ID: 1169065864

View in Genome Browser
Species Human (GRCh38)
Location 20:2693756-2693778
Sequence GCGCCGCGGTGCTGGCGTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 103}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169065864_1169065872 14 Left 1169065864 20:2693756-2693778 CCTGGACGCCAGCACCGCGGCGC 0: 1
1: 0
2: 1
3: 15
4: 103
Right 1169065872 20:2693793-2693815 GGACCGGACCCGGTGCGCTCGGG 0: 1
1: 0
2: 1
3: 7
4: 48
1169065864_1169065876 22 Left 1169065864 20:2693756-2693778 CCTGGACGCCAGCACCGCGGCGC 0: 1
1: 0
2: 1
3: 15
4: 103
Right 1169065876 20:2693801-2693823 CCCGGTGCGCTCGGGTTGGACGG 0: 1
1: 0
2: 0
3: 1
4: 48
1169065864_1169065870 4 Left 1169065864 20:2693756-2693778 CCTGGACGCCAGCACCGCGGCGC 0: 1
1: 0
2: 1
3: 15
4: 103
Right 1169065870 20:2693783-2693805 GTAAGCGCTCGGACCGGACCCGG 0: 1
1: 0
2: 0
3: 0
4: 18
1169065864_1169065869 -2 Left 1169065864 20:2693756-2693778 CCTGGACGCCAGCACCGCGGCGC 0: 1
1: 0
2: 1
3: 15
4: 103
Right 1169065869 20:2693777-2693799 GCAGAGGTAAGCGCTCGGACCGG 0: 1
1: 0
2: 0
3: 5
4: 61
1169065864_1169065868 -7 Left 1169065864 20:2693756-2693778 CCTGGACGCCAGCACCGCGGCGC 0: 1
1: 0
2: 1
3: 15
4: 103
Right 1169065868 20:2693772-2693794 GCGGCGCAGAGGTAAGCGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 135
1169065864_1169065871 13 Left 1169065864 20:2693756-2693778 CCTGGACGCCAGCACCGCGGCGC 0: 1
1: 0
2: 1
3: 15
4: 103
Right 1169065871 20:2693792-2693814 CGGACCGGACCCGGTGCGCTCGG 0: 1
1: 0
2: 0
3: 5
4: 23
1169065864_1169065874 18 Left 1169065864 20:2693756-2693778 CCTGGACGCCAGCACCGCGGCGC 0: 1
1: 0
2: 1
3: 15
4: 103
Right 1169065874 20:2693797-2693819 CGGACCCGGTGCGCTCGGGTTGG 0: 1
1: 0
2: 1
3: 2
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169065864 Original CRISPR GCGCCGCGGTGCTGGCGTCC AGG (reversed) Exonic
901096233 1:6682482-6682504 GGGCAGCGGTGCTGGGGCCCGGG + Intronic
904199878 1:28812630-28812652 GCGCCGCAGGGCTGGAGCCCGGG + Intronic
908401145 1:63774081-63774103 GCGCCCAGGGGCTGCCGTCCCGG - Exonic
923119625 1:230978495-230978517 GGGCAGCGGGGCTGGGGTCCCGG - Intronic
923369449 1:233295655-233295677 GCGCCGCGGTTCGCGGGTCCGGG - Exonic
923372654 1:233328331-233328353 GCGGCGCGGGGCTGGCGGCCGGG - Exonic
923506544 1:234609992-234610014 GCGCCGGGGTGGCGGCGGCCGGG + Intergenic
924052812 1:240093731-240093753 GCGCCCTGCTGCTGGCCTCCGGG + Intronic
1062820177 10:528825-528847 CCTCCGTGGGGCTGGCGTCCAGG + Intronic
1066220672 10:33334804-33334826 GAGCCGCGGAGCTGGCGCCCAGG + Exonic
