ID: 1169068415

View in Genome Browser
Species Human (GRCh38)
Location 20:2707347-2707369
Sequence GCTTCTGGGCAGAGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1663
Summary {0: 1, 1: 1, 2: 6, 3: 100, 4: 1555}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169068415 Original CRISPR GCTTCTGGGCAGAGGGAGGC TGG Intronic
900261390 1:1731791-1731813 GCTTCTCGGGAGACTGAGGCAGG + Intronic
900474431 1:2869557-2869579 GATTTAGGCCAGAGGGAGGCCGG - Intergenic
900611343 1:3545820-3545842 GCTTGTGGCCAGCGGGAGGCTGG - Intronic
900672094 1:3860780-3860802 GCTGGTGGGCAGGGGTAGGCAGG - Intronic
900827827 1:4940816-4940838 GCCTCTGTGCAGAGTGAGGTGGG - Intergenic
900939186 1:5786906-5786928 GCTGGTGTGCAGAGGAAGGCAGG - Intergenic
900978678 1:6034097-6034119 CCTTTAGCGCAGAGGGAGGCAGG - Intronic
900989598 1:6092274-6092296 GGATCTGGGCAGAAGCAGGCTGG - Intronic
901049054 1:6417141-6417163 CCCTCTGGGCACAGGGAGGTGGG + Exonic
901125808 1:6927980-6928002 GATTGTGGGAGGAGGGAGGCAGG - Intronic
901221857 1:7587935-7587957 CCATCTGGGCCGAGGGAGGCGGG - Intronic
901305750 1:8231547-8231569 GCTACTGGGGAGGGTGAGGCAGG + Intergenic
901491228 1:9597365-9597387 GTCCCTGGGCAGAGGGAGGAAGG + Intronic
901633761 1:10660199-10660221 GCTGCTGGGCAGCCGCAGGCCGG + Exonic
901646688 1:10720702-10720724 CCATCTGGGGAGAGGGAGGACGG + Intronic
902041960 1:13499208-13499230 GCTACTCGGGAGATGGAGGCAGG - Intronic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902602881 1:17551979-17552001 GCTTCTGGGCAGGAGGAGCTGGG + Intronic
902684094 1:18064605-18064627 GATGCTGGGCAGGGGGAGGAGGG - Intergenic
902705044 1:18198900-18198922 GCATCTGGGCAGAGGGGGCAGGG - Intronic
902749283 1:18495899-18495921 GGTTAGGGGCAGAGGCAGGCCGG - Intergenic
902906364 1:19560853-19560875 GCTACTGGGCAGGCTGAGGCAGG + Intergenic
902982781 1:20137882-20137904 GCAGCTGGGCAGAGGAAGGGTGG + Intergenic
903080242 1:20805101-20805123 GCTACTGGGGAGGGTGAGGCAGG + Intergenic
903162668 1:21500502-21500524 GCTACTCGGGAGAAGGAGGCAGG + Intergenic
903271372 1:22190452-22190474 GCATCTGGGCAGATGGAGGACGG + Intergenic
903447368 1:23431044-23431066 CCTTCTGGGCAGAGGCTGCCTGG + Exonic
903512954 1:23890145-23890167 GCTACTGGGGAGACTGAGGCAGG + Intronic
903539354 1:24088103-24088125 GTCTCTGGGCAGATGGAGGGTGG + Intronic
903541033 1:24096448-24096470 ACGGGTGGGCAGAGGGAGGCAGG + Intronic
903622417 1:24707571-24707593 CCTGGTGGGCAGAGGGAGCCAGG + Intergenic
903647939 1:24905952-24905974 GCTCCTGGGCTCAGAGAGGCTGG + Intronic
904096628 1:27983765-27983787 GCTACTGGGGAGACTGAGGCAGG - Intronic
904175216 1:28622913-28622935 GCTACTGGGGAGACTGAGGCAGG + Intronic
904403997 1:30274521-30274543 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
904461022 1:30679858-30679880 GCTCCTGGACAGAAGGTGGCAGG + Intergenic
904494584 1:30879480-30879502 CTTTCTGGGCAGAGGGGAGCTGG - Intronic
904515819 1:31053980-31054002 GCTACTGGGGAGACTGAGGCAGG + Intronic
904529253 1:31157355-31157377 GCTACTCGGGAGACGGAGGCAGG - Intergenic
904567445 1:31436060-31436082 GGCTCAGGGCAGAGGGAGTCGGG + Intergenic
904929517 1:34075260-34075282 TCTTGTGGGCAGAAGGAGGCTGG - Intronic
905135240 1:35794365-35794387 GCTACTGGGGAGACTGAGGCAGG - Intergenic
905302874 1:36997625-36997647 GCTTCTGGGGAAAGTGAGGGTGG + Intronic
905361759 1:37425771-37425793 GCTACTGGGGAGACTGAGGCAGG - Intergenic
905383499 1:37581774-37581796 GCTACTGGGGAGACTGAGGCAGG - Intronic
905438604 1:37977725-37977747 GCTACTCGGGAGAGTGAGGCAGG + Intronic
905570171 1:38997602-38997624 GCTACTCTGCAGGGGGAGGCGGG - Intronic
905877486 1:41442101-41442123 GCTACTCGGGAGGGGGAGGCAGG + Intergenic
906282144 1:44561803-44561825 GCTACTGGGGAGAGTGAGGCAGG + Intronic
906290810 1:44618126-44618148 GCTGTTGGGCAAAGGGAGGCAGG - Intronic
906345354 1:45011174-45011196 GCTTCTTGGCAGAGGCAGCGCGG - Exonic
906622759 1:47297697-47297719 GCTGCTTGGGAGAGTGAGGCAGG - Intronic
906689684 1:47784414-47784436 GGGGCTGGGCAGAGGGAGGAGGG + Intronic
907020180 1:51059519-51059541 GCTCCTGGGCAGAAAGGGGCAGG + Intergenic
907024379 1:51101061-51101083 GCTACTTGGAAGAGTGAGGCGGG + Intergenic
907187610 1:52622469-52622491 GCTACTGGGGAGATTGAGGCAGG - Intergenic
907214001 1:52846957-52846979 GCTGCTGGGGAGACTGAGGCAGG - Intronic
907369651 1:53992657-53992679 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
907550107 1:55298011-55298033 GCTACTGGGGAGACTGAGGCTGG - Intergenic
907736219 1:57115197-57115219 GCTTCGGGGCAGACAGATGCAGG + Intronic
907811407 1:57874331-57874353 GCTTCCTGGCAGGGTGAGGCAGG + Intronic
907815983 1:57918710-57918732 GCTACTTGGCAGACTGAGGCAGG + Intronic
907899147 1:58721477-58721499 GCTCCTGGTCAGAGGCAGCCTGG + Intergenic
908154711 1:61341173-61341195 GCTACTCGGCAGGCGGAGGCAGG - Intronic
908640585 1:66218603-66218625 TCTTCTGGGCTGGGGGTGGCTGG - Intronic
908702730 1:66919965-66919987 AATTCTGGGCAGAAGAAGGCAGG + Intronic
908874575 1:68656711-68656733 GCTACTTGGGAGAGTGAGGCAGG + Intergenic
908895782 1:68897019-68897041 GCTACTAGGCAGACGGAGGTGGG - Intergenic
908999123 1:70197387-70197409 GCTACTTGGAAGACGGAGGCAGG - Intronic
909238327 1:73180855-73180877 GCTCCTGGGCAGAAGGGGGCGGG - Intergenic
909472407 1:76043260-76043282 GCTACTGGGGAGACTGAGGCAGG + Intergenic
909570242 1:77101890-77101912 GCTACTTGGGAGGGGGAGGCAGG + Intronic
909763224 1:79320566-79320588 GCTACTGGGAAGGGTGAGGCAGG - Intergenic
909765386 1:79349440-79349462 GCTACTGGGAAGGGTGAGGCAGG - Intergenic
909859636 1:80588565-80588587 GCTACTCGGCAGACTGAGGCAGG + Intergenic
909990684 1:82219762-82219784 GCTACTGGGGAGACTGAGGCAGG - Intergenic
909999161 1:82321617-82321639 GCTTCTTGGGAGACTGAGGCAGG - Intergenic
910250543 1:85193733-85193755 GCTTCTTGGGAGACTGAGGCGGG - Intronic
910252382 1:85211264-85211286 GCTACTCGGGAGAGTGAGGCAGG + Intergenic
910259843 1:85284226-85284248 GCTCCTGGGCAGAAAGGGGCAGG + Intergenic
910263092 1:85310498-85310520 GCTTCTCGGGAGGGTGAGGCAGG - Intergenic
910736297 1:90461596-90461618 ACTTGAGGGCAGAGGGAGGGAGG - Intergenic
911275530 1:95853679-95853701 GCTGCTGTGCAGAAGGGGGCAGG + Intergenic
911646027 1:100337888-100337910 GCTACTGGGGAGACTGAGGCAGG + Intergenic
911814924 1:102336155-102336177 GCTTCTTGGGAGACTGAGGCAGG + Intergenic
912025262 1:105162043-105162065 GCTACTCAGGAGAGGGAGGCAGG - Intergenic
912124580 1:106518887-106518909 GCTACTTGGCAGATTGAGGCAGG + Intergenic
912521865 1:110251059-110251081 GCTTCTACCCAGAGGGTGGCAGG + Intronic
913205502 1:116534567-116534589 CCTTCAGGGCAGTGGGCGGCAGG + Intronic
913246697 1:116876140-116876162 GCTTCTTGGCAGGCTGAGGCAGG - Intergenic
913269594 1:117080119-117080141 GCTACTGGGGAGGGTGAGGCAGG - Intronic
913553088 1:119936069-119936091 GCTTAGGGGTAGAGGGAGGTGGG + Intronic
913669680 1:121084743-121084765 GCTACTGGGCAGGCTGAGGCAGG + Intergenic
914021438 1:143872142-143872164 GCTACTGGGCAGGCTGAGGCAGG + Intergenic
914343312 1:146777796-146777818 GCTACTTGGGAGAGTGAGGCAGG - Intergenic
914644496 1:149640743-149640765 GCTACTGGGCAGGCTGAGGCAGG - Intergenic
914659928 1:149780060-149780082 GCTACTGGGCAGGCTGAGGCAGG + Intergenic
914723579 1:150309106-150309128 GCTTCTGGGGAGGCTGAGGCAGG - Intergenic
914847966 1:151293242-151293264 GCATGTGGGCAGAGGAAGGAAGG + Intronic
915198925 1:154211966-154211988 GCTTCTGGGGAGGCTGAGGCAGG - Intronic
915249741 1:154579539-154579561 GTTTCCGGGCAGAGTCAGGCAGG + Exonic
915281488 1:154825475-154825497 GCTGCTGGGGAGACTGAGGCAGG - Intronic
915373199 1:155369333-155369355 GCTACTGGGCAGGCTGAGGCAGG + Intronic
915624676 1:157107335-157107357 ACTACTGGGCAGAGGGAGGCAGG - Intergenic
915983404 1:160438271-160438293 TCCTCTGGGCAGAAGGAGGGAGG - Intergenic
916199428 1:162256030-162256052 GCTACTGGGGAGACTGAGGCAGG + Intronic
916235396 1:162583086-162583108 GCTACTGGGGAGGGTGAGGCAGG - Intronic
