ID: 1169065727

View in Genome Browser
Species Human (GRCh38)
Location 20:2693276-2693298
Sequence CGGGGCCGCGGTCGTCGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 268}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169065727_1169065739 4 Left 1169065727 20:2693276-2693298 CCCCTCCGACGACCGCGGCCCCG 0: 1
1: 0
2: 1
3: 17
4: 268
Right 1169065739 20:2693303-2693325 GCCGCCAGAGCGCGCCTCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 90
1169065727_1169065737 2 Left 1169065727 20:2693276-2693298 CCCCTCCGACGACCGCGGCCCCG 0: 1
1: 0
2: 1
3: 17
4: 268
Right 1169065737 20:2693301-2693323 CAGCCGCCAGAGCGCGCCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 109
1169065727_1169065745 23 Left 1169065727 20:2693276-2693298 CCCCTCCGACGACCGCGGCCCCG 0: 1
1: 0
2: 1
3: 17
4: 268
Right 1169065745 20:2693322-2693344 GGGGCGCCTCCGCGCGGACCGGG 0: 1
1: 0
2: 1
3: 14
4: 120
1169065727_1169065738 3 Left 1169065727 20:2693276-2693298 CCCCTCCGACGACCGCGGCCCCG 0: 1
1: 0
2: 1
3: 17
4: 268
Right 1169065738 20:2693302-2693324 AGCCGCCAGAGCGCGCCTCTGGG 0: 1
1: 0
2: 1
3: 4
4: 66
1169065727_1169065744 22 Left 1169065727 20:2693276-2693298 CCCCTCCGACGACCGCGGCCCCG 0: 1
1: 0
2: 1
3: 17
4: 268
Right 1169065744 20:2693321-2693343 TGGGGCGCCTCCGCGCGGACCGG 0: 1
1: 0
2: 1
3: 6
4: 59
1169065727_1169065748 29 Left 1169065727 20:2693276-2693298 CCCCTCCGACGACCGCGGCCCCG 0: 1
1: 0
2: 1
3: 17
4: 268
Right 1169065748 20:2693328-2693350 CCTCCGCGCGGACCGGGTGCGGG 0: 1
1: 0
2: 0
3: 11
4: 89
1169065727_1169065742 17 Left 1169065727 20:2693276-2693298 CCCCTCCGACGACCGCGGCCCCG 0: 1
1: 0
2: 1
3: 17
4: 268
Right 1169065742 20:2693316-2693338 GCCTCTGGGGCGCCTCCGCGCGG 0: 1
1: 0
2: 1
3: 13
4: 145
1169065727_1169065746 28 Left 1169065727 20:2693276-2693298 CCCCTCCGACGACCGCGGCCCCG 0: 1
1: 0
2: 1
3: 17
4: 268
Right 1169065746 20:2693327-2693349 GCCTCCGCGCGGACCGGGTGCGG 0: 1
1: 0
2: 1
3: 11
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169065727 Original CRISPR CGGGGCCGCGGTCGTCGGAG GGG (reversed) Intronic
900131134 1:1087852-1087874 CGGGGCCGGGGTGCTCGGCGTGG - Intronic
900180128 1:1307654-1307676 CCGGGCCGCGGCCGCCGGGGAGG - Intronic
900349735 1:2228668-2228690 CGGGGCCGCGGGCGCCGCCGGGG + Intergenic
900382499 1:2391818-2391840 CGGCGCCGCGGAGGACGGAGCGG + Exonic
900422490 1:2561641-2561663 TGGGGCCGAGGACGTGGGAGAGG - Intronic
902033487 1:13439559-13439581 GGGGGCCGCGCTCGTCGGGGAGG - Intergenic
903652478 1:24930276-24930298 CGGGGCCGCGGCCGCCCGCGCGG + Intronic
903792813 1:25906257-25906279 CGGGGCTGCGGGCCTCGGAGGGG - Intronic
904238850 1:29131192-29131214 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
904528802 1:31155009-31155031 CGGGGCCGGAGTCGAGGGAGGGG + Intergenic
909608690 1:77531802-77531824 GGGGGCTGCGCTCGTCGGGGAGG + Intronic
911839202 1:102660060-102660082 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
912800181 1:112715314-112715336 CGGGGCCGCGGCCGAGGGCGGGG - Exonic
915104170 1:153522089-153522111 GGGGGTGGCGCTCGTCGGAGAGG - Intergenic
915902353 1:159855911-159855933 CGGCGGCGGGGTCGGCGGAGGGG - Exonic
916219913 1:162433464-162433486 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
916940108 1:169668323-169668345 GGGGGCAGCGCTCGTCGGGGAGG - Intronic
919250877 1:195054590-195054612 GGGGGCCGTGCTCGTCGGGGAGG - Intergenic
