ID: 1169066163

View in Genome Browser
Species Human (GRCh38)
Location 20:2695213-2695235
Sequence GAGTGGGTGAGGAGTGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 461}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169066156_1169066163 12 Left 1169066156 20:2695178-2695200 CCCACCACCTGCTGTGTGGCGAG 0: 1
1: 0
2: 2
3: 29
4: 200
Right 1169066163 20:2695213-2695235 GAGTGGGTGAGGAGTGCTGATGG 0: 1
1: 0
2: 3
3: 42
4: 461
1169066157_1169066163 11 Left 1169066157 20:2695179-2695201 CCACCACCTGCTGTGTGGCGAGA 0: 1
1: 0
2: 0
3: 11
4: 186
Right 1169066163 20:2695213-2695235 GAGTGGGTGAGGAGTGCTGATGG 0: 1
1: 0
2: 3
3: 42
4: 461
1169066159_1169066163 5 Left 1169066159 20:2695185-2695207 CCTGCTGTGTGGCGAGAGCTCTT 0: 1
1: 0
2: 2
3: 11
4: 116
Right 1169066163 20:2695213-2695235 GAGTGGGTGAGGAGTGCTGATGG 0: 1
1: 0
2: 3
3: 42
4: 461
1169066152_1169066163 23 Left 1169066152 20:2695167-2695189 CCCTCTTTGGCCCCACCACCTGC 0: 1
1: 0
2: 2
3: 43
4: 436
Right 1169066163 20:2695213-2695235 GAGTGGGTGAGGAGTGCTGATGG 0: 1
1: 0
2: 3
3: 42
4: 461
1169066151_1169066163 24 Left 1169066151 20:2695166-2695188 CCCCTCTTTGGCCCCACCACCTG 0: 1
1: 0
2: 1
3: 44
4: 346
Right 1169066163 20:2695213-2695235 GAGTGGGTGAGGAGTGCTGATGG 0: 1
1: 0
2: 3
3: 42
4: 461
1169066150_1169066163 25 Left 1169066150 20:2695165-2695187 CCCCCTCTTTGGCCCCACCACCT 0: 1
1: 0
2: 1
3: 52
4: 620
Right 1169066163 20:2695213-2695235 GAGTGGGTGAGGAGTGCTGATGG 0: 1
1: 0
2: 3
3: 42
4: 461
1169066158_1169066163 8 Left 1169066158 20:2695182-2695204 CCACCTGCTGTGTGGCGAGAGCT 0: 1
1: 0
2: 0
3: 14
4: 178
Right 1169066163 20:2695213-2695235 GAGTGGGTGAGGAGTGCTGATGG 0: 1
1: 0
2: 3
3: 42
4: 461
1169066155_1169066163 13 Left 1169066155 20:2695177-2695199 CCCCACCACCTGCTGTGTGGCGA 0: 1
1: 0
2: 1
3: 35
4: 217
Right 1169066163 20:2695213-2695235 GAGTGGGTGAGGAGTGCTGATGG 0: 1
1: 0
2: 3
3: 42
4: 461
1169066153_1169066163 22 Left 1169066153 20:2695168-2695190 CCTCTTTGGCCCCACCACCTGCT 0: 1
1: 0
2: 7
3: 39
4: 710
Right 1169066163 20:2695213-2695235 GAGTGGGTGAGGAGTGCTGATGG 0: 1
1: 0
2: 3
3: 42
4: 461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169066163 Original CRISPR GAGTGGGTGAGGAGTGCTGA TGG Intronic
900536777 1:3182543-3182565 GCCTGGGTGAGGGGTGCTGAAGG + Intronic
903323243 1:22554946-22554968 GAGTGGGTGGGTGGTGGTGAGGG - Intergenic
903790297 1:25888245-25888267 GAGTGGGTGAGGAGGGCTGTGGG + Intronic
904128681 1:28260092-28260114 GAGTGGGGGAGGGGTGCCGAGGG - Intronic
904695716 1:32329931-32329953 GTGTATGGGAGGAGTGCTGAAGG + Intronic
905258240 1:36699433-36699455 GAGAGAGTGAGGAGTGGAGAGGG - Intergenic
905404334 1:37722989-37723011 GAGTGGGTGAGGCTTCCAGATGG + Intronic
905464355 1:38141426-38141448 GATTGGGAGAGCAGGGCTGAAGG - Intergenic
908000383 1:59673214-59673236 AAGGGGGTAAGGAGTGTTGAGGG + Intronic
908318735 1:62960598-62960620 GGGTGGGTGAGGAGTGTAAAAGG - Intergenic
908424849 1:63996833-63996855 GATTGGGTGAGGAGAGATCATGG + Intronic
910560117 1:88581385-88581407 GAGTGGGGGATGATTGGTGAAGG - Intergenic
910981820 1:92965680-92965702 GAGTAGGTGAGGAATGAGGAAGG + Intergenic
911600942 1:99847845-99847867 GAATGGATGAGGAAGGCTGAGGG + Intergenic
912628144 1:111223099-111223121 GGGTGGGTCAGAAGTGCTGCAGG + Intronic
912997645 1:114547273-114547295 GAGTGGGGAAAGAGGGCTGAGGG + Intergenic
915121054 1:153629719-153629741 GAGTGGGAGAGGAGACCTGCAGG - Intronic
915199947 1:154220247-154220269 GAGTGGGTGGAGAATGCAGACGG + Intronic
915903058 1:159860051-159860073 GAGTGTGTGAGGCCTGGTGAGGG - Intronic
916124012 1:161553210-161553232 GATTGGCTGAGGGGTGATGAAGG + Intergenic
916133895 1:161634572-161634594 GATTGGCTGAGGGGTGATGAAGG + Intronic
916471111 1:165123646-165123668 GAGAGGGGAAGGAGAGCTGAAGG + Intergenic
916550429 1:165844679-165844701 GAGAGGGAGAGGGGGGCTGAAGG + Intronic
917306801 1:173634837-173634859 TAGTGGGTGAGGGGTGAGGAAGG - Intronic
917788994 1:178487465-178487487 GGCTGGGTGAGGACTGCAGATGG - Intergenic
917924098 1:179774561-179774583 GACTGGAGGAGGAGTGCTGAGGG + Intronic
919333915 1:196207974-196207996 GAGTGGCTGAGGAGTGGTGGAGG + Intergenic
919770163 1:201153659-201153681 GTGCGGGTGAGGAGTGAGGAAGG - Intronic
919785266 1:201254643-201254665 GAGTGGGTGAACAGAGCTGGAGG + Intergenic
920002953 1:202811756-202811778 GAGATGGTGAGGAGAGATGATGG - Intergenic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
921056287 1:211545017-211545039 GAGTGGCTGAGGTGAGATGAAGG - Intergenic
921257453 1:213355274-213355296 GAGTGGGTGAAGGGGGCTGGTGG + Intergenic
922022101 1:221715945-221715967 GAGTTGGGGAGGAGAGGTGAGGG - Intronic
923470441 1:234285754-234285776 TTGTGGGTGAGGATTCCTGAGGG + Intronic
