TACCCCAGCCTGAGCTCTCCTGG - Intergenic
921002343 1:211056392-211056414 TACCTAAGGTTCATGACTCCGGG + Intronic
921356341 1:214287635-214287657 AACCCAAGGTTGAGAACTGCTGG - Intronic
922586702 1:226738762-226738784 GACCCCAGCCTGGGGACTCCTGG + Intronic
922863015 1:228835514-228835536 TATCCCAGGTTATGGTCTCCAGG + Intergenic
924055397 1:240119444-240119466 AACCCCAGGCTGAGAACCCCAGG - Intronic
924540967 1:244980464-244980486 GACTCCAGGTTTGGGACTCCAGG + Intronic
1063010043 10:2012530-2012552 GACCCCAGGCTGAGGACTGAGGG - Intergenic
1063955117 10:11258401-11258423 TTCCCCTGGCTCAGGACTCCAGG - Intronic
1064485237 10:15781513-15781535 TACGCCAGGTTGAGTACACCTGG + Intronic
1064756531 10:18576530-18576552 TACCCCAGGCTGTAGAATCCTGG - Intronic
1065901133 10:30209156-30209178 TACACCAGGTAGAGGCCTACCGG - Intergenic
1066000716 10:31102182-31102204 TACCCCAGGTTAAGGTCTTCGGG - Intergenic
1067701295 10:48574867-48574889 TACTCCAGGTCAAGGACTCAGGG + Intronic
1070098673 10:73364322-73364344 TACCCCAGGCTGGTAACTCCTGG - Intergenic
1071782957 10:88867004-88867026 TACCCCAGGTCCAGGCCTTCTGG - Intergenic
1072221916 10:93333952-93333974 TGGCCCAGGTAGAGGGCTCCTGG + Intronic
1073476853 10:103759402-103759424 ATCCCCAGGTTGATGAGTCCTGG - Intronic
1074535361 10:114325003-114325025 TTCCCCAGGGTGAGGATACCAGG + Intronic
1078059372 11:8033368-8033390 CGCCCCAGTTTGAGCACTCCGGG + Intronic
1081105060 11:39056945-39056967 TACCCCAGTTTGTAGTCTCCTGG - Intergenic
1083082164 11:60105117-60105139 TACTCCAGGTTGTAGAATCCTGG + Intergenic
1085448567 11:76617126-76617148 TCCCCCAGGCAGAGGACCCCTGG - Intergenic
1087639983 11:100746366-100746388 TACCCCAGGCTGTAGAATCCTGG + Intronic
1087905578 11:103693048-103693070 TAGCCAAGGTTGAGAACTCTTGG - Intergenic
1090323773 11:125867374-125867396 TATCCCAGGCTGTGGAATCCTGG + Intergenic
1094816303 12:34188827-34188849 TACCACATTGTGAGGACTCCAGG + Intergenic
1096759134 12:53825344-53825366 TCCCCGAGGTAGAGGCCTCCAGG - Intergenic
1100162280 12:91874557-91874579 TATAACAGGTTGGGGACTCCAGG - Intergenic
1100571760 12:95849664-95849686 TGCCCCTGGTTGAGGACCACTGG - Intergenic
1104192082 12:126491566-126491588 TGGCCCTGGTTGAGGGCTCCTGG + Intergenic
1104203458 12:126614511-126614533 TGCCCCAGGTTGTGGAATCCTGG + Intergenic
1105225732 13:18429833-18429855 TACCCCAGGCTGTGGAACCCTGG - Intergenic
1106179072 13:27355728-27355750 TGCCCCAGGTGGAGGACTGCAGG + Intergenic
1107902090 13:45027088-45027110 TACCCCAGATTGAAGGCTGCTGG + Intronic
1109909409 13:68890351-68890373 TACCCCAGGCTGTAGAATCCTGG + Intergenic
1109928706 13:69183827-69183849 GTCCCTAGGTTGAGGACCCCTGG + Intergenic
1111849092 13:93549558-93549580 CATCCCAGGCTGAGCACTCCTGG + Intronic
1112609847 13:100945619-100945641 CAGCCCAGGTTGAGGACTGTCGG - Intergenic
1114146199 14:19980654-19980676 TACCCCAGGCTGTGTAATCCTGG - Intergenic
1114223423 14:20717175-20717197 TACCCCAGGCTGTGTAATCCTGG + Intergenic
1114671527 14:24414261-24414283 TAACCCAGGATGAGCAATCCTGG - Intronic
