ID: 1169061207

View in Genome Browser
Species Human (GRCh38)
Location 20:2661684-2661706
Sequence TCTCAAGGGCAGGAGTTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169061207_1169061212 -6 Left 1169061207 20:2661684-2661706 CCATACAACTCCTGCCCTTGAGA 0: 1
1: 0
2: 0
3: 11
4: 144
Right 1169061212 20:2661701-2661723 TTGAGAAGCAAACGGTACACTGG 0: 1
1: 0
2: 0
3: 7
4: 85
1169061207_1169061213 -5 Left 1169061207 20:2661684-2661706 CCATACAACTCCTGCCCTTGAGA 0: 1
1: 0
2: 0
3: 11
4: 144
Right 1169061213 20:2661702-2661724 TGAGAAGCAAACGGTACACTGGG 0: 1
1: 0
2: 1
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169061207 Original CRISPR TCTCAAGGGCAGGAGTTGTA TGG (reversed) Intronic
901926227 1:12567837-12567859 TCTCAAAGGATGGAGTTTTATGG + Intergenic
906886007 1:49649979-49650001 TATCAAAAGCAGGAGTTGGAAGG + Intronic
907743140 1:57186259-57186281 TCTCAAGTCCAGGATTAGTATGG + Intronic
909541262 1:76794041-76794063 TGCCAAGGGCAGGAGGAGTAGGG + Intergenic
909676400 1:78243086-78243108 TCTCTAGGGCTGGAGTTGTCTGG + Intergenic
916449331 1:164904832-164904854 ACTCAAGACCAGGAGTTGAAGGG + Intergenic
917178957 1:172272142-172272164 TCTCAAGCAAAGCAGTTGTAAGG - Intronic
919842139 1:201617326-201617348 TCTCAAGGGCAGAAGTTTAGGGG - Intergenic
920418017 1:205811726-205811748 TCTCAAGGGCAGGAGTGGGTAGG - Intronic
922302400 1:224313288-224313310 TTTTTAGGGCATGAGTTGTAAGG - Intronic
922532758 1:226356969-226356991 ACTAAAGGGCAGGACTTTTAGGG + Intergenic
923888771 1:238187838-238187860 ACTCAAGGACAGGAGATATAAGG + Intergenic
923973837 1:239236850-239236872 TGCCAAGGGCAGGGGTTTTAGGG + Intergenic
1066494858 10:35932873-35932895 TCTCAAAGGGAGGACTTGAATGG - Intergenic
1068915850 10:62430607-62430629 TCTCCAGGGTTGGAGTTTTATGG - Intronic
1070032931 10:72694118-72694140 TCTAAAGGGCAGGAATGTTATGG + Intronic
1071863830 10:89703564-89703586 TCTCAAGGGCAGCAGTGGCTTGG + Intronic
1074035806 10:109737250-109737272 TCCCAAGGGCAGGAATTAAATGG + Intergenic
1075094265 10:119460780-119460802 CCTCAAGGGCAGAAGATGCAGGG + Intergenic
1075619781 10:123917448-123917470 TATCAAGAGCAGCAGTTGGAAGG - Intronic
1075625098 10:123958282-123958304 ACTCAGGGGCAGGAGTGGGAAGG + Intergenic
1081852677 11:46284745-46284767 GCTCAAGGGCAGGAGTCCTATGG + Intronic
1083736222 11:64682838-64682860 CCTCAAGGGCTGGATTTGAAAGG + Intronic
1085730607 11:78995374-78995396 TGTCAAGGACAGGAGTTTTCAGG - Intronic
1086683917 11:89708353-89708375 TGTCAAGGGTAGGGGTTGGAAGG - Intergenic
1087016921 11:93562891-93562913 TCTCAAAAGCAGGAGGGGTAAGG - Intergenic
1087182511 11:95153795-95153817 TGTCAAGGGAAGGAGTGGTGAGG - Intergenic
1088834089 11:113562485-113562507 TCTCAGGGACAGGAGATGCAAGG + Intergenic
1090809797 11:130227443-130227465 TCTCAAGGGAAGGTGATGCAGGG - Exonic
1092146082 12:6215630-6215652 TCCCAAGAGCAGAAGTTGTCTGG + Intronic
1095514713 12:42993170-42993192 TCTGAAATGCAGGAGATGTATGG - Intergenic