923567621 1:235088251-235088273 GAGTGGGAGAGGGGTGCAGGTGG + Intergenic
924240073 1:242031901-242031923 AAGTGGGAGGGGAGTGGTGAGGG + Intergenic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1064113692 10:12559843-12559865 AAGAGGGTGAGGACTGCTAAAGG + Intronic
1064193946 10:13230541-13230563 GAGATCGTGAGGCGTGCTGAGGG - Intronic
1065957348 10:30705352-30705374 GAAGGGGTGAGGAGCGCTGTGGG - Intergenic
1067336934 10:45374082-45374104 GAGTGGGAGAGAAGTACTGCGGG + Intergenic
1067566324 10:47340253-47340275 GCCTGGGTGGGGAGTGATGAAGG + Intergenic
1067798856 10:49342922-49342944 GGGTGGAGGAGGAGTGGTGATGG - Intergenic
1067897037 10:50193627-50193649 GAGGGGATGAGGGGTGCTGGGGG + Intronic
1067951936 10:50748413-50748435 GAGGGGATGAGGGGTGCTGGGGG - Intronic
1068090288 10:52425049-52425071 CAGTGAGCCAGGAGTGCTGATGG + Intergenic
1069941828 10:71961978-71962000 GAGCGGGTGAGGGGTGGAGATGG + Intergenic
1070976479 10:80609610-80609632 GGGTTGGGGAGGGGTGCTGAAGG + Intronic
1071499355 10:86192510-86192532 CAGTGGGTGCTGAGGGCTGAAGG + Intronic
1071982971 10:91022432-91022454 GAGTGGGTGAGAGTTGGTGAGGG - Intergenic
1072156488 10:92728649-92728671 GTGGGGGTGAGGGGTGCTGCTGG - Intergenic
1072263204 10:93702354-93702376 GGGTGTGTGAGGAGGGCTGTGGG - Exonic
1072713616 10:97734871-97734893 GAGTGGGTGGGGAGTGGCGATGG + Intergenic
1073001808 10:100291284-100291306 GAGAGGGTGAGCTGGGCTGATGG - Exonic
1073443254 10:103565129-103565151 GATGGGGTGAGGGGTGCTCAGGG + Intronic
1074165763 10:110872349-110872371 CAGAGGGGGAGGAGGGCTGAGGG - Intronic
1074189082 10:111120556-111120578 GAGAGGGTGAAGAGTGCTGGTGG - Intergenic
1074654245 10:115564678-115564700 GAGTGGGTGGGTAATGCTGGTGG - Intronic
1075933618 10:126321449-126321471 GAGTGGGTGGTGAGTGTTGTTGG + Intronic
1075972666 10:126667916-126667938 GTGGTGGTGAGGGGTGCTGAAGG - Intronic
1076488729 10:130841411-130841433 GAAAGGGTGGGGAGTGGTGAGGG + Intergenic
1076561957 10:131372881-131372903 GAGGGTGTGGAGAGTGCTGATGG - Intergenic
1077334754 11:1998281-1998303 GAGTAGGGGTGGGGTGCTGAGGG + Intergenic
1078386824 11:10899667-10899689 GAGTGAGTGAATAGTGCTGGGGG + Intergenic
1078609748 11:12809923-12809945 GAGTGGGTGAGGAGGTGTGGAGG + Intronic
1080649755 11:34212679-34212701 GATGGGGTGGTGAGTGCTGAAGG - Intronic
1083506017 11:63157985-63158007 CAGTGAGCCAGGAGTGCTGATGG - Intronic
1084164906 11:67371056-67371078 GAGTGGGTGAGGAGTGGGCTAGG + Intronic
1084563775 11:69918494-69918516 GTGGGGGTGGGGCGTGCTGAGGG - Intergenic
1085065902 11:73495448-73495470 GAGTGGGCCAGCAGTGGTGATGG - Intronic
1085308138 11:75500063-75500085 GAATGGCTGTGGAGGGCTGAGGG - Intronic
1085322956 11:75585750-75585772 AAGTGGCTGTGGAGTTCTGATGG - Intergenic
1085403894 11:76250356-76250378 CATTGGGTGAGGAGTGCTACAGG + Intergenic
1085471126 11:76758776-76758798 GAGAGGGTGTGGAGTGAGGAAGG + Intergenic
1088544730 11:110947817-110947839 GAGTGGGGAAGGGGTGCTCAGGG + Intergenic
1089142699 11:116300124-116300146 AAGTGGGTCAGAAGTACTGAAGG - Intergenic
1089371159 11:117959152-117959174 GAGTTGGGAAGGAGTGCAGATGG + Intergenic
1089458416 11:118639043-118639065 AAGTGGGAGGGGAGTGCAGAAGG + Intronic
1089676306 11:120092355-120092377 GAGTGGGGGAATAGTGTTGAAGG + Intergenic
1089742234 11:120592630-120592652 GAGGGTGTGGGAAGTGCTGAGGG - Intronic
1090379357 11:126314831-126314853 GAAAGGGTGGGGAGTGGTGAGGG + Intronic
1090905347 11:131069616-131069638 GAGGGGGTGAAGAGGGGTGAGGG - Intergenic
1091044813 11:132316078-132316100 GTGAGGATGAGGAGTGCTGTGGG - Intronic
1091314810 11:134606829-134606851 GTGAGGGTGGGGAGTGCTGAAGG + Intergenic
1202817737 11_KI270721v1_random:53463-53485 GAGTAGGGGTGGGGTGCTGAGGG + Intergenic
1091589821 12:1836447-1836469 GGGTGGGTGAGGTGGGCTGGGGG + Exonic
1091725604 12:2844638-2844660 GGGAGGGACAGGAGTGCTGAAGG - Intronic
1091751331 12:3022872-3022894 AAGAGCGTGAGGAGAGCTGAAGG - Intronic
1092056427 12:5511875-5511897 GGGTGGGGGTGCAGTGCTGATGG + Intronic
1092056957 12:5515434-5515456 GAATAGGTGAGAGGTGCTGATGG - Intronic
1092672144 12:10875661-10875683 AAATGGGGAAGGAGTGCTGAAGG - Intronic
1093244192 12:16715155-16715177 GTGTGGGAGAGGAGTGGAGAGGG + Intergenic
1093691108 12:22109982-22110004 GAAAGGGTGGGGAGTGGTGAGGG + Intronic
1094201338 12:27797516-27797538 GAGTGGGAGGTGAGTGCGGATGG + Intronic
1095510296 12:42943985-42944007 GAGGGGGTGAGTTGTGCTGAGGG + Intergenic
1096109111 12:49018715-49018737 GAGACGGTGAGGAGTGCAGGAGG - Exonic
1096623637 12:52879799-52879821 GGGTGGGTGGGGGGAGCTGAGGG - Intergenic
1097050630 12:56221281-56221303 GAGGGGGTGAGGAGCGGGGAAGG + Intronic
1101224662 12:102676023-102676045 GAGTGAGTTATGAGTTCTGATGG + Intergenic