1118726052 14:68629685-68629707 TACCACAGAAGGAGGACTCCTGG - Intronic
1118865754 14:69702341-69702363 GACCCCAGGTGGTGGACTGCCGG - Intronic
1119160021 14:72444765-72444787 GACCCCAGGTTGATGACCCCTGG + Intronic
1124934363 15:34156330-34156352 TACCCCAGGCTGTGGAATCCTGG + Intronic
1125543060 15:40483014-40483036 GACCACAGGTTAAGGAATCCTGG - Intergenic
1125953650 15:43775130-43775152 TTCCCCAGGCTGGAGACTCCTGG - Intronic
1126736319 15:51735335-51735357 TACCCCTGGTTGAGGACCACTGG - Intronic
1131463740 15:92638139-92638161 TCAACCAGGTTGAGGCCTCCTGG - Intronic
1131688218 15:94794081-94794103 TACCCCAGAGTGAGGATGCCAGG - Intergenic
1133960988 16:10493237-10493259 TACCCCAGGCTGTGGGATCCTGG - Intergenic
1135662576 16:24309468-24309490 TACCTCAGGTTGTGACCTCCTGG + Intronic
1141145406 16:81526220-81526242 GACCCAAGGTTGAGAATTCCTGG - Intronic
1141863000 16:86730732-86730754 CACCCCAGCCTGAGGACTCTCGG + Intergenic
1141953160 16:87352510-87352532 TACTCCAGTTTGCGGACTTCTGG - Intronic
1143946655 17:10598589-10598611 GACCCCAGGTTGAGAGCTTCTGG + Intergenic
1144319567 17:14101042-14101064 TACCCCTGGTTAAGAACTGCTGG + Intronic
1149444828 17:56705394-56705416 TAGCCCAAGTTGGGGACCCCTGG - Intergenic
1150484237 17:65532928-65532950 TTTCCCAGGTTTAGGGCTCCAGG - Intronic
1150802070 17:68290766-68290788 TGCCCCGGGTTGGGGGCTCCGGG - Intronic
1152361169 17:79833819-79833841 GCCCCCAGGGTGAGGACGCCCGG - Exonic
1152462711 17:80449843-80449865 TTCCCCAGGTTGAAGAGGCCTGG + Intergenic
1152888748 17:82867932-82867954 TCCCCCAGGGGGAGGACTCCGGG + Intronic
1154463327 18:14618230-14618252 TACCCCAGGCTGTGTAATCCTGG - Intergenic
1154527646 18:15309688-15309710 TACCCCAGGCTGTGGAACCCTGG + Intergenic
1157850199 18:51041600-51041622 TGCCCCTGGTTGAGAACTCCTGG + Intronic
1160867349 19:1261738-1261760 TCCCCCAGGGTGAGGCCGCCAGG - Intronic
1160938027 19:1606517-1606539 TATCCCTGGTTAAGGACTCAGGG + Intergenic
1161138685 19:2635563-2635585 CACCCCAAGTTGAGACCTCCTGG - Intronic
1163466383 19:17470532-17470554 TTCCCCAGGATGCGGGCTCCGGG + Exonic
1163616630 19:18332964-18332986 AAGCCCAGTTTGAGGACTGCAGG - Intergenic
1164836408 19:31357758-31357780 TACCCAAGGTTTGGGGCTCCAGG - Intergenic
1167333841 19:48872727-48872749 TCCCTCAGGCTCAGGACTCCAGG - Intronic
1167437813 19:49490060-49490082 TCCCCAGGGTTGGGGACTCCAGG + Intronic
1167906930 19:52668846-52668868 TACCCCAGGATGTAGAATCCTGG - Intronic
1167956895 19:53073129-53073151 TACCACAGGTTGGGGACTGGAGG - Intronic
928435364 2:31251402-31251424 TGCTACAGGATGAGGACTCCAGG - Intronic
932037039 2:68256015-68256037 TGCCCCAGGTTAAGAATTCCAGG + Intronic
933389381 2:81651490-81651512 TACCCCAGGCTGTAGAATCCTGG + Intergenic
945905618 2:215589448-215589470 GACCCTAGGTTGAGAACCCCTGG + Intergenic
947872266 2:233445822-233445844 GACCCCAGGTTAAGAACACCTGG - Intronic
948214733 2:236220276-236220298 GAGCCCAGGCTGAGGCCTCCAGG - Intronic
1169060512 20:2657469-2657491 TACCCCAGGTTGAGGACTCCTGG - Intronic
