ID: 1169060513

View in Genome Browser
Species Human (GRCh38)
Location 20:2657477-2657499
Sequence ATTTACACTACCCCAGGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169060513_1169060516 10 Left 1169060513 20:2657477-2657499 CCTCAACCTGGGGTAGTGTAAAT 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 67
1169060513_1169060517 13 Left 1169060513 20:2657477-2657499 CCTCAACCTGGGGTAGTGTAAAT 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1169060517 20:2657513-2657535 ATTATCAGACGTGTGTCCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 25
1169060513_1169060518 16 Left 1169060513 20:2657477-2657499 CCTCAACCTGGGGTAGTGTAAAT 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1169060518 20:2657516-2657538 ATCAGACGTGTGTCCGGAGGTGG 0: 1
1: 0
2: 1
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169060513 Original CRISPR ATTTACACTACCCCAGGTTG AGG (reversed) Intronic
901621223 1:10589383-10589405 AATTACACTACACCCGGTTGGGG - Intronic
916740973 1:167646806-167646828 GCTAACACTACCCCAGGTTTTGG - Intronic
920071808 1:203307503-203307525 AAATACAGTTCCCCAGGTTGAGG - Exonic
920896611 1:210057187-210057209 ATTTATACTACCTCATGTTTGGG - Intronic
921157292 1:212448739-212448761 ATTTTCACTTCCACAGGTGGGGG - Intergenic
923345347 1:233046228-233046250 ATTTTGACTGCCTCAGGTTGGGG + Intronic
923514457 1:234682579-234682601 AGTTACACTGCCACAAGTTGTGG - Intergenic
1074230322 10:111527338-111527360 ACTTACAATACTCCAGGTGGAGG + Intergenic
1074602381 10:114928177-114928199 ATCTACACTATCATAGGTTGGGG - Intergenic
1074664886 10:115710708-115710730 ATTTACATACCCCCAGGTTTTGG + Intronic
1088219443 11:107552579-107552601 CTTTACAACACCACAGGTTGGGG + Intronic
1099946483 12:89250539-89250561 ATTGACACTGCCCCAGTTTGGGG + Intergenic
1111390987 13:87594284-87594306 AATTACTCTACCCCTGTTTGTGG - Intergenic
1114241783 14:20874727-20874749 ATTTAGACAACCCCAGGTCGTGG - Intergenic
1114248374 14:20935293-20935315 ATATAGACAACCCCAGGTCGTGG - Intergenic
1120179625 14:81330016-81330038 ATTAACACCATCCCACGTTGGGG + Intronic
1120763347 14:88305887-88305909 AGTTACCCTACCCAAGGCTGAGG + Intronic
1138771820 16:59674510-59674532 ATTTTCCATACACCAGGTTGTGG - Intergenic
1139262175 16:65605084-65605106 ATTTAACTAACCCCAGGTTGGGG + Intergenic
1140292352 16:73672007-73672029 ATTGACACTACCCAAGAATGAGG + Intergenic
1142549444 17:729062-729084 ATTTCCACTACTCCAGGCTGTGG - Intergenic
1150191700 17:63248090-63248112 ATTTAAGCTACCAGAGGTTGTGG - Intronic
1150760982 17:67961511-67961533 ATTTTCACTGCCACAGGTGGGGG - Intronic
1151444730 17:74155853-74155875 ATTAACACTAATCCAGCTTGTGG - Intergenic
1164414847 19:28038375-28038397 ATCTACACTTCTCCAGGTTTGGG - Intergenic
925843025 2:8009975-8009997 ATGTACAATTCCCCAGGCTGGGG + Intergenic
928641708 2:33306026-33306048 TTTCGCACTACCCCAGGTGGTGG + Intronic