920731325 1:208488486-208488508 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
920881986 1:209888999-209889021 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
922832415 1:228610467-228610489 CGGGGCCGCGGGGCTCGGATCGG + Intergenic
922832975 1:228612708-228612730 CGGGGCCGCGGGGCTCGGATCGG + Intergenic
922833536 1:228614949-228614971 CGGGGCCGCGGGGCTCGGATCGG + Intergenic
922834096 1:228617190-228617212 CGGGGCCGCGGGGCTCGGATCGG + Intergenic
922834653 1:228619431-228619453 CGGGGCCGCGGGGCTCGGATCGG + Intergenic
922835205 1:228621646-228621668 CGGGGCCGCGGGGCTCGGATCGG + Intergenic
922835764 1:228623866-228623888 CGGGGCCGCGGGGCTCGGATCGG + Intergenic
922836322 1:228626108-228626130 CGGGGCCGCGGGGCTCGGATCGG + Intergenic
922836880 1:228628347-228628369 CGGGGCCGCGGGGCTCGGATCGG + Intergenic
922837439 1:228630589-228630611 CGGGGCCGCGGGGCTCGGATCGG + Intergenic
922838000 1:228632830-228632852 CGGGGCCGCGGGGCTCGGATCGG + Intergenic
922838558 1:228635070-228635092 CGGGGCCGCGGGGCTCGGATCGG + Intergenic
922839116 1:228637295-228637317 CGGGGCCGCGGGGCTCGGATCGG + Intergenic
922839676 1:228639536-228639558 CGGGGCCGCGGGGCTCGGATCGG + Intergenic
922840237 1:228641767-228641789 CGGGGCCGCGGGGCTCGGATCGG + Intergenic
922840797 1:228644008-228644030 CGGGGCCGCGGGGCTCGGATCGG + Intergenic
922841360 1:228646239-228646261 CGGGGCCGCGGGGCTCGGATCGG + Intergenic
923126730 1:231040166-231040188 CGGGGCCGCGGGCAACGGCGCGG - Exonic
923631279 1:235650352-235650374 CGGGGCCGGGGTTGCTGGAGGGG + Intronic
1065020010 10:21495914-21495936 CGGGGCCCCGGTCCCCGGAGGGG + Exonic
1067363239 10:45601053-45601075 GGGGGCGGCGCTGGTCGGAGAGG - Intergenic
1074098181 10:110331778-110331800 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
1075370084 10:121928170-121928192 AGGGGCCGCCGTCGTCAGTGAGG + Intronic
1075537476 10:123283401-123283423 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
1075698029 10:124449956-124449978 CGGGCCGGCGGTCGGCGGCGCGG + Exonic
1077053017 11:576121-576143 CGGGGCTGCGGGCGTGGGGGCGG + Intergenic
1077249907 11:1556495-1556517 CGGGGCCGAGGGCAGCGGAGGGG + Exonic
1077495173 11:2883861-2883883 CGGGGCAGCGGACGTTGGAAGGG - Exonic
1077764636 11:5144708-5144730 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
1077778174 11:5294491-5294513 GGGGGCGGCGCTCGTCGGCGAGG + Intronic
1078891383 11:15561235-15561257 GGGGGCGGCGGTCGTCGGGGAGG - Intergenic
1080503042 11:32888260-32888282 CGGGGCGGCGCTCATCGGGGAGG + Intergenic
1081611444 11:44565549-44565571 CGGGGGCGGGGCCGGCGGAGGGG + Intronic
1081831478 11:46119889-46119911 CGGGGGCGCGGGCGGGGGAGGGG + Intronic
1081870782 11:46381689-46381711 AGGGGCCGCGGCGGCCGGAGCGG + Intronic
1083546158 11:63550517-63550539 GGGGGCAGCGCTCGTCGGGGAGG - Intergenic
1083684725 11:64369373-64369395 CGGGGCCTGGGTGGTGGGAGGGG + Intronic
1087182019 11:95150789-95150811 TGGAGCCGCCGTCGTCGGACGGG - Intergenic
1087407269 11:97745663-97745685 GGGGGCAGCGCTCGTCGGGGAGG + Intergenic
1088462162 11:110093294-110093316 CGGGGCTGCGGCCCGCGGAGAGG + Intergenic
1090588294 11:128237358-128237380 CGGGGCGGCGCTCATTGGAGAGG - Intergenic
1090776677 11:129971880-129971902 GGGGGCGGCGCTCGTCGGGGAGG + Intronic
1091233409 11:134002937-134002959 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