1172527579 20:35609393-35609415 GACCCCAAGTTAAGGACACCTGG - Intergenic
1173128328 20:40361932-40361954 TACCCCAGTTTGAAGACCACTGG + Intergenic
1175590337 20:60184853-60184875 TACCCCCGGTTGAGAACTACTGG - Intergenic
1175780505 20:61679448-61679470 CACCCCACGTTGAGGACCACTGG + Intronic
1175789181 20:61731044-61731066 GACCCCAGGGTGAGGTCTCTGGG - Intronic
1176769786 21:13058856-13058878 TACCCCAGGCTGTGGAACCCTGG - Intergenic
1176811199 21:13540143-13540165 TACCCCAGGCTGTGTAATCCTGG + Intergenic
1178837149 21:36108317-36108339 TACCCCAGGCTGAATAATCCTGG - Intergenic
1181155789 22:20919047-20919069 AACTCCAGGTTAAGAACTCCAGG + Intronic
1181388807 22:22564369-22564391 CACCCCAGATTCAGGCCTCCTGG + Exonic
1181775008 22:25153284-25153306 CACACCAGGTTGAGAACTACTGG - Intronic
1184478743 22:44735478-44735500 TGCCGAAGCTTGAGGACTCCTGG + Intronic
1185046974 22:48533394-48533416 TGGCACAGGGTGAGGACTCCAGG + Intronic
950488734 3:13289384-13289406 TACTCCAGGTTGAGCCCTCACGG - Intergenic
950594199 3:13964629-13964651 TACCCCAGGCTGTGGAATCCTGG + Intronic
951248507 3:20367721-20367743 TACTCCAGGTTGTAGAATCCTGG + Intergenic
953611511 3:44451027-44451049 TCCCCCCAGTAGAGGACTCCTGG + Intronic
953686393 3:45081512-45081534 TGCCCCAGCTGGAGAACTCCTGG - Intergenic
954090070 3:48277195-48277217 TGCCCCAGGCTGTGGAATCCTGG - Intronic
955340653 3:58122734-58122756 GATCCCAGGTTGAGGGCTCATGG - Intronic
960949575 3:122990471-122990493 TACACCTGGTTGAGAACTACTGG - Intronic
960992614 3:123321838-123321860 TACCCCCAGCTGAGGGCTCCAGG + Intronic
961534707 3:127563008-127563030 GACCCAAGTTTGAGAACTCCTGG + Intergenic
961796475 3:129412541-129412563 TAGCCCAGGGAGAGGACTCTGGG - Intronic
964611951 3:158624571-158624593 TGCCCCAGGCTGTGGAATCCTGG + Intergenic
965190510 3:165521876-165521898 TAGCACAGGGTGAGGACTCAAGG - Intergenic
965790983 3:172387715-172387737 GAGGCCAGGTAGAGGACTCCTGG + Intronic
967630553 3:191739553-191739575 TACCCCAGGATGATGACTGGTGG - Intergenic
970063869 4:12068600-12068622 TACCCCAGGATGAGAAATTCAGG + Intergenic
971574986 4:28261701-28261723 TACCCTAGCCTGAGGAATCCGGG + Intergenic
972994429 4:44863077-44863099 GCCCCAAGGTTGAGGAATCCTGG - Intergenic
983281505 4:165686635-165686657 TTCCCCTCGATGAGGACTCCTGG - Intergenic
989613435 5:43316797-43316819 TACCCCAGGCTGTAGAATCCTGG + Intergenic
990627248 5:57628169-57628191 CACCCCTGGTTGAGGACCACAGG - Intergenic
991306122 5:65177885-65177907 TACTCCAGGTTGTGGAATCCTGG - Intronic
992065582 5:73104712-73104734 TACCCCAGTTTGAAGACTGCTGG + Intergenic
996415155 5:123202782-123202804 TCCCCCAGGGTGAGGATCCCAGG + Intergenic
1000712822 5:164601717-164601739 TACTCCAAGTTGAGGTTTCCCGG - Intergenic
1000756355 5:165165531-165165553 TAACCCAGGTTCAGGTATCCTGG + Intergenic
1001990844 5:176114353-176114375 TCCCCCTGGTTCAGGCCTCCTGG + Exonic
1002226030 5:177723787-177723809 TCCCCCTGGTTCAGGCCTCCTGG - Exonic
1002267816 5:178047423-178047445 TCCCCCTGGTTCAGGCCTCCTGG + Exonic
1006269908 6:32956284-32956306 AACCCCTGGTTTAGGACTCTAGG - Intronic