1096114378 12:49046751-49046773 GCTCAAGGGCTGGCGTTGTGTGG - Exonic
1104058630 12:125249394-125249416 TCACAAGGGCAGGAGCTGTTAGG + Intronic
1112847711 13:103664393-103664415 TCTCAAGGGCAGTAGTGGTGAGG - Intergenic
1113974967 13:114220671-114220693 TCTCATGTGCAGGAGTTATTGGG - Intergenic
1114861601 14:26529481-26529503 GGTCAAGGGTTGGAGTTGTAGGG + Intronic
1115456777 14:33613210-33613232 TCTGAAAGGCAGGGTTTGTAGGG - Intronic
1115509607 14:34126682-34126704 TCTCAAGGGCAGATGATGTAAGG - Intronic
1116205396 14:41858922-41858944 ACTCCAGGGCAGGATTTGTATGG - Intronic
1116832163 14:49731760-49731782 GCTCAAGCCCAGGAGTTGGACGG - Intronic
1119604808 14:76006272-76006294 TTTCAAGGGCAGGAGTGGGGAGG + Intronic
1122123761 14:99568355-99568377 TCTAAAGGGCTGGAGTGGTGGGG + Intronic
1122160593 14:99781410-99781432 TCTAGAGGGCAGGAGTGGTGGGG - Intronic
1122864082 14:104595669-104595691 TCTCAGAGGCAGGAGATGCAGGG + Intronic
1124785163 15:32672409-32672431 TCTGGAGGGCAGGGGTTGTCCGG + Intronic
1125784882 15:42307414-42307436 ACTCAAGGCCAGGAGTTCAAGGG - Intronic
1126412041 15:48382230-48382252 TCTCAGTGGCCGGAATTGTATGG + Intergenic
1129150849 15:73686971-73686993 TCCCCAGGGCAGGAGTGTTAGGG + Intronic
1130906294 15:88242949-88242971 TCCCTAGGGCAGGTGTTGGAGGG - Intronic
1131135699 15:89933515-89933537 TCCCAGGGGCAGGAGTGGGAGGG + Intergenic
1131406434 15:92168697-92168719 TCTCATGGTCAGGAGTGTTAAGG - Intronic
1132641115 16:979056-979078 TCTGCAGGGCAGGAGCTGTGAGG + Intronic
1132799307 16:1743845-1743867 TCTCAGGGGCAGGATGTGTCTGG - Intronic
1133180180 16:4048532-4048554 CTACAAGTGCAGGAGTTGTAGGG - Intronic
1135865818 16:26100927-26100949 GCTCAAAGGCAGGAGATGAAAGG + Intronic
1139572855 16:67824205-67824227 TCTCAATGACAGGTGTTGTCAGG - Intronic
1141659765 16:85435590-85435612 ACTCAAGGGGAGGAGTTGCAGGG - Intergenic
1142369763 16:89672344-89672366 TTTCAAGGGGAGGAGCTGGAGGG - Intergenic
1145300322 17:21630190-21630212 TCACAAGGTCAGGAGTTCCAAGG - Intergenic
1148480100 17:47954399-47954421 CCACAAGGACAGGAGTTGGAAGG + Intronic
1150171641 17:63002219-63002241 TCTCTAGGGTAGAAGTAGTAAGG + Intergenic
1152050783 17:77974542-77974564 TCTCAAGCCCAGGAGTTCAAGGG - Intergenic
1152261442 17:79269465-79269487 TCTCAGAGGCAGGAGTGGGAAGG - Intronic
1153162167 18:2218895-2218917 TCTCAATGCCAGGAGTTATTGGG - Intergenic
1153619588 18:6964661-6964683 TACCAAGGTCAAGAGTTGTAAGG - Exonic
1154106344 18:11527048-11527070 TCTTGAGGACAGGAGTTGGAGGG + Intergenic
1155039924 18:22056287-22056309 TCTCAATGGGAGGAGGGGTAAGG + Intergenic
1156591455 18:38494152-38494174 TCTCATGGACAGGAGAGGTAAGG + Intergenic
1157002104 18:43539053-43539075 ACTCATAGGCAGGAGTTGAACGG - Intergenic
1158084780 18:53638285-53638307 TGTCATGGGGAGGAGTTCTAAGG - Intergenic
1158293334 18:55966743-55966765 ACTCAAGGACAGGAGGAGTAGGG + Intergenic
1159622201 18:70651424-70651446 TCTCAAGGGAAGGAGGTGACTGG - Intergenic
