ID: 1169060516

View in Genome Browser
Species Human (GRCh38)
Location 20:2657510-2657532
Sequence CTTATTATCAGACGTGTGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169060512_1169060516 18 Left 1169060512 20:2657469-2657491 CCAGGAGTCCTCAACCTGGGGTA 0: 1
1: 0
2: 1
3: 18
4: 165
Right 1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 67
1169060513_1169060516 10 Left 1169060513 20:2657477-2657499 CCTCAACCTGGGGTAGTGTAAAT 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 67
1169060514_1169060516 4 Left 1169060514 20:2657483-2657505 CCTGGGGTAGTGTAAATTCCTGC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 67
1169060507_1169060516 22 Left 1169060507 20:2657465-2657487 CCTCCCAGGAGTCCTCAACCTGG 0: 1
1: 0
2: 1
3: 19
4: 164
Right 1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 67
1169060511_1169060516 19 Left 1169060511 20:2657468-2657490 CCCAGGAGTCCTCAACCTGGGGT 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169060516 Original CRISPR CTTATTATCAGACGTGTGTC CGG Intronic
906777318 1:48541429-48541451 CTTATTGTCAGATGAGTGTGTGG - Intronic
906856271 1:49308615-49308637 CCTATTATCAGTCCTTTGTCTGG - Intronic
911741505 1:101391170-101391192 CTTATTCTCCGCCGTGTGACAGG + Intergenic
912269294 1:108192901-108192923 CTTCTGATCAGACGTGAGTGAGG - Intronic
912848241 1:113096814-113096836 CTTATTATCTGATATGTGCCAGG + Intronic
913281637 1:117190509-117190531 CTTGTTATCAGGTGTGTGTATGG - Intronic
917114484 1:171588731-171588753 CTCATTATCAGAGCTGTGTGGGG - Intronic
1071787245 10:88915701-88915723 CTTATTATTAGTCATCTGTCTGG - Intronic
1080045611 11:27804721-27804743 CTTTATATCAGACCTGTGTTAGG + Intergenic
1080354006 11:31420204-31420226 AGTATAAACAGACGTGTGTCTGG - Intronic
1091335622 11:134763412-134763434 CTGAATGTCAGCCGTGTGTCAGG - Intergenic
1101193211 12:102355964-102355986 TTTATTATCTGACATGTGCCTGG + Intergenic
1105996108 13:25673639-25673661 ATTATGATCAGATCTGTGTCTGG - Intronic
1106792797 13:33172775-33172797 ATTATTATCAGACATGTAGCTGG + Intronic
1108629480 13:52267755-52267777 CTGAATATCAGACCTTTGTCGGG + Intergenic
1108656576 13:52538733-52538755 CTGAATATCAGACCTTTGTCGGG - Intergenic
1109406356 13:61905378-61905400 CTTATTATCAAACGTTAGCCAGG + Intergenic
1109945380 13:69424681-69424703 CTTATTACCAGAATTGTTTCTGG - Intergenic
1110900709 13:80820015-80820037 CTTATTATCAAAGGAATGTCAGG + Intergenic
1111280931 13:86023874-86023896 CTTAGAATCAGAAGTGTTTCAGG - Intergenic
1119653628 14:76400993-76401015 CTTCTTCTCACACATGTGTCTGG - Intronic
1136866769 16:33765565-33765587 CTTATGATCAGATGGCTGTCAGG - Intergenic
1203105393 16_KI270728v1_random:1350637-1350659 CTTATGATCAGATGGCTGTCAGG + Intergenic
1203128121 16_KI270728v1_random:1611731-1611753 CTTATGATCAGATGGCTGTCAGG - Intergenic
1145889821 17:28406401-28406423 CTTGTTATCTGTGGTGTGTCTGG - Intronic
1149668987 17:58388309-58388331 CACATTATCAGACCTGTTTCTGG + Intronic
1149822450 17:59792886-59792908 ATTATTATCAGATGAGTGGCTGG + Intronic
1155895389 18:31318687-31318709 CTAAATATCACAAGTGTGTCTGG + Intronic