916344749 1:163775276-163775298 GGGGCTGGGGAGAGGGAGGCTGG + Intergenic
916796107 1:168168995-168169017 GCTACTGGGGAGACTGAGGCAGG - Intergenic
917050215 1:170914467-170914489 GCTGCTGGGGAGGGTGAGGCAGG - Intergenic
917120224 1:171638982-171639004 GCTTCTTGGGAGACTGAGGCAGG + Intronic
917425290 1:174906514-174906536 GCTACTGGGGAGGGTGAGGCAGG + Intronic
917614454 1:176725889-176725911 GCTACTAGGGAGAGTGAGGCGGG - Intronic
917733386 1:177898541-177898563 GCTTAGTGGCACAGGGAGGCAGG + Intergenic
917889637 1:179422873-179422895 GCTACTTGGGAGATGGAGGCAGG - Intronic
917897040 1:179501598-179501620 GCTACTGGGGAGGGTGAGGCAGG + Intronic
918014837 1:180623340-180623362 GCTTCTTGGGAGGGTGAGGCAGG - Intergenic
918045858 1:180940821-180940843 GCTACTCGGGAGATGGAGGCGGG - Intronic
918317485 1:183334176-183334198 GCTACTCGGAAGAGTGAGGCAGG - Intronic
918834333 1:189441009-189441031 GCTACTCGGCAGACTGAGGCAGG - Intergenic
919239183 1:194889553-194889575 GCTCCTGGGCAGAAGGAGGCAGG + Intergenic
919298003 1:195725015-195725037 GCTTCTGGGGAGGCTGAGGCAGG + Intergenic
919513468 1:198494250-198494272 GCTCCTGGGCAGAAGGGGGTTGG - Intergenic
919729317 1:200902745-200902767 GCTGCTGAGCAGTGTGAGGCTGG - Intronic
919767892 1:201139105-201139127 GCTTCTGGGCAGACTGAAGAGGG - Intronic
919825541 1:201500648-201500670 TCTTGTGGGCAGAGGGGGACAGG - Intronic
919901761 1:202048929-202048951 GCTTTTAGGCAGAGAGAGGGCGG + Intergenic
920158071 1:203972177-203972199 GCTACTTGGGAGAGTGAGGCAGG + Intergenic
920250065 1:204617557-204617579 GCCTCTGGGCAGAGAGAAGATGG + Exonic
920300503 1:204985888-204985910 CCTTCGGGACAGAGGCAGGCTGG - Intronic
920653461 1:207855979-207856001 GCTTGTTGGCAGAAGGAGGTTGG - Intergenic
921579369 1:216877513-216877535 GCTACTCGGGAGACGGAGGCAGG - Intronic
921706000 1:218323603-218323625 GCTTCTGGGTAGAAGGGGGAGGG - Intronic
921792157 1:219302426-219302448 GCTTCTGGGCTGTGGAAAGCAGG - Intergenic
921974445 1:221186967-221186989 GCTACTGGGGAGACTGAGGCAGG - Intergenic
922041703 1:221903889-221903911 GCTCCTGGGCAGAAGGGGGAGGG - Intergenic
922755332 1:228093445-228093467 ACATATGGGCAGAGGGTGGCTGG - Intronic
922821327 1:228487601-228487623 GCTTCTGGGCCGAGGAGGACGGG + Exonic
923107519 1:230866100-230866122 GCTCCTGGGCACAGGGATGATGG - Intronic
923572370 1:235128060-235128082 GCTACTGGGGAGACTGAGGCAGG + Intronic
923758060 1:236811990-236812012 GCTACTGGGGAGAGTGAGACAGG - Intronic
923829203 1:237536601-237536623 GCTACTGGGGAGACTGAGGCAGG + Intronic
924102044 1:240613938-240613960 TCTTCTGTGCAAAGGCAGGCAGG - Intergenic
924163105 1:241254086-241254108 GCTACTGGGAAGACTGAGGCAGG + Intronic
924277092 1:242400054-242400076 GCTACTTGGCAGCGTGAGGCAGG + Intronic
924294239 1:242569319-242569341 GCTTCTGGGGAGGCTGAGGCAGG - Intergenic
924458580 1:244237959-244237981 GCTACTGGGGAGACTGAGGCAGG + Intergenic
924802235 1:247335814-247335836 GCATCTGGGCAGGGAGAGCCTGG + Intergenic
924851667 1:247837328-247837350 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1062911124 10:1213015-1213037 GCTTTGGGGAAGAGGGAGGGAGG + Intronic
1063170642 10:3506934-3506956 GCAACTGGGCACAGTGAGGCCGG + Intergenic
1064036375 10:11916622-11916644 GCTACTCGGGAGAGTGAGGCAGG + Intergenic
1064278251 10:13927143-13927165 GCTACTGGGGAGGTGGAGGCAGG + Intronic
1064401498 10:15025033-15025055 GCTACTAGGGAGGGGGAGGCAGG + Intergenic
1064540617 10:16401878-16401900 GCTTCTCAGGAGATGGAGGCAGG - Intergenic
1064637731 10:17386425-17386447 GCTACTGGGGAGACTGAGGCAGG + Intronic
1065026420 10:21543230-21543252 GCTACTGGGGAGACTGAGGCAGG - Intronic
1065183350 10:23148690-23148712 GCTACTGGGGAGACAGAGGCAGG - Intergenic
1065479448 10:26177648-26177670 TCTTCTGGGCAGAGGTCAGCAGG - Intronic
1065684510 10:28270437-28270459 GTTTCTTGGCAGACAGAGGCAGG + Intronic
1065942002 10:30573461-30573483 GCTACTCGGGAGATGGAGGCAGG - Intergenic
1066087133 10:31981920-31981942 GCTACTCGGCAGACTGAGGCAGG + Intergenic
1066312528 10:34211666-34211688 GCTACTGGGGAGCGTGAGGCAGG + Intronic
1066994678 10:42552725-42552747 GCTTCGGGGCAGAGGATGCCGGG - Intergenic
1067459531 10:46447467-46447489 GCTTCTGGGTGGTGGGGGGCAGG + Intergenic
1067552938 10:47247848-47247870 CCTGAGGGGCAGAGGGAGGCAGG + Intergenic
1067627659 10:47937146-47937168 GCTTCTGGGTGGTGGGGGGCAGG - Intergenic
1067792693 10:49299798-49299820 CATTCAGGGCTGAGGGAGGCTGG + Intronic
1068628738 10:59277886-59277908 GCTGCTGAGTAGAGGGTGGCTGG - Intronic
1068630374 10:59291443-59291465 GCTCCTGAACAGAGGGAAGCTGG - Intronic
1068988916 10:63131556-63131578 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1069396342 10:67993405-67993427 GCTACTTGGGAGAGTGAGGCAGG + Intronic
1069480192 10:68774517-68774539 GCTTCTGGGGAGGCTGAGGCGGG + Intronic
1069619393 10:69827280-69827302 CCTACTGGACAGAGGGAGCCGGG - Intronic
1070117461 10:73542617-73542639 GCTACTTGGGAGATGGAGGCAGG + Intronic
1070175112 10:73963454-73963476 GCTACTTGGCAGATCGAGGCAGG - Intergenic
1070265587 10:74899383-74899405 GCTACTGGGGAGGGTGAGGCAGG - Intronic
1070714945 10:78712994-78713016 GCTACTGGGCAGGCTGAGGCAGG - Intergenic
1070972890 10:80582164-80582186 TCTTCTGGCCAGAGGGAGGGAGG - Intronic
1071015066 10:80987474-80987496 GCTTCTGGGGAGGCTGAGGCAGG - Intergenic
1071957052 10:90770805-90770827 GCTCCTGGGCAGAAGGCGGTGGG + Intronic
1072041974 10:91615271-91615293 ACTTCTGGGTAGAGGGATGGAGG - Intergenic
1072338240 10:94419555-94419577 GCTTCTCGGGAGACTGAGGCAGG + Intronic
1072623813 10:97098368-97098390 GCTGCTAGGCAGAGAGGGGCAGG + Intronic
1072735369 10:97875603-97875625 GGCCCTGGGCACAGGGAGGCAGG + Intronic
1072871362 10:99124402-99124424 GCTTCTGGGCAGAAAGTGGTGGG - Intronic
1072963971 10:99955514-99955536 TCTGCTGTGCTGAGGGAGGCAGG + Exonic
1073068976 10:100781509-100781531 GCTCCTGGAGAGAGGGAGGGTGG + Intronic
1073219886 10:101862463-101862485 GCTACTGGGGAGACTGAGGCAGG + Intronic
1073246680 10:102095451-102095473 GCTACTGGGGAGGGTGAGGCAGG - Intergenic
1073265570 10:102226415-102226437 ACTCCTGGGCAAAGGGAGGAGGG - Exonic
1073598088 10:104819627-104819649 TGTGCTGGGCAGTGGGAGGCAGG + Intronic
1073968719 10:109021798-109021820 GCTTGTGGGCAGAGGATCGCAGG - Intergenic
1074173781 10:110975265-110975287 GCTACTGGGGAGACTGAGGCAGG - Intronic
1074206418 10:111286895-111286917 GCTGCTGGGGAGACTGAGGCAGG - Intergenic
1074301838 10:112240456-112240478 GCTCCTGGGCAGAAAGGGGCGGG - Intergenic
1074377835 10:112952874-112952896 GCTTCTTAGAAGAGGGAGGGAGG - Intronic
1074426128 10:113353068-113353090 GCTACTTGGCAGGGTGAGGCAGG + Intergenic
1074432633 10:113406888-113406910 GCTTCTGTGCAGTGTGGGGCTGG + Intergenic
1074531605 10:114302218-114302240 GCTGCTGGGCAGAGTGGGGTGGG + Intronic
1074715618 10:116215874-116215896 GCTGGTGGGGAGAGGGAGCCGGG - Intronic
1074750409 10:116580383-116580405 GCTACTGGGGAGGGTGAGGCAGG + Intergenic
1074972511 10:118550719-118550741 GCAACTGGGCAGAGGCAGACAGG + Intergenic
1075077928 10:119363682-119363704 GCCTCTGGGAAGAGGGAAGCTGG + Intronic
1075207024 10:120457010-120457032 GCTCCTGGGGAGAGGGATCCGGG + Exonic
1075315934 10:121453628-121453650 GGTTGTGGGCAGTGTGAGGCAGG + Intergenic
1075317994 10:121467459-121467481 CCTTCTCGGCAGGGTGAGGCAGG + Intergenic
1075962427 10:126580884-126580906 ACTTATGGGTAGAGGGAGGGAGG - Intronic
1076061252 10:127416043-127416065 GCAGCTGGGCAGAGAGATGCCGG - Intronic
1076502696 10:130949704-130949726 GGTGCGGGGCAGAGGGAGGCTGG - Intergenic
1076664298 10:132077284-132077306 GGTTCTGGGCAGGGGGTGTCCGG + Intergenic
1076692371 10:132230406-132230428 GCGCCTGTGCAGAGTGAGGCTGG - Intronic
1076766845 10:132640430-132640452 TCTTCTGGCCAGAGAGAGGGTGG + Intronic
1077002029 11:328267-328289 GCCTCTGGGCAGTGGGCAGCGGG + Intergenic
1077235289 11:1479191-1479213 GCTCCTGGGCAGACGGGGCCTGG - Intronic
1077341198 11:2027150-2027172 GACCCTGGGCAGAGGGAGACAGG + Intergenic