1159663984 18:71134512-71134534 ACTCAAGGGCAGGAGAAGAAGGG - Intergenic
1164822863 19:31263883-31263905 TCTCCATGGAATGAGTTGTACGG + Intergenic
1165278122 19:34772622-34772644 AATCCAGGACAGGAGTTGTAAGG - Intronic
1167132916 19:47599311-47599333 CCTCTAGGGCAGGAGCTCTAGGG + Intergenic
1168003901 19:53470198-53470220 TCTAAAGGGGAGGAGGTGTCTGG + Intronic
927174313 2:20394794-20394816 TCTCAAGGGCAGAAATTGATGGG + Intergenic
927307276 2:21588105-21588127 GCTCAAGGGCAGCAATTCTAAGG - Intergenic
928046702 2:27941343-27941365 TCACAAGGTCAGGAGTTGCCTGG + Intronic
929213269 2:39383044-39383066 TCTGAAAGGGAGTAGTTGTATGG - Intronic
931765478 2:65452366-65452388 TCTCAAGGCCAGAAGTGGTGAGG - Intergenic
933580013 2:84115290-84115312 TCTCAAAGGCAGGCCCTGTAGGG + Intergenic
938689815 2:133777199-133777221 GCTCAAGGGCTGGAGCTGTGTGG - Intergenic
942446368 2:176081186-176081208 TCTCAATCCCAGGATTTGTACGG + Intronic
944006917 2:194920767-194920789 TCTCAAGGCCAGTGCTTGTATGG - Intergenic
947425609 2:229980576-229980598 TATCAAGGGCAGGGCTTGGAAGG - Intronic
948401811 2:237691026-237691048 GCTTCAGGGCAGGAGTTGTCAGG - Intronic
948730744 2:239962242-239962264 TCTTAAGGGCAGAATTTGGAAGG - Intronic
1169061207 20:2661684-2661706 TCTCAAGGGCAGGAGTTGTATGG - Intronic
1173298276 20:41778597-41778619 TGTGAAGAGCAGGAGTTGGATGG - Intergenic
1174230255 20:49040508-49040530 TCTCCAGGGCAAGACTTGAAGGG - Intergenic
1177207158 21:18023271-18023293 TCTCAAGGGGAGGTGGTGTGGGG + Intronic
1180170704 21:46056841-46056863 TCTCAAGGGCAGCAGAGGTCAGG + Intergenic
1184703886 22:46196938-46196960 TCACGAGGTCAGGAGTTGGAGGG - Intronic
1185126981 22:49016792-49016814 TCTCCAGGGCAGGAGCAGCAAGG + Intergenic
949902118 3:8824175-8824197 TCTCAAGGTTAGAAGTGGTAAGG + Intronic
952220584 3:31320287-31320309 TCTCAGGTGCAGAAGTTGAAAGG - Intergenic
954593208 3:51801896-51801918 TGTCAAGGGATGGAGTTGCAGGG + Intergenic
954618856 3:51984413-51984435 TCTCCAGGGCAGGAGTGGTGGGG + Intronic
960569907 3:119175559-119175581 GCTCCAGGGCAGGAGTACTATGG - Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
963845851 3:150157276-150157298 TGTTCAGGGCAGGAGTTGTTAGG + Intergenic
968496932 4:923671-923693 TCTCAAGGGCAGGGAGTGGAGGG + Intronic
968735281 4:2291914-2291936 GCTGCAGGGCAGGAGTTGCAGGG + Intronic
975195704 4:71520937-71520959 ACTCAAGGCCAGGAGTTCTGAGG - Intronic
975818643 4:78246698-78246720 TTTCAAGTGAAGGAGTTGTTAGG + Intronic
978833181 4:113114222-113114244 TCTCAAGGGCAGGAGGGCCAAGG - Intronic
983755411 4:171328917-171328939 TCTCAGAGGCAGGAGATGTGAGG + Intergenic
984535265 4:180967377-180967399 TCTCAAGGGCATGAGGGGTGGGG - Intergenic
986280596 5:6318920-6318942 TCTCAAGGGCAGAAGCAGTGAGG - Intergenic
986847403 5:11771339-11771361 TCACAAGGTCAGGAGTTCAAGGG - Intronic
987059895 5:14232519-14232541 CCGCAAGGGCAGGAATTGTCTGG + Intronic
990802517 5:59620783-59620805 ACTCAAGGTCATGAATTGTAGGG + Intronic
994669999 5:102753996-102754018 TCTGAAGGGGAGGAGTTGTCTGG + Intronic