1070290669 10:75111523-75111545 GCGCGGCGGTGACGGCGGCCGGG + Intronic
1074865683 10:117543242-117543264 GCGCCGAGGAGCGGGCGCCCTGG - Exonic
1076986124 11:236994-237016 TCCCCGCGGTGCTGACATCCCGG + Exonic
1077080327 11:722111-722133 GCTCCGCGGCGCTGGGGTTCTGG - Exonic
1077919139 11:6630311-6630333 GCGCCCCGGTGCGCGCGTCCAGG + Exonic
1083965795 11:66042956-66042978 GCGCCGCGGGGATGGCGGCCAGG + Exonic
1084911674 11:72394789-72394811 GTGCTGCGGTGCTGGCATTCTGG + Intronic
1085346041 11:75768765-75768787 CAGCCGCGGCGCTGGCGTCCCGG - Exonic
1089563222 11:119356421-119356443 CCTCCGCGGCGCGGGCGTCCAGG + Exonic
1103895340 12:124269438-124269460 GCGCCGCGGGGCTGTGTTCCTGG - Intronic
1104624377 12:130339258-130339280 GCGGCGGGGCGGTGGCGTCCTGG + Intronic
1104760831 12:131296828-131296850 GCGCGGTGGAGCTGGGGTCCAGG - Intergenic
1104818944 12:131663964-131663986 GCGCAGTGGAGCTGGGGTCCAGG + Intergenic
1104969690 12:132525623-132525645 GGGCCGGGGTGCTGGGGTGCCGG + Intronic
1105745634 13:23375203-23375225 CCGTCGCGGCGCTGGCGTCCTGG - Exonic
1113872166 13:113565973-113565995 GCGCGGCACTGCTGTCGTCCTGG + Intergenic
1115754208 14:36517376-36517398 GCGCCGCGGGGCTGGCGGCGTGG + Exonic
1117424428 14:55580278-55580300 GCGCCTCGGAGCGGGCGGCCCGG + Intronic
1121616973 14:95319888-95319910 GCGCCGCGGAGCTGGAGTCGCGG + Exonic
1124848122 15:33311176-33311198 GCGCCGCGGTGCCGGGTGCCCGG + Intronic
1126789137 15:52204693-52204715 GCCCCGGGATGCTGGCGCCCAGG - Intronic
1130517143 15:84634080-84634102 GCGGCGCGGGGCCGGAGTCCTGG - Intergenic
1130672740 15:85927020-85927042 AGGCCGAGGTGCTGGCTTCCTGG - Intergenic
1135803374 16:25519924-25519946 GAGCCACGGTGCTGGGGTGCTGG + Intergenic
1139364822 16:66427020-66427042 GCGCCGCGGTGCTGAGGCCCGGG + Intergenic
1140221588 16:73048038-73048060 GGGGCGCGGCGCTGGCGTCCGGG + Exonic
1141068947 16:80935963-80935985 GCGCCCCAGGGCTGGCTTCCTGG + Intergenic
1141832168 16:86515914-86515936 GCGCCGCTGGACTAGCGTCCAGG + Intergenic
1142591640 17:1008765-1008787 GCTCCCCGGTCCTGGCGTGCAGG + Intronic
1142811291 17:2396786-2396808 GCGGAGCGGGGCGGGCGTCCGGG - Intronic
1143108411 17:4540777-4540799 GCCCCGCGGTGATGGAGTGCTGG - Intronic
1144604665 17:16653835-16653857 GCTCGGCGGTGCCGGCCTCCAGG + Exonic
1150225555 17:63522993-63523015 GCGGGGCGGGGCTGGGGTCCTGG - Intergenic
1152558629 17:81067042-81067064 GCGCCGCTGTGCTGGAGGTCCGG - Intronic
1153238778 18:3012913-3012935 GCGCCGCGGTCCCCGCTTCCCGG - Intronic
1153261258 18:3226500-3226522 GAACCGGGGTGCTGGAGTCCTGG - Intergenic