1077393922 11:2311996-2312018 GCTGCTTGGCAGAGCCAGGCAGG + Intronic
1077867486 11:6234907-6234929 GCCTCTGGGAAGGTGGAGGCCGG + Intronic
1077971174 11:7192729-7192751 GCTACTCGGGAGAGTGAGGCAGG - Intergenic
1078086906 11:8239391-8239413 GCTTCTGGGCAGAGCCAGCAAGG + Intronic
1078243188 11:9549104-9549126 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1078250648 11:9614047-9614069 GCGTCTGGGGAGAGCGGGGCGGG + Intergenic
1078519568 11:12052332-12052354 GGTTCTTAGAAGAGGGAGGCAGG + Intergenic
1078623833 11:12935147-12935169 GCTACCTGGCAGAGGGACGCAGG + Intronic
1078695819 11:13630441-13630463 GCTTCTGGGGAGGCTGAGGCAGG - Intergenic
1079068974 11:17326427-17326449 GCTACTCGGGAGGGGGAGGCAGG - Intronic
1079074374 11:17374647-17374669 GGTTCTGGGGAGAGGAAGGGAGG - Exonic
1079098581 11:17526902-17526924 GCTTCTGGGCCAGTGGAGGCTGG - Intronic
1079300958 11:19278584-19278606 TGTTCTGGCCAGAGGGATGCTGG - Intergenic
1079561765 11:21829906-21829928 GCTACTCGGGAGAGTGAGGCAGG + Intergenic
1079818557 11:25094583-25094605 GCTACTGGGCACAGCCAGGCTGG + Intergenic
1079850318 11:25525219-25525241 GCTACTGGGGAGGGTGAGGCAGG - Intergenic
1080384967 11:31805670-31805692 GGGTCTGGGCAGAGGAAAGCAGG + Intronic
1080565421 11:33504876-33504898 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1081152811 11:39652697-39652719 GATTCTGGGCAGACAGCGGCGGG - Intergenic
1081178981 11:39964777-39964799 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1081580226 11:44346867-44346889 GCATGAGGGCAGAGGGAGGGAGG - Intergenic
1081973000 11:47212995-47213017 GTTTCTGCGAAGAGGCAGGCAGG - Intergenic
1082652838 11:55815616-55815638 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1082782520 11:57298837-57298859 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1082859038 11:57836094-57836116 GCTACTTGGCAGACTGAGGCAGG + Intergenic
1083022833 11:59524797-59524819 GCTACTTGGCAGGCGGAGGCAGG - Intergenic
1083202884 11:61131081-61131103 CCCTCTGGCCAGAGGGAAGCGGG - Exonic
1083268086 11:61556253-61556275 GGCTCTGGGCTGAGGGAGGGTGG - Intronic
1083438523 11:62660076-62660098 GCTACTGGGGAGACTGAGGCGGG + Intronic
1083695223 11:64438133-64438155 GCTACTCGGGAGAGTGAGGCAGG - Intergenic
1083722273 11:64609250-64609272 GGTTCTGGGGAGGGGGAGGGGGG - Intronic
1083749738 11:64754455-64754477 GGCTGTGGGCAGAGGCAGGCCGG + Intronic
1083770485 11:64864289-64864311 CCTTCTGGGCACAGGGAACCTGG - Intronic
1083881768 11:65552452-65552474 GCAGCTGGGCAGAGGGACGTGGG - Intronic
1083890014 11:65591270-65591292 GCTTCTGGGAAGGCTGAGGCAGG + Intronic
1084088393 11:66865232-66865254 GCTTCTGAGACAAGGGAGGCTGG - Intronic
1084194072 11:67513929-67513951 GCTACTGGGGAGGCGGAGGCAGG - Intergenic
1084422456 11:69067139-69067161 GCTACGGGGCAGAGGCAGGAGGG - Intronic
1084481085 11:69420633-69420655 GATTCTGGGCAGGGTGAAGCCGG + Intergenic
1084563371 11:69916226-69916248 GGGTCTGGGCAGAGTGAGGCTGG + Intergenic
1084563682 11:69918067-69918089 GCTTCCTGTAAGAGGGAGGCAGG - Intergenic
1084623348 11:70289077-70289099 GCTACTTGGGAGAGTGAGGCAGG - Intronic
1084964285 11:72736352-72736374 GCTACTGGGGAGGGGGAGGTGGG - Intronic
1085070745 11:73542583-73542605 GCTTCTGGGAAGAGAGAGACAGG - Intronic
1085097219 11:73771248-73771270 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1085148130 11:74222598-74222620 GCTACTGGGGAGACTGAGGCAGG - Intronic
1085334246 11:75678977-75678999 GCTTCTGGGCAGAAAGTGGCGGG - Intergenic
1085357541 11:75853020-75853042 GCTACTTGGGAGATGGAGGCAGG - Intronic
1085417324 11:76328071-76328093 GGCTCTGGGCAGAGGCTGGCGGG + Intergenic
1085523400 11:77151068-77151090 GCTCCTGGGGACAGGGAAGCTGG - Intronic
1085634768 11:78150162-78150184 GCTACTGGGAAGAATGAGGCAGG - Intergenic
1086342929 11:85865774-85865796 GCTTCTCGGGAGACTGAGGCAGG + Intronic
1086468756 11:87084417-87084439 GCTACTGGGGAGACTGAGGCAGG - Intronic
1087034518 11:93742393-93742415 GCTACTGGGGAGACTGAGGCAGG - Intronic
1087572360 11:99944943-99944965 GCAACTGGGCAGAGGAAGGTGGG + Intronic
1087688069 11:101287703-101287725 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1087798844 11:102482290-102482312 GCTTCTTGGGAGGGTGAGGCAGG + Intronic
1087900581 11:103636058-103636080 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1087944221 11:104138871-104138893 TCTTCTGGGGAGACTGAGGCAGG - Intronic
1087979016 11:104587513-104587535 GCTACTCGGCAGACTGAGGCAGG + Intergenic
1088649284 11:111943253-111943275 GCTACTGGGGAGACTGAGGCAGG - Intronic
1088933177 11:114372646-114372668 GCTACTGGGCAGGCTGAGGCAGG + Intergenic
1088986413 11:114913267-114913289 ATTTGTGGGCAGAGAGAGGCAGG + Intergenic
1089230232 11:116967819-116967841 CCTGATGGGCACAGGGAGGCTGG - Intronic
1089390371 11:118097880-118097902 GCTACTTGGAAGACGGAGGCAGG - Intronic
1089399677 11:118157216-118157238 GGCTCTGGGCAGAGGCAGGTAGG + Intergenic
1089422623 11:118343055-118343077 GCTTCTTGTCAGTGGGAGGTTGG + Intergenic
1089463216 11:118665197-118665219 GGATCTGGGAAGAGGGAGGGCGG + Intronic
1089476374 11:118766320-118766342 GCTTCTGGGGAGGCTGAGGCAGG + Intronic
1089539797 11:119182949-119182971 GCTGCTGGCCAGTGGGAGGCAGG - Intronic
1089548962 11:119255246-119255268 ACTCCTGGCCAGAGGGAGGGAGG + Intronic
1089644259 11:119868010-119868032 GTTTCTGGCCAGATGGAGGCAGG + Intergenic
1089713606 11:120336106-120336128 CCTACGGGGCAGAGGGAGGTGGG - Intergenic
1089958218 11:122592397-122592419 GCTACTTGGGAGATGGAGGCAGG + Intergenic
1090049514 11:123365361-123365383 GCTCCTGGGGAGACTGAGGCAGG - Intergenic
1090137057 11:124209812-124209834 GCTCCTGGGCAGAAGGTGGCGGG - Intergenic
1090281160 11:125457069-125457091 GCTATTCGGCAGAGTGAGGCAGG + Intronic
1090441539 11:126728937-126728959 CTTTCGGGGCAGAGGGAGGAGGG + Intronic
1090514678 11:127412432-127412454 GCTCCTGGGCAGGAGGAGGTGGG - Intergenic
1090568322 11:128020099-128020121 GCTTCTGGGGAGGCTGAGGCAGG + Intergenic
1090709679 11:129373908-129373930 GCTTCTCGGGAGACTGAGGCAGG + Intergenic
1090901207 11:131033381-131033403 GATGCTCTGCAGAGGGAGGCAGG - Intergenic
1091039065 11:132259858-132259880 GCTTCTTGGCAGGCTGAGGCAGG - Intronic
1202824183 11_KI270721v1_random:82339-82361 GACCCTGGGCAGAGGGAGACAGG + Intergenic
1091454947 12:599948-599970 GCAGCTGGGCAGAAGGAGGCGGG - Intronic
1091526166 12:1303525-1303547 GCTGCTGGGGAGACTGAGGCAGG + Intronic
1091550004 12:1530148-1530170 GCTTAGGGGCCGAGGGAGCCGGG + Intronic
1091601052 12:1918012-1918034 GCTCCTGGGGAGAGGCAGGTGGG + Intronic
1091711500 12:2743688-2743710 GCTGCTGTGCAAAGGCAGGCGGG + Intergenic
1091731035 12:2880503-2880525 GCTACTTGGGAGAGTGAGGCAGG + Intronic
1091770323 12:3147231-3147253 GCTGCTGGGCAGCAGGAGGCAGG + Intronic
1091918960 12:4289309-4289331 GCTGCCGGGCAGAGGCAGCCTGG - Intronic
1092118623 12:6027517-6027539 GGGTCTGATCAGAGGGAGGCAGG + Intronic
1092355543 12:7792004-7792026 GCTACTGGGGAGACTGAGGCAGG - Intronic
1092464860 12:8721853-8721875 GCTACTTGGGAGAGTGAGGCAGG - Intronic
1092493947 12:8973024-8973046 CCAGCTGGGCTGAGGGAGGCTGG + Intronic
1092508083 12:9124799-9124821 ACTCCTGGGCAGAAGGGGGCAGG + Intergenic
1093033599 12:14312178-14312200 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1093194723 12:16116676-16116698 GCTTCTCGGGAGACTGAGGCAGG - Intergenic
1093286995 12:17276022-17276044 GCTACTGGGCAGGCAGAGGCAGG + Intergenic
1093359386 12:18203990-18204012 GCTTCTGGGGAGGCTGAGGCAGG + Intronic
1093493030 12:19726162-19726184 GCTCCTGGGCAGAAGGAGGTGGG - Intergenic
1093507181 12:19881568-19881590 GCTACTCGGCAGACTGAGGCAGG + Intergenic
1094021691 12:25921398-25921420 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1094215776 12:27940462-27940484 GCTACTCAGCAGATGGAGGCAGG - Intergenic
1094515962 12:31126828-31126850 GCTACTCGGAAGATGGAGGCAGG - Intergenic