1091383641 12:78274-78296 CGGGGCCGCGGCCTTCGGGCCGG + Intronic
1092221447 12:6716349-6716371 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
1092246761 12:6868113-6868135 CGGGGACGCGGACGCCGGCGAGG - Intronic
1092272970 12:7037733-7037755 GGGGGCGGCGCTCGTCGGGGAGG - Intronic
1092336726 12:7640151-7640173 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
1093034544 12:14320406-14320428 GGGGGCGGCGGTCATCGGGGAGG - Intergenic
1093381611 12:18500457-18500479 GGGGGCCGCGCTCGTAGGGGAGG - Intronic
1094507142 12:31071617-31071639 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
1096154912 12:49336480-49336502 GGCGGGCGCGGCCGTCGGAGTGG - Exonic
1099443864 12:82729036-82729058 GGGGGCAGCGCTCGTCGGGGAGG - Intronic
1100831006 12:98516297-98516319 CGGGGCTGCAGGCGCCGGAGCGG + Intronic
1102904056 12:116660994-116661016 GGGGGCAGCGCTCGTCGGGGAGG - Intergenic
1103146099 12:118597224-118597246 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
1104049495 12:125186285-125186307 CGGGGCCGCGGCCGGGGGAGGGG - Intergenic
1105876638 13:24560754-24560776 GGGGGCAGCATTCGTCGGAGAGG + Intergenic
1106157285 13:27171163-27171185 CCGGGCCGGGGTCGTCGGGGAGG - Intronic
1110751355 13:79119685-79119707 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
1113311914 13:109140592-109140614 CCGGGCCGCCGTCGTCGGGCAGG - Exonic
1113693928 13:112330820-112330842 CGGGCCCGGGGTCGGAGGAGGGG - Intergenic
1117157011 14:52951214-52951236 CGGCGCCGCGCTCGGGGGAGGGG + Intronic
1119003923 14:70907609-70907631 CGGGGCGGAGGACGGCGGAGAGG - Exonic
1119673406 14:76536799-76536821 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
1120229723 14:81829513-81829535 GGGGGCTGCGCTCGTGGGAGAGG + Intergenic
1121074924 14:91060225-91060247 CGGGGCCGCAGCCGTGGGCGCGG - Intronic
1121582963 14:95044648-95044670 GGGGGCCCCTGTCGTAGGAGGGG - Intergenic
1122300183 14:100727035-100727057 CGGGGTCGCGGTCCCGGGAGCGG - Exonic
1123036672 14:105474575-105474597 CGGCGCCGCGGTCGCCCGGGCGG + Intronic
1124637097 15:31372251-31372273 TGGGGCTGCTGGCGTCGGAGCGG - Exonic
1125609742 15:40961930-40961952 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
1128813260 15:70587220-70587242 GGGGGCAGCGCTCGTCGGGGAGG + Intergenic
1129158224 15:73732233-73732255 GGGGGCAGCGGTCGTCGGGGAGG + Intergenic
1129387243 15:75202646-75202668 CCGGTCCGCGGGCGTCGGTGTGG + Intronic
1129440563 15:75578556-75578578 CTGGGGCGCGGTCGCCGGTGAGG + Intronic
1129644697 15:77419725-77419747 CGGGGCCGCCGCCGAGGGAGGGG + Intronic
1129997183 15:80016790-80016812 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
1131263667 15:90903132-90903154 CGGGGCCGACGAAGTCGGAGCGG + Exonic
1132255604 15:100373592-100373614 CGAGGCCGCGGCTGTCGGGGTGG + Intergenic
1132736592 16:1389050-1389072 CGGGGCCGGGGCCGGGGGAGGGG - Intronic
1132836773 16:1958248-1958270 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
1133367489 16:5222058-5222080 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
1135942657 16:26836146-26836168 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
1136478309 16:30526595-30526617 CGGGGCCGCGGGCAGGGGAGGGG - Intronic
1137442554 16:48509000-48509022 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
1139147781 16:64344206-64344228 GGGGGCGGCGCTCGTCGGGGTGG - Intergenic