1101515881 12:105434690-105434712 GGGTGGCTGAGGGATGCTGAGGG + Intergenic
1101518394 12:105459110-105459132 GAGGGGGAGGGGAGTGCTTAAGG + Intergenic
1102016333 12:109650356-109650378 GAGAGGCTGAGGAGGGCAGATGG + Intergenic
1102157008 12:110738493-110738515 GACTAGGTGAGGATTCCTGATGG - Intronic
1102457891 12:113082205-113082227 GCGTGGGTGGGGAGGGATGAGGG - Intronic
1103738187 12:123073928-123073950 GGTTGGGTGAGGAGAGCTGGGGG - Intronic
1103948863 12:124541066-124541088 GAGGGGGTGGGGAGTGGAGATGG + Intronic
1103949132 12:124541849-124541871 GAGGGGGTGGGGAGTGGAGATGG + Intronic
1104267729 12:127252170-127252192 GAGTGAGTGGTGAGAGCTGATGG - Intergenic
1104349420 12:128031882-128031904 TAGTGAGCCAGGAGTGCTGATGG - Intergenic
1104372610 12:128237132-128237154 GGGTGGGTGGGGAGTGGGGAGGG - Intergenic
1104601152 12:130154343-130154365 GAGTGGGTGCAGAGAGCTGAGGG - Intergenic
1105520891 13:21130031-21130053 GAGTGAGTGAGGACTGAGGATGG + Intergenic
1105609772 13:21957940-21957962 GACTGGGATTGGAGTGCTGATGG + Intergenic
1105974088 13:25457951-25457973 TAGTGGGTTAAGACTGCTGATGG + Intronic
1106232689 13:27833427-27833449 GAGCAGGTGAGGAGTGCAGCAGG - Intergenic
1106312865 13:28568947-28568969 GAGAAGGAGAGCAGTGCTGATGG - Intergenic
1107431304 13:40342788-40342810 GAGTTGCACAGGAGTGCTGACGG - Intergenic
1107613274 13:42138367-42138389 GAGGGGGTGAGGAGAGATGGTGG + Intronic
1110113156 13:71776903-71776925 GTCTGGGTGGGGAGTGATGAAGG - Intronic
1111133944 13:84014139-84014161 GAGTGGGTGAGGAAAGGAGAAGG + Intergenic
1111469764 13:88663751-88663773 GAATGTGTGAGGAGAACTGATGG - Intergenic
1111639172 13:90946554-90946576 GCATGGGGGAGGAGTGCTGTAGG - Intergenic
1112146687 13:96707957-96707979 GAGTTAGTGAGGTTTGCTGATGG + Intronic
1112382582 13:98906220-98906242 GAGTGGATGAGATGTCCTGAGGG + Intronic
1112592540 13:100776833-100776855 CAGTGAGCCAGGAGTGCTGATGG - Intergenic
1112896304 13:104304341-104304363 GAGTGGGTGAGTGCTGCAGAAGG - Intergenic
1113171205 13:107505241-107505263 GCATTGGTGAGGAATGCTGAAGG + Intronic
1113909813 13:113836560-113836582 GAGGGGGTGGGGAGGGGTGAGGG + Intronic
1113909825 13:113836582-113836604 GAGGGGGTGGGGAGGGGTGAGGG + Intronic
1114639978 14:24213184-24213206 GAGTGGGGGAGGACGGCGGACGG + Intronic
1116115525 14:40645120-40645142 GAGAGGGTGAGGAGTGGTCTTGG - Intergenic
1116604082 14:46967604-46967626 CAGTGGGTAAGGATTGATGAAGG - Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117181175 14:53193431-53193453 CAGTGAGCCAGGAGTGCTGACGG - Intergenic
1119105606 14:71920436-71920458 GAGCTGGTGAGGAGGGCTGATGG + Intergenic
1121469206 14:94138882-94138904 GTGGGGGTGAGCAGGGCTGACGG + Intergenic
1122234381 14:100323601-100323623 GGCTGGGTGAGGGGTGCTGCAGG + Intronic
1122438010 14:101712318-101712340 CAGTGGGTGGGGAGAGATGACGG - Intergenic
1122438397 14:101713710-101713732 CAGTGGGTGGGGAGAGATGACGG - Intergenic
1122821120 14:104345677-104345699 GGGAGGGTGAGGAGTGCCGGTGG + Intergenic
1122861770 14:104585844-104585866 GAGAGTGTGAGCCGTGCTGAGGG + Intronic
1123433274 15:20236219-20236241 GAGTGGGGAGGGACTGCTGAAGG - Intergenic
1124169476 15:27360071-27360093 CACTGGGTCAGGAGTGCTGCAGG + Intronic
1124680864 15:31729718-31729740 GAGAGTGTGAGGTGTGCTTATGG - Intronic
1125517223 15:40328585-40328607 CAGTGGGTGCTGGGTGCTGATGG + Intergenic
1125848220 15:42878593-42878615 GAGTGGGGGAGGAGAGCAGCTGG - Exonic
1127489031 15:59444641-59444663 GAGTGGGGAGGCAGTGCTGAAGG - Intronic
1127618399 15:60709839-60709861 GAGTGGGGCAGGAGTGTTGGGGG - Intronic
1128475369 15:67992794-67992816 ATTTGGGTGAGGAGGGCTGAAGG - Intergenic
1128887543 15:71302581-71302603 GAGTGGGGGTGGGGTGCTGGGGG + Intronic
1129156384 15:73720996-73721018 GAGTGGGTGAACAGAGCTTAGGG - Intergenic
1130200933 15:81826253-81826275 GAGTGGGTGAGGTGGGGTGGGGG + Intergenic
1130425899 15:83798985-83799007 GAATGGGTGAGGAATGATTAAGG - Intronic
1130949323 15:88573199-88573221 GGGTGGGTGAGGGGAGGTGAAGG - Intergenic
1132353379 15:101154454-101154476 GGGTTGGTGAGGAGTGCAGATGG + Intergenic
1132697852 16:1209902-1209924 CAGCGGGTGAGGAGTGAGGATGG + Intronic
1132839283 16:1971015-1971037 GAGTGGGTGCAGAGGGCAGAGGG - Intergenic
1133876638 16:9740999-9741021 GAGTGGGTGGGGTGTGCTCAAGG - Intergenic
1135860663 16:26052759-26052781 GAGTTGGTGAGGACTGTTGAGGG - Intronic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136481739 16:30546320-30546342 GAGCGGGTGAGGGGTGGAGACGG + Intronic
1136851351 16:33614903-33614925 GAGTGGGGAGGGACTGCTGAAGG + Intergenic
1137581181 16:49634522-49634544 GAGGGGGTGAGGAGGGCAGAGGG - Intronic
1137602557 16:49766481-49766503 GCGTGGGTGAGGATGTCTGAAGG - Intronic
1138384407 16:56626343-56626365 GAGTGGGAAAGGAGCTCTGAGGG + Intronic