996873647 5:128217795-128217817 TCTCTAGCCCAGGAGATGTAAGG - Intergenic
997641573 5:135452075-135452097 TCCCAAAGGCTGGATTTGTAGGG - Intronic
997887214 5:137640736-137640758 TCTCTAGAGCAGGAGTTGGGGGG - Intronic
998793667 5:145793899-145793921 TCTCAGGGGAAGGGGTTGTGGGG - Intronic
1001145238 5:169177976-169177998 TCTCAAGGAAAGGAGCTGAAAGG - Intronic
1005432592 6:25774046-25774068 TCTCAAAGGCAGAATTTGTTTGG - Intronic
1007415383 6:41688464-41688486 GCTCAAGGGCAGAAGTGGTGGGG + Intronic
1008336817 6:50316544-50316566 TCTCAAGAGAGGAAGTTGTAAGG - Intergenic
1013150034 6:107437080-107437102 GCTCGAGGCCAGGAGTTGAAGGG - Intronic
1013937533 6:115616228-115616250 TCTCAGAGGCAGGAATTGTGAGG - Intergenic
1014855087 6:126390604-126390626 GTGCAAGGGTAGGAGTTGTAGGG - Intergenic
1021516995 7:21500422-21500444 TCTCTAGGTCAGGAGTTCAAGGG + Intronic
1022443590 7:30452500-30452522 TCCCAGGGGCAGGAGCTGTCAGG + Exonic
1023595749 7:41828156-41828178 GCTCAAGAGCAGCAGCTGTAAGG + Intergenic
1023708752 7:42969541-42969563 TCTGAAGGCCAGGAGTTGCCTGG - Intergenic
1026233004 7:68501679-68501701 GCCCAAGGGCAGGAGTAGAAAGG + Intergenic
1031330892 7:120462721-120462743 TTTCATGGAAAGGAGTTGTAAGG - Intronic
1036621806 8:10429144-10429166 TCTTAAGGGCAGGGATTGAAGGG - Intergenic
1037197840 8:16213598-16213620 TCTGAACAGCAGGAGTTGTAGGG - Intronic
1038488563 8:27953347-27953369 TGGCAAGTGCAGGAGATGTAGGG - Intronic
1038597195 8:28898462-28898484 CTTCAAGGACAGGCGTTGTAGGG + Intronic
1041545228 8:59034941-59034963 TCTCAAGGTCAGGAAGTGGAAGG + Intronic
1042679782 8:71370211-71370233 TCTGAAAGGCAGGACGTGTAGGG - Intergenic
1048026480 8:130591940-130591962 TCTCAAGAGTGGGAGTTGTTGGG + Intergenic
1048845005 8:138597660-138597682 CCTCAAGGGCAGGGGTCTTACGG + Intronic
1049742014 8:144245400-144245422 TGTCAGGGCCAGGAGTTGTCAGG + Intronic
1049768187 8:144365257-144365279 AATCAAGGGCAGGAGGTGAAAGG - Intergenic
1050104144 9:2147914-2147936 ACTCAAGGCCAGGAGTTTGAGGG - Intronic
1056772906 9:89492591-89492613 TCTTCAGGGGAGGAGTTGTGAGG - Intronic
1056983331 9:91337811-91337833 TCTCAAGGGAAGGAATTGATTGG + Intronic
1059552451 9:115243143-115243165 TCTCAAAGGCAGGGGTGGGAAGG - Intronic
1060397386 9:123325680-123325702 TCTCAATAGCAGGATTTCTAGGG + Intergenic
1060777475 9:126386199-126386221 TCTCAAGGCCAGGAGGTTTTAGG - Intronic
1187497574 X:19808601-19808623 TCTTGAGGGCAGCAGTTGTGGGG - Intronic
1190436776 X:50433430-50433452 TCTCAATGGCTGCAGTTATAGGG - Intronic
1192316160 X:70053344-70053366 TCTCAGGGGCAGGAATTGGGTGG + Intergenic
1194320009 X:92434622-92434644 TCTTAAGCCCAGGAGTTGGAGGG - Intronic
1197791805 X:130262523-130262545 TGGCAAGGGAAGGAATTGTATGG + Intronic
1200208498 X:154334691-154334713 TCCAAAGGGCAGGAGTGGGAGGG + Intergenic
1200628129 Y:5547756-5547778 TCTTAAGCCCAGGAGTTGGAGGG - Intronic
1200717941 Y:6571546-6571568 TCTAAAGGGCAAGAAGTGTAAGG + Intergenic