1139403011 16:66696865-66696887 CGGCGCCGCGGGCCTCGGGGAGG + Intergenic
1142185749 16:88694013-88694035 CGCGGCCCCGGTGGTCAGAGCGG + Intergenic
1142196352 16:88741004-88741026 CAGGGCCTCTGTCCTCGGAGTGG - Intronic
1142757638 17:2025233-2025255 CGCGGCGGCGGTGGTCCGAGGGG - Exonic
1142762433 17:2050254-2050276 CGGGGCCGCGGTCCTGGGGCGGG + Intergenic
1142860076 17:2755879-2755901 CGGGGCCCGGGTGGGCGGAGGGG + Intergenic
1143127946 17:4656597-4656619 GGGGGCAGCGCTCGTCGGGGAGG + Intergenic
1143135228 17:4709140-4709162 GGGGGCGGTGCTCGTCGGAGAGG + Intergenic
1143283406 17:5771529-5771551 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
1143590622 17:7884592-7884614 CGGGGCCGCCGTCTGAGGAGGGG - Intronic
1144128129 17:12221176-12221198 GGGGGCGGCGCTTGTCGGAGAGG - Intergenic
1148183111 17:45620684-45620706 CGGGGCCGCGGCCGGGGGCGCGG + Intergenic
1148265740 17:46225007-46225029 CGGGGCCGCGGCCGGGGGCGCGG - Intronic
1148370971 17:47099940-47099962 CGGGGCCGCGGCCGGGGGCGCGG - Intergenic
1148664066 17:49361823-49361845 CGGCCCCGCGGGCGGCGGAGAGG + Intronic
1151558724 17:74859989-74860011 CGGAGCCGCGGACGCCGGCGGGG - Intronic
1151575835 17:74952211-74952233 CGGGGCCGGGGTTGTGGGCGGGG - Intronic
1151672754 17:75580828-75580850 CGGGGTGGCGCTCGTCGGGGAGG - Intergenic
1151763958 17:76122554-76122576 GGGGGCCGGGGGTGTCGGAGAGG + Intergenic
1151919144 17:77140862-77140884 CGCGGCCGCGGCCGAGGGAGCGG - Intronic
1152356514 17:79810171-79810193 CGGGGCCGCGGCCGGGCGAGCGG + Intergenic
1152852875 17:82648119-82648141 CGGGGCCGGGGGCTTCGGAGGGG + Intronic
1152923991 17:83079426-83079448 CGGGGGCGCGGGCGCCGGGGCGG - Intergenic
1155852322 18:30788757-30788779 AGGGGCAGCGCTCATCGGAGAGG - Intergenic
1156150354 18:34234156-34234178 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
1160567811 18:79798068-79798090 CGGGGCCGCAGTGGGCGGTGGGG + Intergenic
1160592092 18:79950839-79950861 CGCGGCCATGGTCTTCGGAGGGG - Exonic
1160887011 19:1354854-1354876 CGCGGCCGTGGACGCCGGAGAGG + Intronic
1160927866 19:1555737-1555759 CGGGGCCGAGGACGCCGAAGGGG + Exonic
1162103357 19:8354163-8354185 CGGGGCCGCGGTTGTCAAACCGG + Intronic
1162116149 19:8430671-8430693 CGGGGCCGCGGACGGAGAAGCGG + Exonic
1162673963 19:12284442-12284464 CGGGGCCGCGGAGCTCTGAGAGG + Intronic
1163181682 19:15608693-15608715 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
1163548400 19:17952194-17952216 CGGGGCCCAGGTCGGCGGGGAGG + Intronic
1163715553 19:18870375-18870397 CGGGGCCGGTGTCCCCGGAGGGG + Exonic
1165036422 19:33036910-33036932 GGGGGCGGCGCTCGTCGGGGAGG - Intronic
1165415490 19:35691143-35691165 AGGGGCGGCGCTCGTCGGGGAGG + Intergenic
1167269217 19:48498526-48498548 CGGGGCCCCGGGAGTGGGAGCGG + Exonic
1167358576 19:49018203-49018225 CGGACCCGCGGTGGTCGGGGCGG + Intergenic
1167648915 19:50719346-50719368 CGGGGCCGGGGCCGCGGGAGGGG - Intronic
1168332775 19:55579536-55579558 CGGGGCCGTGGCCGTGGCAGGGG - Exonic
925068733 2:950512-950534 CGTGGCGGCGGTGGGCGGAGGGG - Intergenic
927055399 2:19361615-19361637 CGGAACCGCGGGCGCCGGAGTGG + Intergenic
928088097 2:28358299-28358321 CGGGGTCGGGGTCGGCGGGGCGG - Intergenic
929238330 2:39628434-39628456 CGGGGCAGCTGCCGGCGGAGAGG + Intergenic
929890824 2:45917718-45917740 GGGGGCGGCGCTCGTCGGGGAGG + Intronic
933659491 2:84915884-84915906 CGGGGCCGGGGTCGCGGGAGTGG + Intergenic