1094657226 12:32432169-32432191 GCTGCTGGGGAGACTGAGGCAGG - Intronic
1095460156 12:42434803-42434825 GCTACTGGGGAGGGTGAGGCAGG - Intronic
1095995059 12:48075102-48075124 GCTACTGGGGAGACTGAGGCAGG + Intronic
1096100355 12:48967275-48967297 GCTACTGGGGAGACTGAGGCAGG - Intronic
1097274770 12:57805473-57805495 ACTTCTATGCAGATGGAGGCTGG - Intronic
1097572921 12:61356152-61356174 GCTCCTGGGCAGACGGGGGTAGG - Intergenic
1097632363 12:62079550-62079572 GCTACTCGGGAGACGGAGGCAGG + Intronic
1097895842 12:64824505-64824527 GCTTCTGGGCACGGGGGAGCTGG + Intronic
1098439703 12:70504653-70504675 GCTCCTGGGCAGGGGAAGGACGG - Intergenic
1098543705 12:71687443-71687465 GCTACTTGGGAGATGGAGGCAGG + Intronic
1098553222 12:71788036-71788058 GCTACTTGGGAGAGTGAGGCAGG + Exonic
1098899597 12:76099420-76099442 GCTGCTGGGGAGACTGAGGCAGG - Intergenic
1098933073 12:76443618-76443640 GCTACTGGGGAGACTGAGGCAGG - Intronic
1098951574 12:76645308-76645330 GCTCCTGGGCAGAAGGGGGCGGG + Intergenic
1099065051 12:77965505-77965527 GCTACTTGGGAGAGTGAGGCCGG + Intronic
1099127380 12:78779875-78779897 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1100050124 12:90438276-90438298 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1100369412 12:93953840-93953862 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1100672869 12:96835500-96835522 GTTCCTGGGCAGAAGGGGGCAGG - Intronic
1100981641 12:100166938-100166960 GCTTTGGGGCAGAGGGAGAGAGG - Intergenic
1101709073 12:107248151-107248173 GATTCTGGGCAGAGGTTAGCTGG - Intergenic
1101782308 12:107846634-107846656 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1101888504 12:108690356-108690378 GCTGCTGGGGAGAGGGAGTATGG + Intronic
1101957681 12:109225237-109225259 GCTACTGGGGAGGGTGAGGCAGG - Intronic
1102077636 12:110072834-110072856 GCGTGTGGGCAGGTGGAGGCAGG + Intronic
1102142256 12:110624687-110624709 GCTGCTGGGGAGACTGAGGCAGG - Intronic
1102201234 12:111059408-111059430 GCTTCTTGGCAGAGATAGCCAGG + Intronic
1102365707 12:112332423-112332445 GCTACTGGGGAGGGTGAGGCAGG + Intronic
1102823801 12:115929239-115929261 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1102991386 12:117318733-117318755 TGTGCTGGGCACAGGGAGGCGGG + Intronic
1103057339 12:117832170-117832192 GCTACTGGGGAGGGTGAGGCAGG + Intronic
1103092606 12:118108044-118108066 GCTACTTGGGAGACGGAGGCAGG - Intronic
1103135141 12:118500455-118500477 GCTGCTGTGCTGTGGGAGGCGGG + Intergenic
1103307047 12:119973474-119973496 GCTACTGGGAAGACTGAGGCAGG + Intergenic
1103355258 12:120315111-120315133 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1103364720 12:120373380-120373402 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1103498634 12:121382727-121382749 GCTGCTGGGGAGACTGAGGCAGG + Intronic
1103610909 12:122123809-122123831 GCTACTGGGGAGACTGAGGCAGG - Intronic
1103631932 12:122268505-122268527 GCTGCTGGGGAGACTGAGGCAGG - Intergenic
1103741508 12:123094646-123094668 GCATCTGTGCAGATGGAGGACGG - Intronic
1103828241 12:123757327-123757349 GCTTCTTGGGAGACTGAGGCAGG + Intronic
1103865071 12:124045181-124045203 GCTTCTGAGCAGGGGCAGCCCGG + Intronic
1104110655 12:125701022-125701044 GGGTCTGGGAAGAGGGAGACTGG + Intergenic
1104413070 12:128575365-128575387 GCTACTGGGGAGACTGAGGCAGG + Intronic
1104471424 12:129032889-129032911 CCTTGTGAGCAGAGGGATGCAGG - Intergenic
1104654170 12:130560777-130560799 GCTCTTGGGCATAGGGAGGGAGG - Intronic
1104717974 12:131029334-131029356 GGATCTTGACAGAGGGAGGCAGG - Intronic
1104733390 12:131121490-131121512 GCTACTTGGGAGAGTGAGGCAGG - Intronic
1104778377 12:131404522-131404544 CCTTCTGGACAGAGGCAGTCGGG - Intergenic
1105013280 12:132770119-132770141 GCTACTGGGGAGAATGAGGCAGG + Exonic
1105065739 12:133195827-133195849 GCTACTTGGAAGGGGGAGGCAGG - Intronic
1105069892 12:133227915-133227937 CCCTCTGGGCAGAGGGAGGGGGG + Exonic
1105368948 13:19786009-19786031 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1105713413 13:23035275-23035297 GCTACTTGGGAGAGTGAGGCAGG + Intergenic
1105751806 13:23427692-23427714 GCCTTTTGGCAGAGGGAGGCAGG + Intronic
1105882143 13:24614532-24614554 CCTCCTGGACAGAGAGAGGCAGG + Intergenic
1106088447 13:26563541-26563563 GCTTCTAGGGAGGGTGAGGCAGG + Intronic
1106226520 13:27790668-27790690 TCCGCTGGGCAGAGGCAGGCTGG - Intergenic
1106253535 13:28001894-28001916 GCTCCTGGGCAGAAGGAGTCAGG - Intergenic
1106288984 13:28343409-28343431 GCTACTGGGGAGACTGAGGCAGG - Intronic
1106379514 13:29223089-29223111 GCTTCTGGGCAGAAAGGGGTGGG + Intronic
1106490542 13:30217340-30217362 GCTACTCGGGAGGGGGAGGCAGG + Intronic
1106855468 13:33847011-33847033 GCTACTCGGGAGAGGGAGGTAGG - Intronic
1106970635 13:35137336-35137358 GCTACTGGGGAGACTGAGGCAGG + Intronic
1107833676 13:44396788-44396810 GGTTCTAGGCAGACAGAGGCCGG + Intronic
1107853432 13:44592063-44592085 GCTCCTGGGCAGAAGGGCGCTGG + Intergenic
1108456089 13:50615111-50615133 GCTACTTGGGAGATGGAGGCAGG + Intronic
1108522091 13:51255769-51255791 GCTGCTGCACAGGGGGAGGCTGG + Intronic
1108807806 13:54181413-54181435 ACTTGTGGGCAGAGGGTGGGAGG - Intergenic
1109348449 13:61145460-61145482 GCTCCTGGGCAGAAAGAGGTGGG + Intergenic
1109497282 13:63189680-63189702 GCTACTGGGCAGGCTGAGGCAGG - Intergenic
1109564993 13:64101251-64101273 GCTTCTCGGGAGACAGAGGCAGG - Intergenic
1109839678 13:67905472-67905494 GCTGCTCGGGAGATGGAGGCAGG - Intergenic
1110673105 13:78205797-78205819 GCTACTGGGAAGGGTGAGGCGGG - Intergenic
1111036773 13:82684502-82684524 GCTACTGGGCAGGCTGAGGCAGG + Intergenic
1111925901 13:94463246-94463268 GCTACTGGGGAGACTGAGGCAGG - Intronic
1112292532 13:98157451-98157473 GCTTCTGGAAGGAGGTAGGCAGG - Intronic
1112350299 13:98627557-98627579 GCTACTTGGGAGAGTGAGGCAGG - Intergenic
1112358750 13:98697165-98697187 GCTACTGGGGAGACTGAGGCAGG - Intronic
1112485879 13:99819231-99819253 GCTTCTGGGGAGGCTGAGGCAGG + Intronic
1112643877 13:101307203-101307225 GCTTCTGAGCAGAGCGATGGTGG + Intronic
1112771684 13:102800045-102800067 GCAGCTGGCAAGAGGGAGGCAGG - Intronic
1112853291 13:103733546-103733568 GCTTGTGGGTAGGGGGAGGGTGG + Intergenic
1113135834 13:107087827-107087849 GCTACTTGGCAGACTGAGGCAGG + Intergenic
1113595817 13:111531003-111531025 GTCCCTGGGCAGAGGGAAGCAGG - Intergenic
1113840533 13:113357331-113357353 GCTACTCGGCAGACTGAGGCAGG + Intronic
1113872746 13:113571435-113571457 GCTACTTGGGAGAGTGAGGCAGG + Intergenic
1114084590 14:19230142-19230164 GCTACTCAGCAGACGGAGGCAGG - Intergenic
1114452964 14:22838416-22838438 GCTTCTGGGCCCAGGAAGGGAGG + Intronic
1115014442 14:28593264-28593286 GCTACTGGGCAGGCTGAGGCAGG - Intergenic
1115029298 14:28774981-28775003 GTTGTTGGCCAGAGGGAGGCCGG + Intronic
1115226247 14:31105111-31105133 GCTACTGGGGAGACTGAGGCAGG - Intronic
1115271865 14:31561557-31561579 GCTGCAGGGCAGGGGGAAGCGGG + Intronic
1115777119 14:36727574-36727596 GCTTCTGGGGAGGCTGAGGCAGG + Intronic
1115816798 14:37172292-37172314 GCTTCTCGGCAGATCGTGGCCGG - Exonic
1116159762 14:41253608-41253630 GCTCCTGGGCAGAAAGGGGCAGG - Intergenic
1116845257 14:49859562-49859584 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1116847722 14:49880307-49880329 GCTACTAGGCAGGGTGAGGCAGG + Intergenic
1117185154 14:53232666-53232688 GCTACTGGGGAGGGTGAGGCAGG + Intergenic
1117221265 14:53608883-53608905 CCATCTGGGCAGAGAAAGGCTGG - Intergenic
1117257844 14:53998707-53998729 GAAACTGGGCAGAGGGAGGGGGG - Intergenic
1117474540 14:56080615-56080637 GCTTCTGGGGAGGCTGAGGCAGG + Intergenic
1117561642 14:56946483-56946505 ACTGCTGGGAAGAGGGAAGCAGG - Intergenic
1117678659 14:58181187-58181209 GCTACTGGGGAGGGTGAGGCAGG + Intronic
1117714962 14:58571355-58571377 GCTACTTGGGAGAGTGAGGCGGG - Intergenic
1117892103 14:60435707-60435729 CCTTCTGGGGAGAGCGGGGCAGG + Intronic