1138385506 16:56633217-56633239 GAGTGGGAAAGGAGCTCTGAGGG + Intronic
1138386064 16:56636316-56636338 GAGTGGGAAAGGAGCTCTGAGGG + Intergenic
1138388451 16:56652448-56652470 GAGTGGGAAAGGAGCTCTGATGG + Intronic
1138389309 16:56658549-56658571 GAGTGGGAAAGGAGCTCTGAGGG + Intronic
1138390548 16:56667477-56667499 GAGTGGGAAAGGAGCTCTGAGGG - Intronic
1138391109 16:56670383-56670405 GAGTGGGAAAGGAGCTCTGACGG + Intronic
1138442063 16:57041068-57041090 GAAGGGGGGAAGAGTGCTGATGG - Intronic
1139372104 16:66475393-66475415 GACTGGGTGGGCAGCGCTGAGGG - Intronic
1139696794 16:68680816-68680838 CAGTGGGTGAGGGGTGGTCAAGG + Intronic
1139709308 16:68763627-68763649 AAGTGGGGGAGGAGGGCCGAGGG - Intronic
1141423458 16:83931461-83931483 GAAGGGGTGAGGTGTGCTGGGGG + Intronic
1141617362 16:85217554-85217576 GAGTGCGTGAGAAGTGATGCTGG + Intergenic
1141955841 16:87370731-87370753 GAGGGGGCGGCGAGTGCTGAGGG + Intronic
1141962105 16:87415838-87415860 CAGAGGGTGATGAGTTCTGAAGG - Intronic
1143020938 17:3916939-3916961 CAGTGGGAGAGGAGAGCTGGGGG - Intergenic
1143026328 17:3943906-3943928 GAGTGGGAGAGGTGGCCTGAGGG - Intronic
1144447828 17:15347429-15347451 GAGTGGAAGGGGAGGGCTGATGG + Intergenic
1144447851 17:15347514-15347536 GAGTGGAAGGGGAGGGCTGATGG + Intergenic
1144447863 17:15347557-15347579 GAGTGGAAGGGGAGGGCTGATGG + Intergenic
1146647783 17:34586645-34586667 GAGTGGGTGGGAAGTGGTGGTGG - Intronic
1147460409 17:40564675-40564697 GAGTGCGTGAGGTTTGCTCAGGG + Intronic
1147768956 17:42854771-42854793 GAGTGGGAAAGGAGTGTTGGCGG + Intronic
1148182127 17:45613744-45613766 GAGGGTGTGATGAGTGTTGATGG - Intergenic
1148266732 17:46231952-46231974 GAGGGTGTGATGAGTGTTGATGG + Intergenic
1148502561 17:48102650-48102672 GATTGGGTGAAAGGTGCTGACGG - Intergenic
1148741904 17:49897821-49897843 AGGTGGGACAGGAGTGCTGATGG - Intergenic
1150141584 17:62734295-62734317 GGGTGGGTGTGGGGAGCTGAAGG + Intronic
1150621854 17:66813573-66813595 GAGTGGGTGAGAAGTGCTTTTGG + Intergenic
1151599778 17:75099088-75099110 GAGTGGGTGGGGAGCGGGGAAGG + Intronic
1152626775 17:81391294-81391316 GGGTGGGAGAGGAGTGCTGGAGG + Intergenic
1153643442 18:7174730-7174752 GTGTGGGTGTGGGGTGCTGAAGG - Intergenic
1154105962 18:11523347-11523369 GAGTGAGTGAGAAGTGAGGAGGG - Intergenic
1157116182 18:44864683-44864705 GAGAGGGTGCGGGGTGCAGAGGG - Intronic
1157181863 18:45505428-45505450 GAGTGGGTGAGGAGCCCACAGGG + Intronic
1157894948 18:51457075-51457097 GGGTGGGTGGGGAGAGCTGAGGG - Intergenic
1158497524 18:57969992-57970014 ATGTGGGTGTGGAGTGATGAAGG - Intergenic
1159602986 18:70446289-70446311 AAGAGGGTGAGAAGGGCTGAGGG - Intergenic
1159783045 18:72681516-72681538 GAGTGGGAGAGAAGTGGAGAGGG - Intergenic
1159915327 18:74182962-74182984 GAGAGGGAGAGGAGTGGTGGAGG - Intergenic
1160251248 18:77205059-77205081 GAGAGAGAGAGGAGTGCAGAGGG - Intergenic
1160587877 18:79922792-79922814 GAGGGGGTTGGGGGTGCTGAGGG + Intronic
1160857502 19:1224084-1224106 GAGGGGCCCAGGAGTGCTGAGGG - Intronic
1160939977 19:1615651-1615673 GTGAGGGTGGGGAGTGCCGAGGG + Intronic
1161348868 19:3781574-3781596 GACTGGGTTGGGGGTGCTGAAGG - Intronic
1161610095 19:5237694-5237716 GACTGGCTGAGGTGTCCTGAAGG - Intronic
1162030556 19:7915466-7915488 AAGTGGGTGTGGTGTGCGGATGG + Intergenic
1162325230 19:9995446-9995468 TAGTGGGAAAAGAGTGCTGAAGG - Intronic
1162666909 19:12221017-12221039 GGGTGGGAGAGGGGTGCTGTTGG + Intergenic
1162775322 19:12975487-12975509 GGGTGGGTAATGAGTGCTGGGGG + Intergenic
1163370502 19:16898595-16898617 GAGTGGGGAGTGAGTGCTGATGG - Intronic
1163763707 19:19150794-19150816 GAGTGGGTGGAGAGTGGGGAGGG + Intronic
1163883242 19:19945345-19945367 GAGTGGGTAAGGGGTGGTGATGG - Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1165020868 19:32922941-32922963 TAGAGGATGAGGAGTGCAGAAGG + Intronic
1165068925 19:33244065-33244087 GAAGGGGTGAGGAGCTCTGAGGG - Intergenic
1165940059 19:39410422-39410444 AAGTGGGAGAGGAGTAATGAGGG - Intergenic
1166333477 19:42091704-42091726 GAAGGTGTGAGGGGTGCTGATGG - Intronic
1166547168 19:43640327-43640349 GAGTGTGAGAGGCGTGCTGCGGG + Intergenic
1167200532 19:48062067-48062089 GAGTGGGAAGGGAGTGTTGATGG + Exonic
1167220549 19:48195913-48195935 GAGAGGGTCAGGAGTCTTGAAGG + Exonic
1167566694 19:50261445-50261467 GGGTGGGAGAGGGGTGATGACGG - Intronic
1167602011 19:50459842-50459864 GAGGAGGTGAGGAGGGATGAGGG + Intronic
1167694780 19:51009109-51009131 GAGAGGGTGAGGGGTGCTTTAGG - Intronic
1167694963 19:51009785-51009807 GAATGGAGGAGGAGTGCTGGGGG + Intergenic
1167777679 19:51571519-51571541 GGGTGGGTGATGGGTGCTGTGGG + Intronic
1168135317 19:54347131-54347153 ACGTGGGTGAGGAGGGCTCAAGG + Intergenic