1006925923 6:37655078-37655100 CACCCCAGGCTCAGGACCCCTGG - Intronic
1007370677 6:41425097-41425119 TGCCCCAGGCTGAGCACACCAGG + Intergenic
1007749406 6:44062911-44062933 AACCCCATGATGAGGGCTCCAGG + Intergenic
1019194475 6:170273055-170273077 TACCCCAGATAGAAGATTCCAGG - Intergenic
1019372669 7:671102-671124 TTCCTCAGGTTGAGGACTTGAGG + Intronic
1020745500 7:12073790-12073812 TACCCCAGGCTGTGGAATCTTGG - Intergenic
1021248606 7:18295725-18295747 TGCCCCCGGTTGAGAACTACTGG - Intronic
1022495798 7:30852396-30852418 AATCCCAGGATGAGGATTCCTGG - Intronic
1025757733 7:64360568-64360590 TACCCTGGGTTGGAGACTCCTGG + Intergenic
1026962109 7:74415438-74415460 TATCCCCGGTTGAGAACTACAGG - Intergenic
1028869161 7:95748465-95748487 TATCCAAGGTTGAGGATTCCTGG - Intergenic
1029273870 7:99392951-99392973 TGCCCCAGGAGGAAGACTCCAGG - Intronic
1031228565 7:119074540-119074562 TACCCGGGGTTGGGGACGCCTGG - Intergenic
1032682872 7:134203494-134203516 TTTCCCAGGTTGAGGGCCCCTGG + Intronic
1032785818 7:135198362-135198384 TACCGCAGGATGAGGATTGCAGG - Intronic
1033097446 7:138443263-138443285 TACCCCAGGCTGCAGAATCCTGG + Intergenic
1033302701 7:140200759-140200781 TTGCCCAGGCTGAGGACTACAGG + Intergenic
1034876873 7:154732620-154732642 CATCCCAGGCTGATGACTCCAGG - Intronic
1034882755 7:154775122-154775144 GTCCCCAGATTGAGGACTACTGG + Intronic
1036104322 8:5824040-5824062 TATCCCAGGCTGCGGAATCCTGG + Intergenic
1037904807 8:22709830-22709852 TACTCCAGGTTGAGCCATCCTGG - Intergenic
1039021179 8:33208603-33208625 TACCCCAAGGTGAACACTCCTGG + Intergenic
1041396715 8:57399147-57399169 CTGCCCAGGCTGAGGACTCCTGG + Intergenic
1045652089 8:104350775-104350797 TATCCAAGGTTGAGGACCTCTGG - Intronic
1048200920 8:132373244-132373266 TACCCCAGGTGTAGGTCTCCAGG - Intronic
1049186340 8:141256204-141256226 CACCCCAAGTTCAGGACTTCTGG + Intronic
1050204774 9:3184733-3184755 TACCTCAGCTTGAAGACTACTGG - Intergenic
1055350658 9:75383604-75383626 TATCCCAGGTTTAGTACTGCAGG - Intergenic
1059422183 9:114199168-114199190 CACCCCAAGTTGAGAACTACTGG - Intronic
1061316534 9:129799757-129799779 TACCCCAGGCTGAAGAGGCCTGG - Intergenic
1186577427 X:10781035-10781057 TACCGGAGGTTGGGGACCCCTGG + Intronic
1187556609 X:20358028-20358050 CACCGAAGGTTGAGGACCCCTGG + Intergenic
1187698907 X:21946212-21946234 GACCCCAGGTTGAGACCCCCAGG + Intronic
1188298955 X:28484058-28484080 CAGCCCAGGTTGAGAACTCCTGG + Intergenic
1189298519 X:39935863-39935885 CACCCCAGGTCGACGACGCCGGG - Intergenic
1190433608 X:50402065-50402087 TACCCCCAGTTGAGGACCACTGG + Intronic
1192326084 X:70133507-70133529 CTCCCTAGGTTGAGGAGTCCAGG - Exonic
1192493519 X:71597387-71597409 TAGCCGAGGATGAGGACCCCAGG + Intronic
1192751231 X:73994082-73994104 CACCCCTGGTTGAGGACAACTGG - Intergenic
1199278845 X:145976167-145976189 TACTCCAGGCTGTGGAATCCTGG - Intergenic
1200763179 Y:7058462-7058484 TACCCCAGGCTGTAGAATCCTGG + Intronic
1201296802 Y:12470667-12470689 TACCCCAGACTGTGGAATCCTGG + Intergenic