1118157890 14:63258585-63258607 GCTGTTGGGGAGAGGGAAGCTGG - Intronic
1118578328 14:67267368-67267390 GCTACTTGGGAGGGGGAGGCAGG - Intronic
1118630722 14:67700026-67700048 GCTCCTTGGGAGATGGAGGCAGG + Intergenic
1118708800 14:68503034-68503056 GCTTCAGGTCAGAGGGAGGAGGG - Intronic
1118716003 14:68560622-68560644 GCTACTCGGGAGAGTGAGGCAGG + Intronic
1118985430 14:70750594-70750616 GCTACTCGGCAGGTGGAGGCAGG - Intronic
1119036156 14:71231725-71231747 ACTCCTGGGCAGAAGGGGGCTGG + Intergenic
1119078412 14:71667951-71667973 GCTTCTGGGGAGGCTGAGGCAGG + Intronic
1119109949 14:71962285-71962307 GTGGCTGGGCAGAGGGAGGCCGG + Intronic
1119197284 14:72726456-72726478 GCTGATGGGCAGAGGGAGGATGG - Intronic
1119389518 14:74281528-74281550 GCCTCTGGGCAGAGGAAGGAGGG - Intergenic
1119593857 14:75916015-75916037 GCTTCTTGGGAGACAGAGGCAGG + Intronic
1119643402 14:76330779-76330801 GCTTGAGGACAAAGGGAGGCAGG + Intronic
1119657949 14:76430938-76430960 GCTGCTGGTCAGAGGGCAGCAGG - Intronic
1119881407 14:78102897-78102919 GATTTTGGGCAGAGGCAGGGTGG - Intergenic
1119923092 14:78465647-78465669 GCTACTCGGGAGAGTGAGGCAGG - Intronic
1120377634 14:83729922-83729944 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1120700996 14:87698652-87698674 GCAGCTGGGCAGAAGGAGCCTGG - Intergenic
1121199361 14:92104809-92104831 GCTACTGGGGAGACTGAGGCAGG + Intronic
1121224443 14:92311017-92311039 GCTGCTGAGAAGCGGGAGGCTGG + Intergenic
1121287927 14:92750900-92750922 GCTACTGGGGAGGGTGAGGCAGG + Intergenic
1121550267 14:94794131-94794153 GCTACTCGGCAGACTGAGGCAGG - Intergenic
1121764380 14:96473280-96473302 GCTGCTGGGGAGACTGAGGCAGG - Intronic
1122073267 14:99219152-99219174 GCTACTGGGGAGGTGGAGGCAGG - Intronic
1122139387 14:99653298-99653320 CCTTCAGGCCAGAGCGAGGCAGG - Intronic
1122161180 14:99785164-99785186 GCTACTGGGGAGACTGAGGCAGG - Intronic
1122325611 14:100879403-100879425 GCCTTAGGGCAGTGGGAGGCGGG - Intergenic
1122635028 14:103125806-103125828 GGGTCTGGGCAGGAGGAGGCTGG + Intronic
1122793816 14:104195678-104195700 GCTTGTGGGGTGAAGGAGGCTGG + Intergenic
1123115864 14:105893762-105893784 GCCTCTGGTCAGCAGGAGGCTGG + Intergenic
1123117889 14:105902872-105902894 GCCTCTGGTCAGCAGGAGGCTGG + Intergenic
1123120106 14:105912477-105912499 GCCTCTGGTCAGCAGGAGGCTGG + Intergenic
1123428060 15:20188755-20188777 GCTTCCAGGCAGATGAAGGCAGG + Intergenic
1123630304 15:22256474-22256496 GCTACTGGGTAGACTGAGGCAGG - Intergenic
1123853229 15:24381584-24381606 GCTTTTGCCCAGAGGAAGGCGGG + Intergenic
1123903394 15:24898474-24898496 GCTACTCGGGAGAGTGAGGCAGG + Intronic
1124024610 15:25953972-25953994 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1124163902 15:27300853-27300875 GCTACTGGGGAGACTGAGGCAGG + Intronic
1124404376 15:29380961-29380983 GCTACTGGGGAGACTGAGGCAGG - Intronic
1124637832 15:31376127-31376149 GCTTCTGGCAAGAAAGAGGCTGG - Exonic
1125015650 15:34931694-34931716 GCTACTGGGGAGACTGAGGCAGG + Intronic
1125044164 15:35227293-35227315 GCTACTGGGGAGACTGAGGCAGG - Intronic
1125153174 15:36556668-36556690 GCTACTTGGGAGAGTGAGGCAGG + Intergenic
1125226085 15:37397707-37397729 GCTTCTGGTCAAAGAGAGTCTGG + Intergenic
1125692463 15:41607447-41607469 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1125711503 15:41790786-41790808 CCATCTGGTCAGAGGTAGGCAGG - Intronic
1125882320 15:43205509-43205531 GCTACTGGGGAGACTGAGGCAGG - Intronic
1125889700 15:43256506-43256528 GCTTGTGGGGAGAGGGAGCAGGG - Intronic
1126129881 15:45330007-45330029 GCTTCTGGGGACACTGAGGCAGG + Intergenic
1126622702 15:50655876-50655898 GCTTCTGGGGAGGCTGAGGCAGG + Intronic
1126635591 15:50776835-50776857 GCTACTGGGGAGGGTGAGGCAGG - Intergenic
1126878286 15:53067476-53067498 GCTGATTGGCAGAAGGAGGCTGG + Intergenic
1127302256 15:57666485-57666507 GATTTGGGGCAGAGGGAGGAGGG - Intronic
1127368206 15:58310839-58310861 GCTTCTGTGCGCTGGGAGGCTGG - Intronic
1127467925 15:59262514-59262536 GCTACTGGGCAGGCTGAGGCGGG + Intronic
1127497033 15:59523135-59523157 ACACCTGGGAAGAGGGAGGCGGG + Exonic
1127548613 15:60014746-60014768 GCTACTGGGGAGGGTGAGGCAGG + Intronic
1127895254 15:63293274-63293296 GCTACTGGGGAGGGTGAGGCAGG - Intronic
1128025123 15:64429203-64429225 GCTTCTGGGGAGGCTGAGGCAGG + Intronic
1128101444 15:65003742-65003764 GCTACTTGGAAGACGGAGGCAGG + Intronic
1128310278 15:66626925-66626947 GCTACTGGGAAGATTGAGGCAGG + Intronic
1128638225 15:69316929-69316951 GCTACTTGGCAGACTGAGGCAGG - Intronic
1128965254 15:72051857-72051879 GCTCCTGGGCAAAAGGAGGCAGG + Intronic
1128975467 15:72149764-72149786 GCTTCTGGGGAGGCTGAGGCAGG + Intergenic
1129207472 15:74045515-74045537 GCCTCTGGGCAGGTGGAGGGTGG - Exonic
1129485171 15:75863752-75863774 GCTACTGGGGAGACTGAGGCAGG - Intronic
1129669396 15:77598727-77598749 GCTGCTGGTAAGAGGGAAGCCGG + Intergenic
1129792357 15:78349839-78349861 GGTTCTGGGCTGGGGGAGGGGGG - Intergenic
1129799960 15:78406141-78406163 GCTCCTGGGTGGAGGGGGGCAGG + Intergenic
1129868465 15:78926097-78926119 GCTTCTGGGTTGGGGGTGGCTGG + Intronic
1130227839 15:82073305-82073327 GTTCCTGGGCAGAAGGAGGTGGG - Intergenic
1130518941 15:84647606-84647628 GCTACTGGGGAGACTGAGGCAGG - Intronic
1130553397 15:84906129-84906151 GCTACTGGGCAGGCTGAGGCAGG - Intronic
1131011190 15:89019743-89019765 TCTTCTGGGCAGAGTGAGATGGG + Intergenic
1131025834 15:89140890-89140912 GTCTCTGGGCAAAGGGAGCCAGG - Intronic
1131648393 15:94371798-94371820 GCTACTGGGGAGACTGAGGCAGG - Intronic
1131909943 15:97187287-97187309 GCCTCAGGGAATAGGGAGGCCGG + Intergenic
1131952058 15:97691915-97691937 GCATCTGGGCAGGGAGTGGCAGG - Intergenic
1132180795 15:99751388-99751410 GCTACTGGGAAGACTGAGGCAGG - Intergenic
1132490925 16:230469-230491 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1132504350 16:299765-299787 GCTACTGGGCAGGCTGAGGCAGG - Intronic
1132518631 16:377389-377411 TCTTCTGGGATGAGGGGGGCAGG + Exonic
1132584402 16:700073-700095 GCTGCTGGGAAGAGCGGGGCAGG - Intronic
1132730671 16:1359995-1360017 GCTACTGGGGAGACTGAGGCGGG + Intronic
1132774190 16:1582789-1582811 GCTACTGGGGAGACTGAGGCAGG + Intronic
1132853213 16:2033986-2034008 GCTTCTGGACAGAGGCAGAGGGG + Intronic
1132856976 16:2050065-2050087 GCTACTCGGGAGAGTGAGGCAGG - Intronic
1132873162 16:2124473-2124495 GCTCCTGGGCCGGGGGAGCCGGG + Intronic
1133022364 16:2972413-2972435 GTCTCTGGGCAGAGGGAGCCAGG - Exonic
1133173697 16:3997980-3998002 GCTACTGGGGAGACTGAGGCAGG + Intronic
1133185129 16:4090540-4090562 GCTTCGGAGCACAGGGAGGTGGG - Intronic
1133227069 16:4346123-4346145 GCTGCAGGGCAGAGGGGGGCTGG + Intronic
1133297687 16:4762879-4762901 ACGGCTGGGCAGAGGGAGGGAGG - Intronic
1133300893 16:4782060-4782082 GCTACTGGGGAGACTGAGGCAGG - Intronic
1133341356 16:5038516-5038538 GCTACTTGGCAGACTGAGGCAGG - Intronic
1133495033 16:6309722-6309744 GCTTCCCTACAGAGGGAGGCTGG + Intronic
1133622953 16:7543830-7543852 GCTACTCGGGAGAGTGAGGCAGG - Intronic
1134015327 16:10884158-10884180 GCTTCTCAGCAGTTGGAGGCAGG - Intronic
1134143458 16:11742221-11742243 GCTTTAGTGCCGAGGGAGGCGGG - Intronic
1134186272 16:12087483-12087505 GCTTCTTGGGAGAATGAGGCAGG + Exonic
1134227130 16:12399825-12399847 GCTTGTGGGCAGGGGGAGCATGG + Intronic
1134267671 16:12705644-12705666 GCTACTCGGCAGGGTGAGGCAGG + Intronic
1134288196 16:12880650-12880672 GCTACTGGGGAGGGTGAGGCAGG + Intergenic
1134451231 16:14364940-14364962 GCTTCTGGGCCAGGGAAGGCTGG + Intergenic
1134552250 16:15143655-15143677 GCTCCTGGGCCGGGGGAGCCGGG + Intergenic
1134744511 16:16577402-16577424 GCTACTAGGGAGAGTGAGGCAGG - Intergenic
1135000976 16:18776350-18776372 GCTACTGGGGAGAGTGAGGCAGG + Intergenic
1135057105 16:19240688-19240710 GCTTCTGGGCAGAAGAGGGCTGG - Intronic
1135416441 16:22271586-22271608 GCTACTTGGGAGAGTGAGGCGGG + Intronic
1135509236 16:23068258-23068280 GCTGCTGGGAAGCTGGAGGCTGG + Exonic
