ID: 1169061785

View in Genome Browser
Species Human (GRCh38)
Location 20:2665648-2665670
Sequence GCCACCTTTTTGGCTGGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169061785_1169061789 11 Left 1169061785 20:2665648-2665670 CCTCAACCAGCCAAAAAGGTGGC No data
Right 1169061789 20:2665682-2665704 ATTCCCAGTGCTTCTATTCTTGG No data
1169061785_1169061791 13 Left 1169061785 20:2665648-2665670 CCTCAACCAGCCAAAAAGGTGGC No data
Right 1169061791 20:2665684-2665706 TCCCAGTGCTTCTATTCTTGGGG No data
1169061785_1169061794 25 Left 1169061785 20:2665648-2665670 CCTCAACCAGCCAAAAAGGTGGC No data
Right 1169061794 20:2665696-2665718 TATTCTTGGGGAATATGCATAGG No data
1169061785_1169061790 12 Left 1169061785 20:2665648-2665670 CCTCAACCAGCCAAAAAGGTGGC No data
Right 1169061790 20:2665683-2665705 TTCCCAGTGCTTCTATTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169061785 Original CRISPR GCCACCTTTTTGGCTGGTTG AGG (reversed) Intergenic
No off target data available for this crispr