ID: 1169060514

View in Genome Browser
Species Human (GRCh38)
Location 20:2657483-2657505
Sequence GCAGGAATTTACACTACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 65}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169060514_1169060522 28 Left 1169060514 20:2657483-2657505 CCTGGGGTAGTGTAAATTCCTGC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1169060522 20:2657534-2657556 GGTGGTCGTGTTTCACAGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 83
1169060514_1169060517 7 Left 1169060514 20:2657483-2657505 CCTGGGGTAGTGTAAATTCCTGC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1169060517 20:2657513-2657535 ATTATCAGACGTGTGTCCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 25
1169060514_1169060520 26 Left 1169060514 20:2657483-2657505 CCTGGGGTAGTGTAAATTCCTGC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1169060520 20:2657532-2657554 GAGGTGGTCGTGTTTCACAGTGG 0: 1
1: 0
2: 1
3: 11
4: 83
1169060514_1169060521 27 Left 1169060514 20:2657483-2657505 CCTGGGGTAGTGTAAATTCCTGC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1169060521 20:2657533-2657555 AGGTGGTCGTGTTTCACAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 73
1169060514_1169060516 4 Left 1169060514 20:2657483-2657505 CCTGGGGTAGTGTAAATTCCTGC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 67
1169060514_1169060518 10 Left 1169060514 20:2657483-2657505 CCTGGGGTAGTGTAAATTCCTGC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1169060518 20:2657516-2657538 ATCAGACGTGTGTCCGGAGGTGG 0: 1
1: 0
2: 1
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169060514 Original CRISPR GCAGGAATTTACACTACCCC AGG (reversed) Intronic
900118787 1:1039941-1039963 CCAGGAATTTGCACTTCTCCAGG + Intronic
901621226 1:10589389-10589411 GAGGGAAATTACACTACACCCGG - Intronic
902799371 1:18819810-18819832 CCAGGATTTTCCACTGCCCCAGG + Intergenic
1066093485 10:32049954-32049976 GCAAGCATTTAAACTACCTCAGG - Intronic
1069782131 10:70963433-70963455 GCAGGAGCTGGCACTACCCCAGG - Intergenic
1078179404 11:8998276-8998298 GCAGGCTGTTACACTGCCCCAGG + Intronic
1081321080 11:41692301-41692323 GTAGGAATTTGCCCTACCACTGG + Intergenic
1087514354 11:99139123-99139145 GCAGGAATGGACACTATGCCTGG - Intronic
1091128707 11:133125170-133125192 GAGGGTATTTAAACTACCCCAGG + Intronic
1091132091 11:133154994-133155016 TCAGCAATCTACACTAACCCAGG - Intronic
1098479244 12:70940937-70940959 ACAGGAGTATACACTACCTCTGG - Intergenic
1098891708 12:76016228-76016250 GCATGCTTTTACACTATCCCGGG - Intergenic
1101579289 12:106027355-106027377 GTAGGAATGTGCATTACCCCAGG - Intergenic
1102755291 12:115334938-115334960 GCAGGAAGCTTCACTACCACTGG - Intergenic
1103330210 12:120149027-120149049 GCAGGAATTTAGACCAGCCTGGG - Intronic
1105455676 13:20538999-20539021 TCAGGAAGTGGCACTACCCCAGG - Intergenic
1113536289 13:111068779-111068801 GTACGAATTTACACTCCCACGGG + Intergenic
1117628709 14:57667163-57667185 GCAGGTATTTACACAAACACAGG - Intronic
1119025127 14:71146416-71146438 GCAGGCATCTACACTGCACCCGG - Intergenic
1121009354 14:90510826-90510848 GCAGGAGTGTACAGTGCCCCAGG - Intergenic
1121700325 14:95948787-95948809 GCAGGAATTTGCCGCACCCCAGG + Intergenic
1121884026 14:97526416-97526438 GAAGGAATTTACAATTTCCCAGG + Intergenic