1135559897 16:23468287-23468309 GCTACTCGGGAGAGTGAGGCAGG - Intronic
1135597766 16:23756369-23756391 GCATCTGGGGAGAGGGTGGGAGG - Exonic
1135851404 16:25967263-25967285 GCTACTGGGGAGACTGAGGCAGG - Intronic
1135880079 16:26247136-26247158 ACTTCTGAGGGGAGGGAGGCTGG - Intergenic
1135898350 16:26431137-26431159 GCTACTCGGCAGGCGGAGGCAGG - Intergenic
1136027649 16:27480087-27480109 GCTACTGGGCAGGCTGAGGCAGG + Intronic
1136164992 16:28447879-28447901 GCTGCTGGGGAGACTGAGGCAGG - Intergenic
1136197975 16:28667101-28667123 GCTGCTGGGGAGACTGAGGCAGG + Intergenic
1136214320 16:28781278-28781300 GCTGCTGGGGAGACTGAGGCAGG + Intergenic
1136259042 16:29061123-29061145 GCTGCTGGGGAGACTGAGGCAGG + Intergenic
1136277736 16:29188887-29188909 GCTTCTGGGCAGTGGGGTGTGGG + Intergenic
1136320270 16:29479431-29479453 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1136347015 16:29682482-29682504 GCTACTTGGGAGAGTGAGGCAGG - Intronic
1136350884 16:29706838-29706860 GCTACTCGGGAGATGGAGGCAGG - Intergenic
1136394564 16:29986098-29986120 GCTCCTTGGCAGAGGGAGCTGGG - Intronic
1136394588 16:29986181-29986203 GCTCCTTGGCAGAGGGAGCTGGG - Intronic
1136412156 16:30083788-30083810 GCATGTGGGCAGGGGCAGGCAGG + Intronic
1136434841 16:30218772-30218794 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1136467029 16:30451432-30451454 GCTACTGGGGAGACTGAGGCGGG - Intergenic
1137334345 16:47533397-47533419 GTTCCTGGGCAGAAGGGGGCAGG - Intronic
1137613056 16:49831887-49831909 GCTACTGGGGAGGCGGAGGCAGG + Intronic
1137704203 16:50522856-50522878 GCTCCTGGGGAGAGGGGTGCTGG - Intergenic
1138033552 16:53580187-53580209 GCTCTTGGGCAGAAGGGGGCAGG - Intergenic
1138342958 16:56302683-56302705 CCTTCTGAGAAGAGGGAGCCCGG - Intronic
1138439431 16:57025393-57025415 GCTGCTGGGCAGAGGTCCGCAGG - Exonic
1138612006 16:58132585-58132607 GCTTCTAGGGAGACTGAGGCAGG + Intergenic
1138790544 16:59898594-59898616 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1139091553 16:63654314-63654336 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1139138509 16:64233570-64233592 GCTCCTGGGCAGAAAGGGGCAGG + Intergenic
1139277092 16:65738021-65738043 GTTTCTGCTCACAGGGAGGCAGG - Intergenic
1139539571 16:67604195-67604217 GCTACTTGGCAGACTGAGGCAGG + Intronic
1139716644 16:68818965-68818987 GCTACTGGGGAGGGTGAGGCAGG - Intronic
1139819046 16:69705289-69705311 GCTACTTGGCAGACAGAGGCAGG + Intergenic
1139835001 16:69831042-69831064 GATTGAGGGCAGAGGGAGGCAGG + Intronic
1139867900 16:70078280-70078302 GCTACTCGGCAGACTGAGGCAGG + Intergenic
1139894928 16:70280937-70280959 GCTTCTGGGGAGGCTGAGGCGGG - Intronic
1139962260 16:70724784-70724806 GCTTCTGCTGAGAGGGAAGCAGG + Intronic
1139990676 16:70937541-70937563 GCTACTTGGGAGAGTGAGGCAGG + Intronic
1140014527 16:71168702-71168724 GCTGCAGGGCAGAAGGAGGAGGG + Intronic
1140103479 16:71938446-71938468 GCTCCTGGGCAGAAAGGGGCAGG + Intronic
1140134186 16:72190629-72190651 GCTTGGGGTCAGAGGCAGGCGGG + Intergenic
1140184189 16:72752081-72752103 GCTACTGGGCAGGCTGAGGCAGG - Intergenic
1140191078 16:72817616-72817638 GCCTCTGGCCAGAGGGAGAATGG - Intronic
1140210969 16:72969945-72969967 CCTTCTGGGCAGTGGGCGTCCGG - Intronic
1140956318 16:79869725-79869747 GCCTCTGGGCAGTGGCAGGTTGG - Intergenic
1141433728 16:83985519-83985541 GCTACTTGGGAGAGTGAGGCAGG + Intronic
1141494307 16:84396436-84396458 GCTACTGGGGAGGGTGAGGCAGG + Intronic
1141555398 16:84833849-84833871 GCTGCTGGGCTGGGGGAGTCAGG - Intronic
1141683058 16:85555282-85555304 GCGCCTGGGCAGAAGGAGGCAGG - Intergenic
1141723170 16:85768113-85768135 ACACCTGGGCAGAGGGAAGCAGG - Intergenic
1141732258 16:85830392-85830414 GCTTCCTGGGAGAGGCAGGCTGG - Intergenic
1141825105 16:86473214-86473236 GCTACTGGGCAGGCTGAGGCAGG - Intergenic
1141972783 16:87494168-87494190 GCTACTGGGTAGACCGAGGCAGG + Intergenic
1142008260 16:87700639-87700661 GCTGGAGGGCAGAGGGAGGAGGG + Intronic
1142020777 16:87780876-87780898 ACTTGTGGGCAGAGGGAGGAAGG - Intergenic
1142082110 16:88154929-88154951 GCTTCTGGGCAGTGGGGTGTGGG + Intergenic
1142265989 16:89064145-89064167 GCCTCTGGGCTGCGGGAGCCGGG + Intergenic
1203117834 16_KI270728v1_random:1509484-1509506 GCTTCCAGGCAGATGAAGGCAGG - Intergenic
1142482054 17:225163-225185 GCCTCTGAGCAGATGGAGGAAGG - Intronic
1142483676 17:233571-233593 GCACCTGGCCAGTGGGAGGCAGG - Intronic
1142537329 17:627662-627684 GCTACTTGGGAGGGGGAGGCAGG + Intronic
1142790237 17:2258444-2258466 GCTACTGGGGAGACTGAGGCAGG + Intronic
1142816971 17:2434324-2434346 GCTACTGGGGAGACTGAGGCAGG - Intronic
1142921388 17:3190150-3190172 GCTTGGGCACAGAGGGAGGCGGG - Intergenic
1142964833 17:3573955-3573977 GCTACAGGGCACAGGGAGGGCGG + Exonic
1142992091 17:3738280-3738302 GCTACTGGGCAGGCTGAGGCAGG - Intronic
1143123574 17:4625865-4625887 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1143156935 17:4843364-4843386 GCTACTGGGGAGGGTGAGGCAGG + Intronic
1143189374 17:5030619-5030641 GCTACTGGGGAGGGTGAGGCAGG - Intergenic
1143253516 17:5539375-5539397 CCTTCTGGGCAGAGGGAAGAGGG - Intronic
1143365453 17:6405622-6405644 GCTTGTGGGCAGAGGGAAGGAGG - Intronic
1143542269 17:7576505-7576527 GTATCTGAGCAGAGAGAGGCAGG - Exonic
1143767208 17:9145502-9145524 GCTTCTGAGCAGAGTGGGCCAGG + Intronic
1144232321 17:13220478-13220500 GCTTCTGGGAAGAGGGAGGCTGG + Intergenic
1144508184 17:15851473-15851495 TCTTCTGGGCAGTATGAGGCAGG - Intergenic
1144546023 17:16196711-16196733 GCTACTGGGGAGACTGAGGCAGG + Intronic
1144730438 17:17522917-17522939 GCACTTGGGCAGAGGGAGGAGGG - Intronic
1144847352 17:18226762-18226784 ACATCAGTGCAGAGGGAGGCGGG - Intronic
1145172305 17:20669107-20669129 TCTTCTGGGCAGTATGAGGCAGG - Intergenic
1145202494 17:20959199-20959221 TCATCTGGGCAGTGTGAGGCAGG - Intergenic
1145245675 17:21267809-21267831 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1145371579 17:22310926-22310948 GCCTCTGGGCTGTGAGAGGCTGG + Intergenic
1145828877 17:27898816-27898838 GCTACTGGGCAGGCTGAGGCAGG + Intergenic
1145921655 17:28614323-28614345 GCTTCAGGGCAGAGGAAGGAAGG + Intergenic
1146215504 17:30976115-30976137 GCTGCTGGGAAGACTGAGGCAGG - Intronic
1146320611 17:31843641-31843663 GCTTCTGGACACAGAGAGCCTGG + Intergenic
1146650627 17:34603947-34603969 GCTTCTAGGTAGAGGGAGGGTGG - Intronic
1146715573 17:35084125-35084147 GCTACTTGGGAGACGGAGGCAGG + Intronic
1146789675 17:35744194-35744216 GCTGGGGGGCAGGGGGAGGCAGG + Intronic
1146996014 17:37321634-37321656 GCTGCTGGGGAGGGTGAGGCAGG + Intronic
1147478090 17:40733444-40733466 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1147498679 17:40941897-40941919 GCTACTGGGGAGGTGGAGGCAGG - Intergenic
1147733764 17:42620863-42620885 GCTACTTGGCAGGCGGAGGCAGG - Intergenic
1148034019 17:44644418-44644440 GCTACTGGGGAGAATGAGGCTGG + Intergenic
1148037334 17:44676708-44676730 GCTACTTGGGAGGGGGAGGCAGG + Intronic
1148230770 17:45932968-45932990 GCTACTGGGGAGGGTGAGGCAGG + Intronic
1148327519 17:46791926-46791948 GCTACTGGGGAGACTGAGGCGGG + Intronic
1148392402 17:47282058-47282080 GCTACTTGGGAGACGGAGGCAGG - Intronic
1148540125 17:48473602-48473624 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1148711289 17:49683184-49683206 GCTACTGGGCAGGCTGAGGCAGG - Intergenic
1148744191 17:49909374-49909396 GCTTCTAGGCAGAGGGGAGCGGG + Intergenic
1148759312 17:49991306-49991328 GTGTCTAGGCAGAGGGAGGGAGG + Exonic
1148849732 17:50548753-50548775 GCAACGGGTCAGAGGGAGGCTGG - Intronic
1149187978 17:54023977-54023999 GCTTCTTGGGAGACTGAGGCAGG + Intergenic
1149441771 17:56680124-56680146 GCTTCCTGGCATAGGGTGGCGGG - Intergenic
1149564151 17:57629709-57629731 GCTTCTGGGCTGAGCAAGACTGG - Intronic
1149569818 17:57664404-57664426 GCTACTGGGGAGACTGAGGCAGG + Intronic
1149683936 17:58524676-58524698 GCTACTGGGGAGGGTGAGGCAGG - Intronic