1162239075 19:9333700-9333722 CTTATTCTCAGGCTTGTTTCTGG - Intronic
1162908285 19:13836194-13836216 CTCAGAATCAGACCTGTGTCTGG - Intergenic
1163999952 19:21089354-21089376 CTTATTACCAGACTTTAGTCAGG + Intronic
925838071 2:7965185-7965207 GTAAGTATCAGACGTGTGTGCGG - Intergenic
928102131 2:28444987-28445009 CTTATTCTCAGCCCTGTGTTTGG + Intergenic
929301394 2:40307684-40307706 CTGGTTACCAGAGGTGTGTCTGG + Intronic
930460324 2:51665403-51665425 CTTAGTATAAGACATGAGTCTGG - Intergenic
934829811 2:97506644-97506666 ATTATTATCACACGAGTGTGGGG + Intronic
935124126 2:100207898-100207920 CTTCTTATCAGACATGTGCGTGG - Intergenic
936694280 2:114928383-114928405 CTGATTTTCAGACTTGTGTGGGG - Intronic
936695341 2:114940357-114940379 CTTATAATAAAACATGTGTCTGG - Intronic
946160436 2:217832434-217832456 CTTCTTCTCAGAGCTGTGTCAGG - Intronic
946652550 2:221909175-221909197 CTTGTGATCAGAAGTGTCTCAGG + Intergenic
1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG + Intronic
1181345273 22:22215456-22215478 CTTATTAACAAATGTGTGTAGGG + Intergenic
1183186912 22:36297097-36297119 CTCGTTATGAAACGTGTGTCAGG + Intronic
949941202 3:9156192-9156214 CTTATCATCAGAAGTGAGTTTGG + Intronic
951068580 3:18297228-18297250 CTTATTATCAGAAATCTGACAGG + Intronic
955672504 3:61416563-61416585 CTTATCTACAGATGTGTGTCAGG - Intergenic
959047064 3:101485664-101485686 CATATTATCAGAGTTGTTTCTGG - Intronic
961237866 3:125383843-125383865 CTTACTGTGAGACGTGTGTATGG + Intergenic
967695238 3:192523550-192523572 TTTATTATCAGACTTGGGTAGGG - Intronic
968699927 4:2050366-2050388 CTTATTATCAGATTTCAGTCAGG - Intergenic
975231486 4:71939418-71939440 ATTATTATCATATGTGTGTGGGG - Intergenic
976880236 4:89913366-89913388 CTTATTAGTAGACATGTGGCAGG + Intronic
979341205 4:119526320-119526342 CTTATGATCAGGCTTGTGTGAGG - Intronic
983658967 4:170112803-170112825 CTTATTATCAGATTTTAGTCAGG - Intergenic
986220171 5:5761835-5761857 CTTAGCATCTGACGAGTGTCTGG + Intergenic
999480715 5:151945712-151945734 CTCAGTATCAGTCCTGTGTCAGG - Intergenic
1011790106 6:90889754-90889776 CTTCTTATCACACGTGTCTCGGG + Intergenic
1012340637 6:98118450-98118472 CAAATTAGCAGACGTGTGACTGG - Intergenic
1015932228 6:138373297-138373319 CATATTATAAGAAATGTGTCAGG - Intergenic
1020719066 7:11718398-11718420 CATATTATCAGATGTGTCACAGG + Intronic
1022155482 7:27657925-27657947 CTTATTATCAATCGTGTGCCAGG - Intronic
1025284827 7:57652765-57652787 CATCTTCTCTGACGTGTGTCCGG + Intergenic
1026419596 7:70220382-70220404 TTTAGTATCAGACGTGTGTTAGG + Intronic
1032364382 7:131285481-131285503 CTTATTATCAGATGGATGTGAGG + Intronic
1048815290 8:138328028-138328050 CTTATTATCATTCTTGTCTCGGG + Intronic
1051926851 9:22338455-22338477 CTTATTTTCAGATGTCTGTGAGG - Intergenic
1056395962 9:86181239-86181261 CTCATTATTAGACTGGTGTCAGG - Intergenic
1056396109 9:86182655-86182677 CTTATTATTAGACTGGTGTCAGG - Intergenic
1058659264 9:107254519-107254541 TTTATTATCAGAAGGTTGTCTGG - Intergenic
1062042266 9:134409553-134409575 CTTATTAACAAATCTGTGTCGGG + Intronic
1194358936 X:92922941-92922963 CTTATTTTCAGACTTGGCTCTGG + Intergenic