931442350 2:62299178-62299200 GTTGCCACTACCCCATGTTGGGG - Intergenic
936035181 2:109105438-109105460 ATGTAGACAACCCCAAGTTGAGG + Intergenic
943040114 2:182794505-182794527 ATATACACTGACCCAGGTTAAGG + Intergenic
947151408 2:227120264-227120286 ATCTGCACTACCCAAAGTTGGGG + Intronic
1169060513 20:2657477-2657499 ATTTACACTACCCCAGGTTGAGG - Intronic
1173360644 20:42341601-42341623 ATCTACACTCTCCCAGGATGAGG + Intronic
1177873573 21:26603137-26603159 ATTTACAATAGCCAAGGTTTGGG - Intergenic
1179034535 21:37748129-37748151 ATTTATACAACCCCAGGTACGGG + Intronic
1184557627 22:45241491-45241513 ATCAACACTCCCCCATGTTGGGG - Intergenic
949829505 3:8198896-8198918 GTTTCCACGACCCCATGTTGAGG + Intergenic
950239370 3:11354276-11354298 ATTTACTCTTCCCCAGGATCAGG - Intronic
953470242 3:43160029-43160051 ATTTCCAAAACCCCAGGTGGAGG - Intergenic
960012186 3:112846397-112846419 ATTTACATTATCCCAGTTTGGGG + Intronic
967188387 3:186964817-186964839 GCTTACCCTACCCCAGGCTGTGG + Intronic
967242905 3:187458569-187458591 CTTTAGACTATCACAGGTTGTGG + Intergenic
980570979 4:134619564-134619586 TTTGCCACTCCCCCAGGTTGAGG + Intergenic
982813803 4:159860482-159860504 ATTTAAACTAAACCACGTTGTGG + Intergenic
983015805 4:162610082-162610104 ATATACTATACCCCAGGATGAGG + Intergenic
983264508 4:165493829-165493851 ATTTCCATTTCCCCAGTTTGAGG + Intronic
984889014 4:184474802-184474824 ATTTTCGCTTCCCCAGGTCGCGG + Intergenic
996171563 5:120298967-120298989 AGTTACACTACCAAAGTTTGAGG + Intergenic
1000255948 5:159538643-159538665 ATTATTACTACTCCAGGTTGGGG + Intergenic
1000426285 5:161094324-161094346 ATCTACACTACCCAAAGTTATGG - Intergenic
1006878755 6:37320945-37320967 TATTACACTAGCCCAGGCTGAGG - Intronic
1008045097 6:46843640-46843662 ATTTAACCTCCCCCAGGGTGTGG + Intergenic
1010931794 6:81812659-81812681 ATTTCCACTCCTCCAGGTTTCGG - Intergenic
1021878112 7:25067251-25067273 ATTTTCACTGCCACAGGTGGGGG + Intergenic
1022565888 7:31401478-31401500 ATTTACACTAACCTAGGAAGGGG - Intergenic
1023365693 7:39460959-39460981 AAATACACTACCCCAGGGTCAGG + Intronic
1028672150 7:93413977-93413999 ATTCACAATACCCAAAGTTGTGG - Intergenic
1033869085 7:145728112-145728134 ATTTACACTGCCCCGGGGTAGGG + Intergenic
1039397295 8:37237264-37237286 AATTACAATACCCTAGATTGGGG - Intergenic
1041193631 8:55378230-55378252 ATTTACACTATCAAAGGATGTGG + Intronic
1042598649 8:70476046-70476068 ATTTGTTCTACCTCAGGTTGAGG + Intergenic
1053652474 9:40183117-40183139 ATTTAACCTCCCCCAGGGTGTGG - Intergenic
1053902875 9:42812424-42812446 ATTTAACCTCCCCCAGGGTGTGG - Intergenic
1054532107 9:66193104-66193126 ATTTAACCTCCCCCAGGGTGTGG + Intergenic
1057009254 9:91587048-91587070 CTCTACTCTACCCCAGCTTGTGG + Intronic
1193697848 X:84730637-84730659 ATGTACTCTCCCCCAGGTTCTGG + Intergenic
1198127826 X:133663583-133663605 ATTTTCACTTCCACAGGTGGGGG + Intronic
1199907826 X:152252743-152252765 ACTCACACTACCTCTGGTTGGGG + Intronic