925348848 2:3187799-3187821 AGGTGGGTGAGGAGTGGGGAGGG - Intergenic
925348883 2:3187887-3187909 AGGTGGGTGAGGAGTGGGGAGGG - Intergenic
926145881 2:10396951-10396973 GGGTGGGTGAGGACTGAGGATGG + Intronic
926706280 2:15840063-15840085 TAGTGTGTGAGGAGGGGTGAAGG - Intergenic
926763714 2:16303734-16303756 GATTGGATGAGGTGTGCAGAAGG - Intergenic
927036217 2:19179539-19179561 GAAAGGGTGGGGAGTGGTGAGGG - Intergenic
927309907 2:21618264-21618286 GGGTGGGTGAGGGGTGGTGTTGG + Intergenic
927907901 2:26875200-26875222 GAGTGGGTGGAGGGTGGTGAAGG + Intronic
928142301 2:28740272-28740294 GTGTGTGTGTGTAGTGCTGAAGG - Intergenic
928761344 2:34586895-34586917 GAGCAGGTAAGCAGTGCTGAAGG + Intergenic
929299143 2:40282021-40282043 GTGTGGGGGAGCTGTGCTGAAGG - Intronic
929493994 2:42423451-42423473 GAGTGTGTGAGGAGTGCTGTTGG - Intronic
929670898 2:43875914-43875936 GAGAGGGTGGGGTGTGCTGGGGG - Intronic
930388493 2:50729663-50729685 GAGAGGGTGAAGAGTGCTGATGG - Intronic
931835431 2:66093996-66094018 GAGGGAGTGAGGAATGGTGAGGG + Intergenic
932405813 2:71512070-71512092 CAGTGGGTGGGAAGTCCTGAGGG + Intronic
933652577 2:84861183-84861205 GAGCAGGTGAGGGGTGCTGTTGG + Intronic
933978686 2:87532795-87532817 GAATGGGAGAGGAGAGCTAAAGG - Intergenic
934536693 2:95140128-95140150 CAGTGGGTGAGGGGAGCTGAGGG + Intronic
935553993 2:104486774-104486796 GAACGGGTGGAGAGTGCTGAGGG - Intergenic
935984539 2:108660102-108660124 GAGTGGGTGAGGTGTGTGGGGGG - Intronic
936067632 2:109344272-109344294 GAGTGGCTGATGGGTGCTGATGG + Intronic
936093004 2:109512816-109512838 GAGGGGGTGAGGAGGGGTCAGGG - Intergenic
936136976 2:109903750-109903772 GAGTGGGTGAGGTGTGTGGGGGG - Intergenic
936207721 2:110467735-110467757 GAGTGGGTGAGGTGTGTGGGGGG + Intronic
936315146 2:111418000-111418022 GAATGGGAGAGGAGAGCTAAAGG + Intergenic
936974753 2:118207847-118207869 GATGGGGTGAGGAGTCTTGAGGG + Intergenic
937075809 2:119105670-119105692 GAATGAGTGAGGAGTGAGGAGGG - Intergenic
937957071 2:127427493-127427515 GAGTGGGAGTGGAGAGGTGAAGG - Intronic
940615889 2:156048049-156048071 TAGGGGGTGCGCAGTGCTGAGGG - Intergenic
940638286 2:156323130-156323152 GGGAGGGAGATGAGTGCTGAAGG + Intergenic
941998836 2:171626705-171626727 GAGGTGGTGGGGGGTGCTGAGGG + Intergenic
942301095 2:174563330-174563352 GAGAGGTTGAGGAGGGATGATGG + Intronic
943547878 2:189303689-189303711 GAGTGGTTGAAGTGTGCTGCTGG - Intergenic
943966043 2:194334258-194334280 GAGCGGGAGAGGAGAGATGAAGG + Intergenic
944391041 2:199220010-199220032 GAGGGGGTGAGGAGTAAAGAAGG - Intergenic
945142627 2:206703101-206703123 GGGTAGGGGCGGAGTGCTGAGGG + Intronic
946187623 2:217990013-217990035 GTGTGGATGATGTGTGCTGAGGG - Intronic
946187627 2:217990048-217990070 GTGTGGATGATGTGTGCTGAGGG - Intronic
946187651 2:217990210-217990232 GTGTGGATGATGCGTGCTGAGGG - Intronic
946385917 2:219384470-219384492 GAGTGGGGGTGGAGGGTTGAAGG - Intronic
946407931 2:219502040-219502062 GAGGGGGTCAGGAGGGCTGGAGG + Intronic
946569070 2:221001344-221001366 GAGTGGGAGAGGAGAGGAGAAGG - Intergenic
946570026 2:221014270-221014292 CAGTGAGTCAGGAGTGCTGATGG - Intergenic
947400298 2:229725042-229725064 GAGATGGTGAGGAGTGGGGAAGG + Intergenic
947787717 2:232838803-232838825 GGGTGGGGGAGGGGTGCAGAGGG - Intronic
1168953464 20:1818145-1818167 GGGTGGATGAGGAGACCTGATGG - Intergenic
1169023333 20:2347249-2347271 GAGTGGAAGAGGAGTGGGGAAGG - Intergenic
1169066163 20:2695213-2695235 GAGTGGGTGAGGAGTGCTGATGG + Intronic
1169217093 20:3800231-3800253 GGGTGGGTGATGGGTGCGGAGGG + Intronic
1171104452 20:22419430-22419452 GATAGTTTGAGGAGTGCTGATGG - Intergenic
1171200062 20:23233515-23233537 GAGTGTGCGAGGAGAGGTGAGGG + Intergenic
1171386918 20:24776725-24776747 GACTGGGTGAAGAGTGCTCCAGG + Intergenic
1173422916 20:42918552-42918574 GCGTGGGTGAGGAGAGCAGGTGG - Intronic
1173803513 20:45909889-45909911 GAGTGGGTCAGGAGGGCTGGAGG - Intronic
1174054882 20:47791655-47791677 GTGTGGGTGGGGAGTGGGGAGGG - Intergenic
1175306160 20:57977073-57977095 GAGAGGGTGAGGGGTGCTCCTGG - Intergenic
1175672821 20:60920670-60920692 GTGTGTGTGAGGACTGCGGAGGG - Intergenic
1176119989 20:63450074-63450096 GAGGGGGTGAGGCGGGGTGAGGG - Intronic
1176120019 20:63450157-63450179 GGGTGGGGGAGGAGTGGTGGTGG - Intronic
1176157451 20:63628818-63628840 AAGTCGAAGAGGAGTGCTGAGGG + Intergenic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1177778670 21:25599111-25599133 CAGTAGGTAAGGGGTGCTGATGG - Intronic
1178292369 21:31379857-31379879 GATTGGGTGAGAAGAGCTGGAGG + Intronic
1178347887 21:31847740-31847762 CAGTTGGTGGGGAGTGTTGAAGG - Intergenic
1178559243 21:33622536-33622558 GAGTGGGTGAGAAGTAGTGATGG + Intronic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1179117275 21:38505347-38505369 GAGAGGGTGAGGTGTGGAGAGGG - Intronic