1157294557 18:46433336-46433358 GCGCCGCTGTGCTGGTGGGCCGG - Exonic
1159040299 18:63318453-63318475 GCGGCGAGGTCCTGGCGACCGGG + Exonic
1160745470 19:709168-709190 GGGCCGCGGGGCTGGGGGCCCGG + Intronic
1160751501 19:736514-736536 GCGCAGCGGTGCTGGGGACCTGG - Intronic
1161035106 19:2080090-2080112 CTGCCACGGTGCCGGCGTCCTGG - Intronic
1161170340 19:2809503-2809525 GCGCCGCAGTGCTGGCCTCTGGG + Intronic
1163455489 19:17403745-17403767 CCGCAGCGGAGCTGGAGTCCTGG + Exonic
1165425910 19:35745287-35745309 GGGCCGGGGTACTGGGGTCCTGG - Exonic
1168676217 19:58279588-58279610 GCTCCGCGGTGCTGGGGTCCCGG - Exonic
926095765 2:10080037-10080059 GCGCCACGGGGCTGGGGTCGCGG + Exonic
927714145 2:25341694-25341716 GCGCCGAGTTGCAGGGGTCCGGG + Intronic
927809400 2:26173191-26173213 GCGCCCCGGGGCCGCCGTCCCGG - Exonic
940354007 2:152718663-152718685 GCGCCGCGGTCCCGGCACCCCGG + Exonic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
942947135 2:181683678-181683700 GCGGCGCGGGCCGGGCGTCCCGG + Intergenic
946855408 2:223945194-223945216 GCGCGGCCGTGACGGCGTCCTGG + Exonic
947712771 2:232325552-232325574 GTGCCGAGGAGCTGGGGTCCTGG + Intronic
949075989 2:242058261-242058283 GAGCCTGGGTGCTGACGTCCTGG + Intergenic
1169065864 20:2693756-2693778 GCGCCGCGGTGCTGGCGTCCAGG - Exonic
1171459728 20:25291752-25291774 GAGTCTCGGTGCTGGCGTCAGGG + Intronic
1172026759 20:31953865-31953887 GAGACGCAGTGCTGGGGTCCAGG - Intergenic
1175994093 20:62804705-62804727 GGGGCGCGGGGCGGGCGTCCCGG + Intergenic
1176088783 20:63309839-63309861 GTGCCGGGGGGCTGGAGTCCAGG - Exonic
1179494044 21:41760532-41760554 GCTCCGCTCTGCTGGCCTCCCGG - Intronic
1180960607 22:19760750-19760772 GCGCCGCGCTGCGTGCGCCCCGG - Intronic
1184676273 22:46045032-46045054 GCCCGGCGGCGCTGGGGTCCGGG + Intergenic
1185220768 22:49628085-49628107 GAGCCGCGGTCCTGGAGTCATGG - Intronic
1185385637 22:50530282-50530304 GCGGCGCAGCGCTGGGGTCCCGG + Intronic
950263176 3:11556379-11556401 GGTCGGCGGTGCTGGCGGCCGGG - Exonic
951611342 3:24495140-24495162 GCGGCGCGGAGCAGGCGCCCCGG - Intronic
954265936 3:49470365-49470387 GAGCGGCGGTGGCGGCGTCCTGG + Exonic
954838985 3:53494802-53494824 ACGCCGCGGTGATGCCGGCCCGG - Intronic
961305690 3:125958254-125958276 GCGCCGCGGGGCTCGGGCCCTGG - Intergenic
968629828 4:1644573-1644595 GAGCCCCGGGGCTGGCGCCCAGG - Intronic
968756111 4:2417455-2417477 GCGCCGCGGGGTCGGGGTCCGGG - Intronic
968831604 4:2935047-2935069 GCTCCGCGGGGCAGGCGTCGTGG - Intergenic
976751899 4:88457470-88457492 ACGCGGCGGGGCGGGCGTCCAGG + Exonic
977573985 4:98658334-98658356 GGGCCGCGGCGCTGGCGGCCTGG + Exonic