1149884642 17:60328041-60328063 GCTCCTGGGCAGAAGGGGGCAGG + Intronic
1149925907 17:60701860-60701882 GCTTCTTGGGAGACTGAGGCAGG + Intronic
1149977024 17:61276239-61276261 GCTACTTGGGAGAGTGAGGCAGG + Intronic
1150091506 17:62329903-62329925 GCTACTTGGGAGAGTGAGGCAGG + Intergenic
1150262167 17:63802796-63802818 GCTACTCGGGAGAGTGAGGCAGG + Intronic
1150414579 17:64976370-64976392 GCTACTGGGTAGGGTGAGGCAGG - Intergenic
1150491235 17:65575722-65575744 GCTACTGGGGAGACTGAGGCAGG + Intronic
1150699242 17:67433395-67433417 GCTTCTGGGCAGATGAATGGAGG + Intronic
1150815647 17:68390097-68390119 GCTACTGGGGAGACTGAGGCAGG - Intronic
1151101946 17:71565891-71565913 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1151319165 17:73342429-73342451 GATGCTGGGCCGAGTGAGGCTGG + Intronic
1151504972 17:74521716-74521738 GCTTGTGGGCAGGTGGGGGCGGG + Exonic
1151667569 17:75554188-75554210 GCTCCTGGGGAGACTGAGGCAGG + Intronic
1151907855 17:77060736-77060758 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1152026195 17:77811031-77811053 ACATCTGGGCACATGGAGGCTGG - Intergenic
1152040642 17:77900441-77900463 GCTGCTGGGGAGACTGAGGCAGG - Intergenic
1152302471 17:79503314-79503336 GCTCCGGGGCAGAGGGAGACTGG - Intronic
1152305218 17:79516408-79516430 GCTCCTGGGCAGAGAGACACAGG + Intergenic
1152346072 17:79752710-79752732 GCTTCTGGGGAGGCTGAGGCAGG - Intergenic
1152416314 17:80164825-80164847 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1152509784 17:80778685-80778707 GCTTCTCGGGAGAAGGAGGCAGG + Intronic
1152571125 17:81121721-81121743 GCTCCTGGGCAGAGGCTGCCTGG + Exonic
1152609041 17:81306708-81306730 GGTGCTGGGGAGAGGCAGGCGGG - Intergenic
1152623901 17:81379706-81379728 CCTGCTGGTAAGAGGGAGGCAGG - Intergenic
1152699068 17:81810353-81810375 ACCACTGGGCAGAGGGGGGCAGG + Intronic
1152884475 17:82841427-82841449 GCTACTGGGGAGACTGAGGCGGG - Intronic
1153036272 18:765508-765530 GCTACTGGGGAGGGTGAGGCAGG - Intronic
1153060573 18:990804-990826 GCTTCTGGTAAGAGGAAGCCAGG + Intergenic
1153428813 18:4993087-4993109 GCTCCTAGGCAGAAGGAGGTGGG - Intergenic
1153907648 18:9677285-9677307 GCTTCTGGGGAGGGTGAGGCAGG - Intergenic
1153998190 18:10460419-10460441 GCTTCTCGGGAGGGTGAGGCAGG + Intronic
1154122778 18:11665067-11665089 GATGCTGTGCAGAGGGTGGCAGG - Intergenic
1154219464 18:12439634-12439656 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1154326189 18:13392488-13392510 TCCTCTGAGCAGAGGGAAGCAGG + Intronic
1155478958 18:26264327-26264349 GCTACTGGGGAGGGTGAGGCAGG + Intronic
1155520549 18:26663864-26663886 GCTACTTGGGAGAGTGAGGCAGG + Intergenic
1155911908 18:31513690-31513712 TCCTCAGGGCAGAGGGAAGCGGG - Intronic
1156036578 18:32771971-32771993 GCATCTAGGCAGAGGAGGGCAGG + Intronic
1156178981 18:34581134-34581156 GCTGCTGGGGAGACTGAGGCAGG + Intronic
1156249828 18:35342082-35342104 GCTACTGGGGAGATTGAGGCAGG + Intronic
1156494565 18:37517397-37517419 GCTTTTGGGCAGGGGCAGGGCGG + Intronic
1156731442 18:40197981-40198003 GCTTGGGGACAGAGGGAGGCGGG - Intergenic
1156908898 18:42387631-42387653 GCTACTGGGCAGGCTGAGGCAGG - Intergenic
1157203490 18:45679170-45679192 CCTGCTAGGCAGAGGGAGCCAGG + Intronic
1158023393 18:52869562-52869584 GCTCCTGGGCAGAAGGGGGTGGG - Intronic
1158198096 18:54910590-54910612 GCTCCTGGGCAGAAGGGGGCAGG - Intronic
1158435766 18:57435104-57435126 GTCGCTGGGGAGAGGGAGGCTGG - Intergenic
1158552079 18:58444820-58444842 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1158708337 18:59814831-59814853 GCTACTGGGGAGGGTGAGGCAGG + Intergenic
1158882238 18:61791608-61791630 GGGTCTGGGAAGAGGGAGGGAGG - Intergenic
1159766912 18:72502562-72502584 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
1160292799 18:77609421-77609443 ATTTCTGGGCAGAAGGGGGCGGG + Intergenic
1160442580 18:78903672-78903694 TCTTCTGAGCAGTTGGAGGCAGG + Intergenic
1160506202 18:79427949-79427971 GCCTCTGTGCAGTGGGTGGCGGG + Intronic
1160597831 18:79989224-79989246 GCTTATGGGGAGGCGGAGGCAGG - Intronic
1160718843 19:588984-589006 GCTTCTGGGCCGAAGCCGGCTGG - Intergenic
1160816875 19:1040150-1040172 GCTGCTGGGCGGAGGGAAGGCGG + Exonic
1160988955 19:1852850-1852872 GATCCTGGGGGGAGGGAGGCAGG - Exonic
1161011681 19:1962356-1962378 GCTTCTGGGCACAGCCATGCTGG - Intronic
1161109206 19:2459846-2459868 GCTACTCGGGAGAGTGAGGCAGG - Intergenic
1161137682 19:2629734-2629756 GCATGGGGTCAGAGGGAGGCGGG - Intronic
1161292890 19:3505289-3505311 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1161327273 19:3669957-3669979 GCCTCGGGGCAGGGGCAGGCCGG + Intronic
1161394547 19:4038237-4038259 GGTCGTGGGCAGAGGGCGGCGGG - Exonic
1161405210 19:4087780-4087802 GCTACTGGGGAGGGTGAGGCAGG - Intergenic
1161405998 19:4091462-4091484 GCTACTGGGGAGGGTGAGGCAGG - Intronic
1161429654 19:4224264-4224286 CCTTCTGTACAGTGGGAGGCTGG + Intronic
1161430405 19:4229205-4229227 GCTTCAGGGCAGCGGAAGGAAGG + Intergenic
1161463837 19:4416060-4416082 GCTACTGGGCAGACTGAGGCAGG + Intronic
1161464398 19:4420352-4420374 GCTTCTTGGGAGACCGAGGCAGG - Intronic
1161552306 19:4920663-4920685 GCTGCTTGGCAGACTGAGGCTGG - Intronic
1161614260 19:5261170-5261192 CCCTCTGGGCTGAGGGAGGGAGG + Intronic
1161746739 19:6064739-6064761 GATTCTGGCCAGGAGGAGGCTGG + Intronic
1161781532 19:6296333-6296355 CCTACTCGGGAGAGGGAGGCAGG - Intergenic
1161926586 19:7305227-7305249 GCTTCTCGGGAGACTGAGGCAGG - Intergenic
1162089861 19:8272135-8272157 GCTACTGGGAAGACTGAGGCAGG - Intronic
1162106151 19:8371044-8371066 CTTTCTGGGCAGATGGAGGCTGG + Exonic
1162128287 19:8511052-8511074 TCTTCTGGGCTGGGGGAGCCCGG - Intronic
1162205273 19:9051225-9051247 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1162317253 19:9947080-9947102 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1162353986 19:10169443-10169465 GCTACTGGGGAGGTGGAGGCAGG + Intronic
1162412887 19:10517242-10517264 GCCTCTGGGGAGGGGGAAGCTGG - Intronic
1162504806 19:11077140-11077162 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1162786870 19:13040530-13040552 GCTCCTGAGGAGAGGGAGGGAGG - Intronic
1162878246 19:13637004-13637026 GCTTCTCGGGAGACTGAGGCAGG + Intergenic
1163172300 19:15540705-15540727 GCTCCTGGCCAGGGTGAGGCTGG + Exonic
1163253447 19:16140491-16140513 GCTACTGGGGAGACTGAGGCAGG + Intronic
1163323796 19:16590143-16590165 GCTACTGGAAAGAGGCAGGCAGG + Intronic
1163353346 19:16793686-16793708 GCTACTGGGGAGGCGGAGGCAGG - Intronic
1163404192 19:17112403-17112425 GCCAGTGGCCAGAGGGAGGCTGG + Intronic
1163428783 19:17254233-17254255 GCTACTCGGCAGGCGGAGGCAGG + Intronic
1163441660 19:17325008-17325030 GTGACTGGGCAGGGGGAGGCCGG + Exonic
1163568688 19:18067380-18067402 GTCTCTGGACAGTGGGAGGCTGG - Intronic
1163570661 19:18080348-18080370 GCTACTGGGGAGACTGAGGCAGG - Intronic
1163823281 19:19508449-19508471 GCTTCAGGGCAGAGGGAATGAGG + Exonic
1163832060 19:19551795-19551817 GCTTCTAGGCAGAGGGATGTTGG + Intergenic
1163852180 19:19670353-19670375 GCTTCTTGGAAGACTGAGGCAGG - Intronic
1163894125 19:20042136-20042158 GCTGCTGGGGAGACTGAGGCAGG - Intergenic
1164473725 19:28556444-28556466 GGTTCTGGGAAGTGGGAGCCTGG - Intergenic
1165013132 19:32863221-32863243 GCTACTGGGGAGACTGAGGCAGG - Intronic
1165022601 19:32936426-32936448 GTTCCTGGGCAGAAGCAGGCAGG + Intronic
1165203492 19:34164595-34164617 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1165404390 19:35620784-35620806 GGTGCTGGGCAGATTGAGGCAGG + Intronic
1165436990 19:35801053-35801075 GCTACTGGGGAGGCGGAGGCAGG + Intronic
1165835087 19:38750035-38750057 GCTGCTGGGGAGACTGAGGCAGG + Intronic
1165866686 19:38943700-38943722 GCTTCTGGGGAGACTGAGGCGGG - Intronic
1165995414 19:39840362-39840384 GCTTCGGGGCAGGGAGAGGCTGG - Intronic
1166062914 19:40337922-40337944 GCTTCTGGTCAGTGGGACCCAGG - Intronic