1179723516 21:43329317-43329339 GGGTGGGTGTGGGGTGATGAGGG + Intergenic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1180041806 21:45283927-45283949 GAGGGGGTGAGGAGCGCTGTGGG - Intronic
1180044993 21:45301210-45301232 CTGTGGCTGAGCAGTGCTGAAGG - Intergenic
1180722845 22:17922164-17922186 GAGCAAGTGAGGAGTGTTGAAGG - Intronic
1180818432 22:18807971-18807993 AAGTGGGGGAGGGGGGCTGATGG + Intergenic
1181204654 22:21242426-21242448 AAGTGGGGGAGGGGGGCTGATGG + Intergenic
1181783163 22:25207406-25207428 CTGTGGGAGAGGCGTGCTGAAGG + Intergenic
1182199692 22:28555693-28555715 GAAAGGGTGGGGGGTGCTGAGGG + Intronic
1182454499 22:30441243-30441265 CAGTGAGTCAGGAGTGCTGATGG + Intergenic
1183364446 22:37399670-37399692 GGGTGGGAGAGGTGGGCTGATGG - Intronic
1183472171 22:38015500-38015522 GAGGGAGAGAGGAGTGCTCAAGG - Intronic
1183708478 22:39489052-39489074 GAGTGGGTGGGGAGTGGGGGTGG + Exonic
1184361582 22:44022374-44022396 GGGTGGGGGAGAAGTGCTGTGGG - Intronic
1184517367 22:44970978-44971000 GGTTGGAGGAGGAGTGCTGACGG - Intronic
1184813039 22:46850164-46850186 GAGATGGAGACGAGTGCTGAGGG + Intronic
1185383830 22:50522579-50522601 CAGCGGGCTAGGAGTGCTGAGGG + Intronic
1203222270 22_KI270731v1_random:52989-53011 AAGTGGGGGAGGGGGGCTGATGG - Intergenic
949357936 3:3201668-3201690 GAATGGGTGAGGAGTGAGGCAGG - Intergenic
950669611 3:14518245-14518267 GAATTGGTGAGGAGTGCAGCTGG + Intronic
950967965 3:17159538-17159560 GAGTGGGTGAGGATGGCAGAGGG - Intronic
951623165 3:24628970-24628992 GAGTGGTTGGGGAAGGCTGAGGG - Intergenic
952231123 3:31432150-31432172 GAGTGGGAGGGGAGTGCAGTGGG - Intergenic
952237536 3:31495587-31495609 GAGTGGCTTGGGAGAGCTGAGGG + Intergenic
952427853 3:33193649-33193671 GAGTGAGTGAGGGGAGATGAGGG + Intronic
955100270 3:55842304-55842326 GAGTGGCTCAGAAGTGTTGAAGG + Intronic
955345847 3:58161321-58161343 GGGTGGGTGAGGATTGGTCAGGG + Intronic
955409657 3:58647382-58647404 GATTGGCTGAGGAGTGATGCTGG + Intronic
956157871 3:66317639-66317661 GAGTGGGTGTGCTGTGCTGTGGG + Intronic
957262801 3:77922482-77922504 GAGTGGGGGAGGAGAGCTCTGGG - Intergenic
957418703 3:79939789-79939811 CAGTGGGGGAGCAGTGCTAAAGG - Intergenic
960053449 3:113259228-113259250 GAGTGGGTTAAGAGTCCTTAAGG - Intronic
960293893 3:115919122-115919144 GTGGGGGTGAGGAGTGGGGAGGG - Intronic
961094482 3:124142745-124142767 GAGTGGGTGGGGGGTGGAGATGG - Intronic
961171738 3:124802100-124802122 TAGAGGGTGATGAGTGCTGTGGG - Intronic
961197408 3:125014512-125014534 GAGTGTGTGTGGAGGGCTGGGGG + Intronic
962345037 3:134612438-134612460 AAGGTGGTGGGGAGTGCTGAGGG + Intronic
965919670 3:173896795-173896817 GATTGGGTGAGAAGAGCGGATGG - Intronic
967429973 3:189371127-189371149 GAATGGGTCAGGTGTGATGATGG + Intergenic
967873418 3:194250620-194250642 GAGTGGGGGGAGAGTGCTCAAGG - Intergenic
968093560 3:195912259-195912281 GAGTGGGTGGGTGCTGCTGAGGG + Intergenic
968909292 4:3469419-3469441 GGGTGGGTGGGCAGGGCTGATGG + Intronic
968909310 4:3469480-3469502 GGGTGGGTGAGCAGGGCCGATGG + Intronic
968925231 4:3543505-3543527 GAGTGGGTGGGGGGTTATGAAGG - Intergenic
968954182 4:3709872-3709894 GAGTAGGTGAGGGGAGCTGCAGG + Intergenic
969062989 4:4453817-4453839 CAGTGAGTGAGTAGTGGTGAAGG - Intronic
969240587 4:5894456-5894478 GACTGGGTGGGGACTGCAGAGGG + Intergenic
969492542 4:7508218-7508240 AAGGGGGTGAGGAGGGATGAAGG + Intronic
969592118 4:8127848-8127870 GGGTGGGGGAGGAGTGGTGGGGG + Intronic
970423259 4:15924394-15924416 GAGTGGCTGAGGAGTATTAATGG - Intergenic
971189789 4:24416478-24416500 GAATGGGAGAGAAGGGCTGAGGG + Intergenic
975234366 4:71974530-71974552 GAGTGCATGATGAGTGCTTAAGG - Intergenic
975668033 4:76753438-76753460 GAGTGGATCTGGAGTGCAGATGG - Intronic
975800716 4:78057260-78057282 GCCTGGGTGAGGAGGGCTGCGGG - Intergenic
976738456 4:88334269-88334291 AAGTGGATGAGGAGGGATGAGGG - Intergenic
976961106 4:90975217-90975239 GAGTAGGAAATGAGTGCTGATGG + Intronic
978557540 4:109997106-109997128 CAGTGAGCCAGGAGTGCTGATGG + Intronic
979649005 4:123107733-123107755 GGGAGGCTGAGGAGGGCTGAGGG - Intronic
979715491 4:123832393-123832415 GAGAGAGTGAGCAGTGGTGAAGG + Intergenic
980126703 4:128781371-128781393 GAGAGGCTGAGGAGGGCTGATGG + Intergenic
981027590 4:140092565-140092587 GAGTGAGTGAGCAGTGCGGCGGG - Intronic
983981873 4:174007861-174007883 GAGTGGGAGAGTAGAGATGAGGG - Intergenic
984364730 4:178784235-178784257 GAAGGGGTCAGGAGTGCTGAGGG + Intergenic
985377210 4:189354427-189354449 GAGTGGGTGTTGGGTGTTGATGG + Intergenic
987210976 5:15683051-15683073 GAGAGGGAGATGAGAGCTGAAGG + Intronic
993020372 5:82584495-82584517 GAGTGGGTATGCTGTGCTGAAGG + Intergenic