1127407049 15:58660768-58660790 GCAGGAATTTCCTCTGCCCTTGG - Intronic
1129146657 15:73654023-73654045 GGATGAATTTAAACTATCCCAGG - Intergenic
1131707769 15:95016691-95016713 GCAGGCAGTTACTCTAGCCCTGG + Intergenic
1136866894 16:33766506-33766528 CCAGGAATTCGCACGACCCCGGG + Intergenic
1137964009 16:52913094-52913116 GCAGGAGTTTGCAATCCCCCAGG + Intergenic
1140142042 16:72267294-72267316 GAAGGAATTTAGAGTTCCCCTGG + Intergenic
1203105268 16_KI270728v1_random:1349696-1349718 CCAGGAATTCGCACGACCCCGGG - Intergenic
1203128246 16_KI270728v1_random:1612672-1612694 CCAGGAATTCGCACGACCCCGGG + Intergenic
1147684198 17:42276937-42276959 GCAGGAATTCACATTCGCCCAGG + Intergenic
1148148249 17:45379545-45379567 GCAGGCACTTACACAGCCCCTGG - Intergenic
1148794397 17:50190147-50190169 GCAGGAGTTTCCACTACCTGGGG + Intronic
1150162251 17:62908244-62908266 GGAGGAAGCTGCACTACCCCAGG - Intergenic
1150304061 17:64069550-64069572 GAAGGAATATTCCCTACCCCTGG + Intronic
1152341455 17:79728188-79728210 CCAGGAATTCGCACAACCCCAGG + Intergenic
1158252577 18:55505969-55505991 GCAGGAAATAACACTAGACCTGG + Intronic
1158654361 18:59315968-59315990 GCAGGAATTTACACTTTACTTGG - Intronic
948421359 2:237862613-237862635 GCTGGAATTCACACTACACATGG - Intronic
1169060514 20:2657483-2657505 GCAGGAATTTACACTACCCCAGG - Intronic
1170924167 20:20707787-20707809 CCAGGAACCTACCCTACCCCTGG + Intronic
1170933279 20:20788316-20788338 GCAGGAATTTACACTGAGCAAGG + Intergenic
1182795980 22:32991992-32992014 GCAGAAATCTACTCCACCCCAGG + Intronic
950913501 3:16618922-16618944 GCAGGAATGTACCCAATCCCAGG - Intronic
953166673 3:40471010-40471032 GGAGGAATTTTCACTAACCAGGG - Intergenic
963412577 3:144949764-144949786 GCAGGAATATATACTACTACTGG + Intergenic
968389028 4:173643-173665 GCAGGTTTTTACCCTATCCCAGG + Intergenic
999356384 5:150936687-150936709 GCAGGAATTTCAATTACCACAGG + Intergenic
1004327495 6:14688798-14688820 TCAAGAATTTTCACTACCACTGG + Intergenic
1006120914 6:31805204-31805226 ACAGGCATGTACACTACACCTGG + Intronic
1009368449 6:62874257-62874279 CAGGGAATTTACACCACCCCCGG + Intergenic
1019943113 7:4306749-4306771 TAAGGAATTTTCACCACCCCAGG + Intergenic
1035987717 8:4453277-4453299 ACATGAATTTACACTCCCACTGG + Intronic
1038003224 8:23407858-23407880 GCAGTAATTCACATGACCCCTGG - Intronic
1039531896 8:38269581-38269603 GCAGGAAGCTACACTACCTGAGG + Intronic
1045848880 8:106670048-106670070 TCAGGAATCAACACTACCCCTGG - Intronic
1046810611 8:118529149-118529171 CCAGGAACTTACACTATACCAGG + Intronic
1047330964 8:123886345-123886367 GCAAGAATTCACTCAACCCCGGG - Intronic
1050555650 9:6787681-6787703 GAGGCAATTTACACTAACCCAGG - Intronic
1051475921 9:17509151-17509173 GCAGGAATTTTCACTCACCAAGG + Intergenic
1053099092 9:35354339-35354361 GTGGGAATTTCCCCTACCCCAGG + Intronic
1191730226 X:64325833-64325855 GGAGGAAGTTAAACTATCCCTGG + Intronic
1191936160 X:66429287-66429309 GCAGGAATTTTTACAACCCAAGG - Intergenic
1196511878 X:116521376-116521398 GCAGGAAATTACAATATGCCAGG - Intergenic
1197082817 X:122439988-122440010 GCTGGATTTTACAATTCCCCAGG + Intergenic
1198022936 X:132676971-132676993 GCAGTAATTGCCACTTCCCCAGG - Intronic
1200112878 X:153751489-153751511 GCAGGAACTCACACTTCCCCGGG + Intergenic
1200759580 Y:7025661-7025683 TTAGGAATTTACTCTACTCCAGG + Intronic