938725985 2:134109394-134109416 GGGGGCTGCGCTCGTCGGGGAGG + Intergenic
940215135 2:151296270-151296292 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
941309829 2:163913930-163913952 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
942299555 2:174548639-174548661 GTGGGCGGCGCTCGTCGGAGAGG + Intergenic
942620060 2:177835984-177836006 GGGGGCAGCGCTCGTCGGGGAGG - Intronic
943790073 2:191921900-191921922 GGGGGCAGCGCTCGTCGGGGAGG - Intergenic
943906084 2:193502513-193502535 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
943942769 2:194020473-194020495 GGGGGCAGCGCTCGTCGGGGAGG - Intergenic
944244429 2:197516526-197516548 CGGGGCCGCTGAGGTGGGAGGGG + Intronic
944843100 2:203642916-203642938 GGGGGCAGCGCTCGTCGGGGAGG + Intergenic
946376542 2:219313089-219313111 GGGGGCGGCGCTCGTCAGAGAGG - Intergenic
946692424 2:222319514-222319536 CGGGGCCGGGGTGGGCGGCGGGG + Intergenic
947412033 2:229851029-229851051 GGGGGCGGCGCTCGTCGGGGAGG - Intronic
947641638 2:231710465-231710487 CGGAGCCGGGGTCCGCGGAGCGG + Intronic
1169065727 20:2693276-2693298 CGGGGCCGCGGTCGTCGGAGGGG - Intronic
1169327543 20:4687245-4687267 CGGGGCCTCGGGCCTCGGCGGGG + Intronic
1169645311 20:7803606-7803628 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
1170649544 20:18227077-18227099 GGGGGCCACGCTCGTCGGGGAGG - Intergenic
1171810406 20:29741976-29741998 CGCGGCCCCGGCCGGCGGAGAGG + Intergenic
1175992438 20:62796511-62796533 CCGGGCCGCGGCCATGGGAGAGG + Exonic
1178534878 21:33403292-33403314 CAGGGCCGCGGTTCCCGGAGCGG + Exonic
1178585602 21:33868365-33868387 GGGGGCGGCGCTCGTCGGGGAGG + Intronic
1178983308 21:37283233-37283255 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
1179626977 21:42654218-42654240 CGGGGTCGTGGTCCGCGGAGGGG + Intronic
1179989578 21:44940158-44940180 CGCGGCCGAGGCCGGCGGAGGGG - Exonic
1179993048 21:44958557-44958579 CGGTGCCGCGGGCTACGGAGGGG - Intronic
1180740996 22:18053404-18053426 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
1183476544 22:38038924-38038946 CGGGGCCGGGGCAGTCGTAGGGG + Intronic
1184439202 22:44498253-44498275 CGGGGCCGGGGTCGCGGCAGAGG + Exonic
1184584301 22:45437041-45437063 CGGGGCGGCGCTCGTCGGGGAGG - Intergenic
1184906205 22:47488354-47488376 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
1185229075 22:49670249-49670271 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
949259021 3:2083940-2083962 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
949260556 3:2099033-2099055 CGGGGACGCGGTCGCGGGTGTGG + Intronic
950203643 3:11061685-11061707 GGGGGCGGCGCTCGTCAGAGAGG - Intergenic
950550132 3:13661309-13661331 CGGGGCCGGGGTGGTGGGAGGGG + Intergenic
951558610 3:23945198-23945220 CGGGGCGGAGGTCGCCGCAGCGG + Intronic
952275296 3:31870428-31870450 GGGGGCGGCGCTCGTCGGGGAGG - Intronic
952355420 3:32579028-32579050 GGGGGCAGCGCTCGTCGGGGAGG - Intergenic
953564771 3:44022067-44022089 CGGAGCCGCGCTCCTCGGGGTGG + Intergenic
954733533 3:52685753-52685775 CGGGGCTGCAGGCGGCGGAGCGG - Exonic
955368699 3:58332824-58332846 CGGGGCGGCGGCCGTGGGAAGGG + Intergenic
957804861 3:85133908-85133930 GGGGGCGGCGCTCGTCGGGGAGG + Intronic
961688850 3:128653711-128653733 GGGGGCGGCGCTCGTCGGGGAGG - Intronic
963091399 3:141486931-141486953 CGGGGCCGCGGCGGGCGGGGCGG + Intergenic