995039417 5:107571137-107571159 GAGTGGGGGAAGAGGGCTTAGGG + Intronic
995597067 5:113759088-113759110 GAGTGAGTGAGGAGGCATGAGGG + Intergenic
995887784 5:116915703-116915725 AAGTGGGTGTGGGGTGCTGAAGG + Intergenic
996054649 5:118969294-118969316 GAGTGGGTGTGCTGAGCTGAGGG - Intronic
996540815 5:124628988-124629010 CAGTGGATGAGGTGTGCTCAGGG - Intergenic
997631774 5:135374142-135374164 GAGAGGGTGAGTATTACTGATGG - Intronic
998650710 5:144118541-144118563 GGGTGGAGGAGGAGTTCTGAGGG - Intergenic
999188751 5:149731272-149731294 GACTGGGAGAGGGGTGCTGCTGG + Intronic
999793498 5:154965778-154965800 GAATGGGGGAGGGGAGCTGAAGG + Intronic
1001731378 5:173962945-173962967 CAGCGGGTGAGGGGTGCTGAGGG - Intergenic
1003110606 6:3249463-3249485 AAATGGGTGAGCAGTGCTGTAGG - Intronic
1003434586 6:6074175-6074197 GGGTGAGTGAGCAGTGCTGGTGG + Intergenic
1005280336 6:24267165-24267187 GTGAGGGTGAGGAGTGGAGATGG + Intronic
1006162859 6:32048208-32048230 GAGTGGGAGAGGAGAGCTCAGGG + Intronic
1006255784 6:32830862-32830884 GAGTGTGTGAGGAGTTGGGAGGG - Intronic
1006520630 6:34569039-34569061 GAGAGGGAGAGGAGAGGTGATGG - Intergenic
1006948448 6:37801213-37801235 GAGTCGGTGGAGGGTGCTGAAGG - Intergenic
1007231756 6:40353037-40353059 GAGGTAGTGAGGAATGCTGATGG - Intergenic
1007412879 6:41674946-41674968 GTGTGGGTGAGGAGGGCTAGAGG + Intergenic
1007579604 6:42949532-42949554 GTGTGGGAAAGGAATGCTGAAGG - Intergenic
1007598153 6:43064599-43064621 GAGTGGGTTAGGAGTTGAGATGG + Intronic
1007614604 6:43172446-43172468 GAAGGGGTGAGGAGCGGTGATGG + Intronic
1011029757 6:82909063-82909085 AGGTGGGTGAGGACTTCTGAAGG + Intronic
1011112972 6:83859127-83859149 GAGTGGGTGAATAGAGCAGAAGG + Intergenic
1012953688 6:105545659-105545681 GTGTGGATGAGGAGAGCAGAAGG - Intergenic
1013063466 6:106660315-106660337 GGGGGGGTGGGGAGTGTTGAGGG - Intronic
1013304279 6:108833559-108833581 GGGTGGGTGGGGGGTGCTGAGGG + Intergenic
1014713145 6:124832801-124832823 GAGTGTGTGAGGTGGGTTGAAGG - Intergenic
1015473636 6:133634920-133634942 AACTGGCTGTGGAGTGCTGATGG + Intergenic
1016261712 6:142179408-142179430 GACTTGTTGAGGAGTGCTTATGG + Intronic
1016567346 6:145471544-145471566 GAGTGGGGAAGGAGTGGTGTTGG - Intergenic
1017048914 6:150372383-150372405 GGTGGGGTGGGGAGTGCTGAGGG + Intronic
1017048944 6:150372509-150372531 GGTGGGGTGGGGAGTGCTGAGGG + Intronic
1017828069 6:158097403-158097425 GAATAGGTGAGAAGTGCTGTTGG - Exonic
1018301012 6:162403218-162403240 GAGTGAGTGAGGAGAGCTGGAGG - Intronic
1018639054 6:165890061-165890083 GAGTGAGTGAGGAGTGAGGGAGG - Intronic
1018722973 6:166587905-166587927 GAGTGAGTGAGGAGGGCGCAGGG - Intronic
1019982246 7:4630155-4630177 GAGTGGGTGGGCAAGGCTGATGG - Intergenic
1020020288 7:4862282-4862304 GCTAGGGTGAAGAGTGCTGAGGG - Intronic
1021614238 7:22486526-22486548 GAGTGGGTGAGGCCTGGAGAAGG - Intronic
1021717259 7:23471129-23471151 GAGTGGGTGAGGGGGGCAGGGGG + Intergenic
1021955266 7:25818124-25818146 GAGTGGGCCAGGATTGCTGAGGG - Intergenic
1022350276 7:29561537-29561559 GAGTGGGTGAGCATTTCAGATGG - Intergenic
1022638018 7:32155511-32155533 GAGTGGTTGCTCAGTGCTGATGG + Intronic
1022741268 7:33123617-33123639 GAGTGTGGGAGGAGTGGTGTTGG + Intergenic
1023665044 7:42514155-42514177 GAGTGGGTAAGGGGTGCTTTGGG + Intergenic
1024030092 7:45453650-45453672 GAGGGGGTGAGGAGGGATGGAGG + Intergenic
1024390994 7:48812025-48812047 GAGTGAGTGAATAGAGCTGAAGG + Intergenic
1024720604 7:52133769-52133791 GAGTGGGTGTGGATTGAAGAAGG + Intergenic
1025709024 7:63890868-63890890 GAGAGGAGGAGGAGGGCTGAAGG + Intergenic
1027297546 7:76793249-76793271 GAGGGGTGGAGGAGGGCTGAAGG - Intergenic
1028297890 7:89158372-89158394 GAATGGGTGTGGAGGGCTAAGGG - Intronic
1028626992 7:92888883-92888905 GAGTGGGTGTGCTGTGCTGGGGG + Intergenic
1028912992 7:96228880-96228902 GGGTGGGCCAGGAGTGCTGGGGG - Intronic
1031145053 7:117988421-117988443 GATTGGGGGAGGAGAGATGAAGG + Intergenic
1032453490 7:132054264-132054286 GAAGGGGTGGGGAGTGATGAAGG + Intergenic
1032978488 7:137253215-137253237 GAGCGGGTGAGGAATGCTACCGG + Intronic
1033457063 7:141512112-141512134 GAGTGGGCGAGGAATGGTGGAGG - Intergenic
1033521015 7:142160368-142160390 GAGTGGGGGAAGATTACTGATGG - Intronic
1033599656 7:142879829-142879851 GAGTGGGTGGGACGTGCAGAGGG - Intronic
1033621811 7:143068748-143068770 GAATGAGTGAGGGGAGCTGAGGG - Intergenic
1033867913 7:145714762-145714784 GAATCGGGGAGGAGTGGTGATGG + Intergenic
1034355163 7:150445440-150445462 GAGTGGGTGGGGAGGGGAGAGGG + Intergenic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035922310 8:3690981-3691003 GTGAGGGTGGGGAGTGCTGACGG + Intronic
1036082060 8:5567966-5567988 CAGTGGCTGAGGGGTGCTGCTGG + Intergenic