977919294 4:102625702-102625724 GGGCCAGGGTGCTGGCTTCCTGG - Intergenic
982288843 4:153760099-153760121 GAACCGGGGTGCTGGCGACCGGG - Exonic
986680934 5:10232365-10232387 GTGCTGCGGTGCTGGAGGCCTGG + Intronic
990553753 5:56909788-56909810 CCGCCGCCGTGGTGGCGTCTGGG - Intronic
991245715 5:64506565-64506587 GCGCCCCGGCGCGGGCGGCCCGG - Exonic
992269789 5:75053054-75053076 GGGCCGCGGAGCCGGCTTCCTGG - Intergenic
992561526 5:77957671-77957693 GCTCCGGGGAGATGGCGTCCAGG - Intergenic
998001701 5:138630832-138630854 GCCCCACGGGCCTGGCGTCCTGG - Intronic
1001561226 5:172670172-172670194 GCGACACGGTGCTGGCCTACTGG + Exonic
1002092032 5:176811416-176811438 GCGCCGCGGTCCCGGTGGCCGGG + Intronic
1007412933 6:41675238-41675260 GTGCAGCGGTGCTGGCTTCAGGG + Intergenic
1014230376 6:118895275-118895297 GCGCCGGGATGCTGGCGCGCAGG + Intronic
1016328228 6:142927014-142927036 GCGGCGCGGGGCGGGCGGCCAGG + Intronic
1016923209 6:149317053-149317075 GCGCCGCGCGGGTGGGGTCCGGG - Intronic
1017021524 6:150143566-150143588 GCGCCCCGGAGCTGGAGCCCGGG - Intronic
1019197089 6:170289342-170289364 GCGCTGCTGGGCTGGAGTCCTGG + Intronic
1019450397 7:1094824-1094846 GCACCACGGTGCTGGGGTCATGG - Intronic
1019530222 7:1499479-1499501 GGGCCGCGTTGCGGGCGACCTGG - Exonic
1026819463 7:73537215-73537237 GCGCCGCGTTGCTGGGGTAAGGG - Exonic
1029361026 7:100088882-100088904 GTGCGGCGGGCCTGGCGTCCGGG - Intergenic
1034223065 7:149460381-149460403 GCGCGGCTGTGCGGGCGGCCCGG + Intronic
1034692786 7:153027375-153027397 GCGCCGAGGCCCTGGCATCCAGG - Intergenic
1041689940 8:60678898-60678920 GCGCCGCGGAGGAGGCGGCCCGG + Exonic
1043472661 8:80578257-80578279 GCGCGGGGGTGCGGGCGGCCGGG - Intergenic
1047732088 8:127736308-127736330 GAGCTGCGCTGCGGGCGTCCTGG + Exonic
1047961694 8:130016170-130016192 CCGCCGTGGTGGGGGCGTCCGGG - Intronic
1049205125 8:141360085-141360107 ACGCTGCGGTGCTGGGGTCCTGG + Intronic
1050091124 9:2016915-2016937 GCGCCGAGGGGCTGGCGCGCCGG - Intronic
1050552226 9:6758287-6758309 GCACGGGGGTGCGGGCGTCCGGG + Intronic
1060925326 9:127451743-127451765 TCGCCGCGGTACTGGGGTCTCGG - Exonic
1062286539 9:135775448-135775470 ACGGCCCGGTGCTGGCGTCTGGG - Intronic
1062294779 9:135818663-135818685 GCGCCGCGGCGCAGGCGTCGTGG - Intronic
1062346727 9:136118497-136118519 CCGCGGCGGCGCCGGCGTCCCGG + Exonic
1062574594 9:137200331-137200353 CCGCCGAGGTGCTGGTGTACGGG - Exonic
1189333347 X:40155923-40155945 GCGCCTGGGTGCAGGCCTCCAGG - Intronic
1200128558 X:153829582-153829604 GGGCCGCGGGGCTGGGCTCCAGG + Intronic