964569209 3:158094492-158094514 CGGGAGCGCGGTAGGCGGAGAGG - Intergenic
965040343 3:163499338-163499360 GGGGGCGGCGATCGTCGGGGAGG - Intergenic
965220854 3:165924384-165924406 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
968469719 4:773841-773863 CGGGGCAGTGCTCGTCGGGGAGG - Intergenic
968479166 4:826226-826248 CGGGGCCGCGGGCGCCGGGCGGG + Intergenic
968879767 4:3292972-3292994 CGGGGCCGAGGCCGGAGGAGGGG - Intergenic
971564149 4:28117190-28117212 GGGGGCGGCGCCCGTCGGAGAGG + Intergenic
973613700 4:52659368-52659390 CTGGGCCGCGGCCGGCGGCGCGG + Intergenic
975898480 4:79122246-79122268 GGGGGCGGCGTTCGTCGGGGAGG - Intergenic
979536208 4:121823489-121823511 CGGGTCCGCGGTTGTTGGACGGG + Exonic
980051885 4:128047606-128047628 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
982172844 4:152678520-152678542 CGGGGCGGCGGTGGGGGGAGGGG + Intronic
982692811 4:158567214-158567236 GGGGGCCATGGTCGTCGGGGAGG - Intronic
985087146 4:186324897-186324919 GGGGGCGGCGCTCATCGGAGAGG - Intergenic
985896359 5:2751797-2751819 CCGGGCCGCGGCCGGGGGAGGGG + Intergenic
986044349 5:4022937-4022959 AGGGGCCGGGGTCGTCGCTGAGG + Intergenic
986912497 5:12574561-12574583 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
987050280 5:14143146-14143168 CGGGGCCGCGTTGGGCGGATGGG - Intergenic
988086941 5:26485327-26485349 GGGGGCGGCGCTCGTTGGAGAGG + Intergenic
993529145 5:89003670-89003692 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
994096384 5:95851480-95851502 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
994935324 5:106246524-106246546 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
1000329143 5:160193943-160193965 GGGGGCGGCGCTCGTCGGGGAGG + Intronic
1001636489 5:173213745-173213767 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
1002691374 5:181053009-181053031 CGGGGGCGCGCGCGGCGGAGGGG - Intronic
1002793246 6:450282-450304 GGGGGCAGCGCTCGTCGGGGAGG - Intergenic
1002817745 6:694895-694917 GGGGGCAGCGCTCGTCGGGGAGG - Intergenic
1003175698 6:3751250-3751272 CGGGGCCGGGGACGCGGGAGGGG - Intronic
1003290555 6:4775904-4775926 CGCGGCCGCTGCCGTCGGGGCGG + Intronic
1003489189 6:6606520-6606542 GGGGGCGGCGCTCGTCGGGGAGG + Intronic
1004217628 6:13717065-13717087 AGGGGCGGCGCTTGTCGGAGAGG - Intergenic
1004220663 6:13743523-13743545 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
1004235500 6:13871968-13871990 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
1004338180 6:14783650-14783672 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
1004519346 6:16347153-16347175 GGGGGCGGCGCTCGTCGGGGAGG - Intronic
1005512123 6:26520857-26520879 CGGGGGCGGGGGCGTGGGAGGGG - Intergenic
1005561474 6:27045546-27045568 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
1005749036 6:28866530-28866552 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
1005758850 6:28949840-28949862 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
1005978190 6:30816344-30816366 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
1007775736 6:44223497-44223519 CGGGGCCGCGGGCGTCGGGGAGG + Intronic
1009964819 6:70567020-70567042 CGGGGCCACGGTCGCGGGAGGGG + Intronic
1011983535 6:93416868-93416890 CTGGGGCGGGGCCGTCGGAGGGG + Intronic
1015600393 6:134905044-134905066 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