1036562989 8:9913372-9913394 GATTGGCTGAGGAGTCCGGAGGG - Intergenic
1036701952 8:11018850-11018872 GAGTGGGACAGGAGTTCTTAGGG - Intronic
1036989939 8:13580894-13580916 GAGGGGGTGAGGATGGGTGAGGG + Intergenic
1037988680 8:23305518-23305540 GAATGGGTGGGTAGTGCTGGTGG - Intronic
1040857137 8:51960137-51960159 GAGTGGCCATGGAGTGCTGAAGG + Intergenic
1041031450 8:53739925-53739947 GAGTGGGTGAGGAGCGGTGGAGG - Intronic
1041090413 8:54296729-54296751 GAGAGGGCGAGCAGGGCTGATGG + Intergenic
1042510175 8:69603080-69603102 GAGAGGGTGAGAAGAGTTGAAGG + Intronic
1042669585 8:71246916-71246938 AAGAGGGTGGGGAGTGCTGGAGG - Intronic
1042795885 8:72662753-72662775 GAGTGGGACAGGAGGGCTAATGG + Intronic
1045295129 8:100865907-100865929 GAGTGAGTGAGGGGTGATGCTGG - Intergenic
1045488965 8:102655237-102655259 GAGCGGGGGAGGAGTGGGGAGGG - Intronic
1046873024 8:119224686-119224708 GAGTGGGTGGGGAGAGGAGAAGG - Intronic
1047353618 8:124099490-124099512 GAGAGGATGAACAGTGCTGATGG - Intronic
1047947400 8:129895233-129895255 GGGTGGGGGAGGATTGCTTAAGG - Intronic
1048409407 8:134156545-134156567 GAGTGGGTAAGGCGTGCCTAAGG - Intergenic
1049130420 8:140835078-140835100 CAGTGAGTGGGGAATGCTGATGG - Intronic
1049783947 8:144441674-144441696 GCGTGGTCCAGGAGTGCTGATGG - Intronic
1050484143 9:6115840-6115862 GAAAGGGTGAGGGGTGGTGAGGG - Intergenic
1051335743 9:16064404-16064426 GAGAGGGTGAGGGAGGCTGAGGG + Intergenic
1052043547 9:23768595-23768617 CAGTGGGTGAGGGTGGCTGATGG - Intronic
1052463488 9:28798430-28798452 GAGTGTATGAGAACTGCTGATGG + Intergenic
1052999683 9:34571103-34571125 GAGTAGCTGAAGAGTGGTGAGGG - Intronic
1053588485 9:39485478-39485500 GAGTGGATGATGAATGATGAAGG + Intergenic
1053800121 9:41758687-41758709 GAGTGGGTGGGGGGTTATGAAGG - Intergenic
1054145071 9:61556148-61556170 GAGTGGGTGGGGGGTTATGAAGG + Intergenic
1054188549 9:61970839-61970861 GAGTGGGTGGGGGGTTATGAAGG - Intergenic
1054464767 9:65487105-65487127 GAGTGGGTGGGGGGTTATGAAGG + Intergenic
1054577821 9:66879816-66879838 GAGTGGATGATGAATGATGAAGG - Intronic
1054649972 9:67617778-67617800 GAGTGGGTGGGGGGTTATGAAGG + Intergenic
1054736028 9:68750775-68750797 AAGGGGGTTGGGAGTGCTGAAGG + Intronic
1055000997 9:71448199-71448221 GAGAGGGTGAGAAATGCTGTGGG + Intergenic
1055568677 9:77594349-77594371 GAGTGGCTGGAGAGTGCTGGTGG - Intronic
1056311248 9:85343136-85343158 AAGTGTGTGTGGAGTGGTGATGG - Intergenic
1056772958 9:89492851-89492873 GGGGAGGTGAGGAGTGGTGAGGG - Intronic
1057373748 9:94498816-94498838 GAGAGGCTGAGGTGGGCTGATGG + Intergenic
1058256628 9:102774704-102774726 GAGTTGGAGAGGAGTTATGAAGG - Intergenic
1058447716 9:105068560-105068582 GGGAGGATTAGGAGTGCTGAGGG - Intergenic
1059248519 9:112867720-112867742 GAGGTGGGGAGGAGTTCTGAGGG - Intronic
1059502318 9:114765823-114765845 GAGCGGGAGAGGAGTGAAGAGGG - Intergenic
1060286039 9:122253463-122253485 TAGTGGTTGAGGTGTCCTGATGG - Intronic
1060752550 9:126182884-126182906 GGCTGGGTGAGGAGTGATGTGGG + Intergenic
1061874214 9:133535850-133535872 GAGGGGGTGGGGAGAGCTGAGGG + Intronic
1062562174 9:137146491-137146513 GTCTTGGTGAGGAGTGCAGAGGG - Intronic
1186502197 X:10060428-10060450 GAGGGGGTGGGGGGTGCAGAGGG + Intronic
1188273547 X:28173644-28173666 GGATGGGTGAGGGGTGTTGAGGG - Intergenic
1188309232 X:28596953-28596975 GATTAGGTGAGGCTTGCTGAAGG + Intronic
1188485715 X:30679668-30679690 GAATGGGGGAGGGGTGCAGAGGG - Intronic
1188746272 X:33847878-33847900 GCATTGATGAGGAGTGCTGAGGG + Intergenic
1189462223 X:41252210-41252232 GAGTGGGTGCGGATTGTTAATGG - Intergenic
1189904099 X:45740208-45740230 GAGTGGGGAATGAGTGCTAATGG - Intergenic
1189957391 X:46289139-46289161 CAGTGGGTGTGGACTGGTGATGG + Intergenic
1191029403 X:55951692-55951714 GAGGGGGTGAGGACTGCTTACGG + Intergenic
1192020332 X:67384465-67384487 GAGTGGGGAAGGAGTGGTGATGG - Intergenic
1193886150 X:86985583-86985605 GAGTGAGTGAGTACAGCTGAAGG - Intergenic
1193896922 X:87126427-87126449 GAATGGGAGAGGAGTGGTGATGG - Intergenic
1194580654 X:95666449-95666471 GAGTGGGTGTGCTGTACTGAAGG - Intergenic
1195734821 X:108001242-108001264 GCCTGGGTGTGGAGTGCAGAGGG - Intergenic
1196456169 X:115893024-115893046 GAGTGGCTTGGGAGTGCTGTGGG - Intergenic
1196745366 X:119066977-119066999 GGGTGGGTTAGGAGAGGTGAGGG + Intergenic
1197144426 X:123155774-123155796 GTGTGGGGGAGGTGTGCTGGTGG - Intergenic
1197292043 X:124670463-124670485 GAGTGGCTGAGGAGAGTAGAGGG - Intronic
1197838241 X:130718105-130718127 GAGTGGAGGAGGGGTGGTGAGGG - Intronic
1199872572 X:151912638-151912660 GATTGGGTTAGGAGTGTGGAAGG - Intronic
1199904078 X:152206754-152206776 CAGTGGGTGAGCATTGCTGCTGG - Intronic
1202047106 Y:20746293-20746315 GTGTGTGTGAAGAATGCTGAAGG + Intergenic