1019578024 7:1746811-1746833 CGGGGCCGCGGCCGGGTGAGTGG - Exonic
1020281906 7:6654173-6654195 CGCGGCCGCAGTCGGCGCAGCGG - Exonic
1020552238 7:9621529-9621551 GGGGGCGGCGTTCGTCGGGGAGG + Intergenic
1022005393 7:26262056-26262078 CGGGGCGGCTGTGGGCGGAGGGG - Intergenic
1022174104 7:27857102-27857124 GGGGGCGGCGCTCGTCGGGGAGG + Intronic
1024335591 7:48202960-48202982 GGGGGCGGCGCTCGTCGGGGAGG + Intronic
1024691329 7:51806148-51806170 GGGGGCGGCGGTCGTCGGGGAGG - Intergenic
1024735769 7:52302940-52302962 GGGGGCAGTGGTCGTCGGGGAGG + Intergenic
1025078662 7:55964458-55964480 CGCGGCCGCGGGGGTCGGCGGGG - Intronic
1026335937 7:69394140-69394162 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
1030215686 7:107042408-107042430 GGGGGCGGCGGTCGTCGGGGAGG + Intergenic
1032437166 7:131909639-131909661 CGGGGCAGCGCTCGTCGGGAAGG - Intergenic
1035717196 8:1763640-1763662 CGGGGCGGCGGGCGCGGGAGGGG - Intronic
1036851272 8:12203431-12203453 GGGGGCTGTGGTCGTCGGGGAGG + Intergenic
1036872636 8:12445705-12445727 GGGGGCTGTGGTCGTCGGGGAGG + Intergenic
1037811021 8:22086869-22086891 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
1037878664 8:22561947-22561969 CGGGGCCGAGGGCTGCGGAGGGG + Intronic
1039587650 8:38720110-38720132 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
1039637349 8:39180441-39180463 GGGGGCAGCGCTCGTCGGGGAGG - Intronic
1041244871 8:55880207-55880229 CGGGGCCGGGGGCATCGGCGCGG + Intronic
1044306537 8:90646154-90646176 CGGGGCCGCGGGCGATGGGGCGG + Intronic
1044404925 8:91816635-91816657 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
1045467718 8:102485560-102485582 GGGGGCAGCGCTCGTCGGGGAGG + Intergenic
1045488891 8:102654957-102654979 AGGGGCGCCTGTCGTCGGAGCGG - Intronic
1046661157 8:116949796-116949818 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
1047393721 8:124475031-124475053 CGGGGCCGCGGCCGGGGGCGGGG - Exonic
1048655376 8:136530499-136530521 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
1049087593 8:140490562-140490584 GGGGGCGGCAGTCGTCGGGGAGG + Intergenic
1054722499 9:68617337-68617359 GGGGGCCGCGCTCATCGGGGAGG - Intergenic
1058727570 9:107818116-107818138 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
1058786539 9:108393827-108393849 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
1058799409 9:108530456-108530478 GGGGGCAGCGCTCGTCGGGGAGG - Intergenic
1061472173 9:130835340-130835362 CGGGGCCGGGGGCGCCGGGGGGG + Intronic
1062520289 9:136954774-136954796 GGGGGCCGCGGCTGTCTGAGTGG - Intronic
1062559884 9:137136781-137136803 CGGGGCCGCAGCTGTCAGAGTGG + Intergenic
1189209872 X:39275893-39275915 GGGGGCAGCGCTCGTCGGGGAGG - Intergenic
1190385600 X:49879888-49879910 CGGGGCCGGGGTCGGCGGCGCGG - Intergenic
1194890449 X:99372119-99372141 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
1196616188 X:117769346-117769368 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
1196845099 X:119890904-119890926 GGGGGCGGCGCTCGTCGGAGAGG - Intergenic
1197376758 X:125690627-125690649 GGGGGCGGCGCTCGTCGGGGAGG + Intergenic
1198468143 X:136921676-136921698 GGGGGCGGCGCTCGTCGGGGAGG - Intergenic
1199285059 X:146046233-146046255 GGGGGCAGCGCTCGTCGGGGAGG + Intergenic
1200155381 X:153972214-153972236 CGGGGCCGAGCGCGTCGGAGGGG - Intergenic