1166228762 19:41413457-41413479 GCTTGGTAGCAGAGGGAGGCGGG - Intronic
1166270163 19:41708616-41708638 GACTCAGGGCAGAGGGAGGAAGG + Exonic
1166340765 19:42135314-42135336 GGGACTGGGCAGAGGGAGGTGGG - Intronic
1166897457 19:46032840-46032862 CCTCCTGGGCAGAAGGGGGCAGG + Intergenic
1166937564 19:46343678-46343700 GCTACTTGGGAGACGGAGGCAGG - Intergenic
1167064948 19:47178127-47178149 GCTACTCGGGAGGGGGAGGCAGG + Intronic
1167280153 19:48562437-48562459 GCTACTGGGGAGGGTGAGGCAGG + Intronic
1167346221 19:48947125-48947147 GCTCCTGGGCAGAAGGGGGCAGG + Intergenic
1167447362 19:49545608-49545630 TCTTATCGGGAGAGGGAGGCTGG + Intronic
1167688533 19:50971057-50971079 GCTCCTGGGAAGACTGAGGCGGG - Intergenic
1167738521 19:51311227-51311249 ACTCCTGGGCTGAGGGAGGAGGG + Intergenic
1167822451 19:51941039-51941061 GCTACTGGGAAGACAGAGGCAGG - Intronic
1168055537 19:53862637-53862659 GCTACTGGGGAGACTGAGGCTGG - Intergenic
1168055734 19:53864073-53864095 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1168087998 19:54062610-54062632 GCTTCTCGGGAGGCGGAGGCAGG + Intronic
1168189235 19:54725982-54726004 TCTTCTGAGCACAGGGAGGGAGG + Intronic
1168199515 19:54804722-54804744 TCTTCTGAGCACAGGGAGGGAGG + Intronic
1168203949 19:54835771-54835793 TCTTCTGAGCACAGGGAGGGAGG + Intronic
1168206130 19:54851927-54851949 TCTTCTGAGCACAGGGAGGGAGG + Intronic
1168250185 19:55137481-55137503 ACTCCTGGGCTGAGGGAGGAGGG - Intronic
1168250270 19:55137732-55137754 ACTCCTGGGCTGAGGGAGGAGGG - Intronic
1168290236 19:55354063-55354085 CCTCCAGGGGAGAGGGAGGCGGG - Exonic
1168320971 19:55509204-55509226 TCTTATGGGGAGAGGGTGGCTGG - Intronic
1168327985 19:55547686-55547708 GCTACTGGGCAGGCTGAGGCAGG + Intergenic
1168479992 19:56711925-56711947 GCTACTGGGGAGGGTGAGGCAGG - Intergenic
1168710143 19:58495027-58495049 GCTACTGGGCAGGCTGAGGCAGG - Intronic
924995401 2:356206-356228 GCATCTGGACATAGGGAGGGAGG + Intergenic
925053476 2:835559-835581 GGTTATGGGCAGAGGGAGGAAGG + Intergenic
925113022 2:1352419-1352441 GCTCCTGGGCACAGTGAGGCTGG + Intronic
925172198 2:1756922-1756944 GCTACTGGGGAGACTGAGGCAGG + Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925194021 2:1908712-1908734 GCTGATGGGGAGAGGGAGGGTGG + Intronic
925380623 2:3422991-3423013 GCTACTGGGGAGACTGAGGCAGG + Intronic
925398908 2:3558075-3558097 GCATCGGGGTCGAGGGAGGCCGG - Intronic
925610488 2:5697134-5697156 GGGTCTGGGAGGAGGGAGGCTGG + Exonic
925849413 2:8066365-8066387 GCTACTGGGGAGACTGAGGCAGG + Intergenic
925926837 2:8676957-8676979 GCTGGTGGGCAGAGGGGGGGTGG + Intergenic
926026592 2:9550555-9550577 GCTACTGGGGAGACTGAGGCAGG - Intronic
926221263 2:10937138-10937160 CTTTCTGGGCAGAGGGGGGCAGG - Intergenic
926395739 2:12440657-12440679 GCTGCTGGGGAGAGGGAGGGAGG - Intergenic
926450454 2:12997340-12997362 GCTACTGGGGAGATTGAGGCAGG + Intergenic
926748116 2:16176746-16176768 GCTACTGGGGAGAGTGAAGCAGG - Intergenic
926895775 2:17686368-17686390 GCTTCTTGGGAGGGTGAGGCAGG + Intronic
926925136 2:17979889-17979911 GCCTCTGGGAGGAGAGAGGCTGG + Intronic
927266930 2:21162286-21162308 GCTCCTGGGCAGAAGGAAGGAGG - Intergenic
927533879 2:23836999-23837021 GCTCCTGGGCAGAAGGGGGTGGG - Intronic
927613599 2:24566646-24566668 ACTTCTGGGCAGAAAGGGGCAGG - Intronic
927709044 2:25313981-25314003 GCATCTGGGCGCCGGGAGGCAGG + Exonic
928126292 2:28618805-28618827 GCTTTGGGGCAGAGGGAGCCCGG + Intronic
928310408 2:30204965-30204987 GCTGATGGGCATGGGGAGGCAGG - Intergenic
928533815 2:32219544-32219566 GCTACTTGGCAGACCGAGGCAGG - Intronic
928552201 2:32383641-32383663 GCTACTGGGGAGACTGAGGCAGG - Intronic
929027249 2:37616431-37616453 TCTACTGGGCAGAAGGAGCCAGG + Intergenic
929108919 2:38389956-38389978 GACACTGGGAAGAGGGAGGCAGG + Intergenic
929109663 2:38396125-38396147 GTTTGTGGGGAGAGGGAGGAGGG - Intergenic
929125297 2:38518127-38518149 GCTACTGGGGAGACTGAGGCAGG - Intergenic
929184702 2:39081406-39081428 GCTTCTGGGGAGGCTGAGGCAGG + Intronic
929590100 2:43139804-43139826 GCTACTTGGCAGACTGAGGCAGG + Intergenic
929786930 2:45000209-45000231 GCTGCTGGGGAGACTGAGGCAGG + Intergenic
930316159 2:49799272-49799294 GCTACTAGGAAGAGTGAGGCAGG + Intergenic
930560929 2:52958844-52958866 GCTACTGGGGAGACTGAGGCAGG + Intergenic
930611991 2:53554162-53554184 GCTCCTGGGCAGAAGGGGGAGGG + Intronic
930800542 2:55438437-55438459 GTTCCTGGGCAGAAGGGGGCAGG + Intergenic
931458264 2:62428888-62428910 GTTACTGGGGAGACGGAGGCAGG + Intergenic
931733961 2:65177557-65177579 GCTCCTGGGCAGAAAAAGGCAGG - Intergenic
932125741 2:69144236-69144258 GCCACTGGGCAGAGGGAGGCTGG - Intronic
932262051 2:70335252-70335274 GCTACTTGGCAGACCGAGGCAGG - Intergenic
932490376 2:72116250-72116272 GCTCCTTGGCAGTGGCAGGCTGG - Intergenic
932644657 2:73488115-73488137 GCTCCTGGGCAGAAAGGGGCAGG - Intronic
933296773 2:80499707-80499729 GCTACTGGGGAGACTGAGGCAGG + Intronic
933668653 2:84985715-84985737 GCTACTGGGGAGACTGAGGCAGG + Intronic
933672568 2:85022997-85023019 GCTTCTGGGGAGACTGAGGCAGG - Intronic
933734559 2:85485395-85485417 GCTTCTCGGGAGGGTGAGGCAGG + Intergenic
933804465 2:85988027-85988049 ACTGCCGGGCAGAGGGAGGATGG + Intergenic
933921567 2:87052887-87052909 GCTTCTGGCCAGTCTGAGGCAGG + Intergenic
933930057 2:87140910-87140932 GCTTCTGGCCAGTCTGAGGCAGG - Intergenic
934001390 2:87716695-87716717 GCTTCTGGCCAGTCTGAGGCAGG - Intergenic
934473668 2:94578128-94578150 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
935115668 2:100133819-100133841 GCTTCTGGGGAGGCTGAGGCAGG + Intronic
935175851 2:100648192-100648214 TATTCTGGGCAGAAGCAGGCGGG + Intergenic
935374355 2:102379819-102379841 GCCTTTGGGAAGAGGGAGTCTGG + Intronic
936107974 2:109641915-109641937 GCTACTGGGGAGACTGAGGCAGG - Intergenic
936122429 2:109758294-109758316 GCTACTGGGAAGACTGAGGCAGG + Intergenic
936146052 2:109981271-109981293 CCTTCTGAGCAGAGAGAGGCAGG - Intergenic
936198638 2:110390208-110390230 CCTTCTGAGCAGAGAGAGGCAGG + Intergenic
936222264 2:110613180-110613202 GCTACTGGGAAGACTGAGGCAGG - Intergenic
936362886 2:111822495-111822517 GCTTCTGGCCAGTCTGAGGCAGG + Exonic
936537246 2:113321888-113321910 GAGCATGGGCAGAGGGAGGCCGG + Intergenic
936657571 2:114506041-114506063 AATTCTGGGCAGAAGAAGGCAGG + Intronic
937299883 2:120832618-120832640 GCTTCTGCCCAGGGTGAGGCTGG + Intronic
937904544 2:127046435-127046457 GCTTCTTGCCAGAGGGAGCAGGG - Intergenic
937987080 2:127642757-127642779 GCTGCAGGGCAGAGGTGGGCTGG - Intronic
938180682 2:129179304-129179326 GTTCCTGGGCAGAAGGGGGCAGG - Intergenic
938366239 2:130736758-130736780 GCTTCTGAGCAGGGTGAGCCTGG - Intergenic
939108623 2:137980145-137980167 GCTACTGGGGAGGGCGAGGCAGG - Intronic
939162306 2:138604928-138604950 GCTACTGGGGAGACTGAGGCGGG + Intergenic
939171225 2:138698740-138698762 GCTACTTGGGAGATGGAGGCAGG + Intronic
940542391 2:155037818-155037840 GCTACTGGGGAGACTGAGGCAGG + Intergenic
941485213 2:166071776-166071798 GCTACTGGGGAGACTGAGGCAGG + Intronic
941974498 2:171387965-171387987 GCTGCTGGGAAGAGGGAGAGTGG - Intronic
942006820 2:171710812-171710834 GCTACTGGGGAGACTGAGGCAGG - Intronic
942020475 2:171863009-171863031 GCTACTTGGGAGAGTGAGGCAGG - Intronic
942531661 2:176916880-176916902 GCTTCTTGGGAGACTGAGGCAGG - Intergenic
943048004 2:182881546-182881568 GCTTCTTGGGAGACTGAGGCAGG + Intergenic
943556399 2:189410452-189410474 GCTGCTGGGAAGTCGGAGGCAGG + Intergenic
943656726 2:190516977-190516999 GCTACTGGGCAGGCTGAGGCGGG + Intronic
943715965 2:191152132-191152154 CCGTCAGGGAAGAGGGAGGCAGG - Intergenic
943955166 2:194178750-194178772 GCTGCTGGGCAGGCTGAGGCAGG + Intergenic
944298451 2:198094171-198094193 GCTACTGGGGAGGCGGAGGCAGG - Intronic
944313898 2:198265102-198265124 GCTACTGGGGAGACTGAGGCAGG - Intronic
944670588 2:201991056-201991078 GCTACTGGGGAGACTGAGGCAGG + Intergenic
944679294 2:202062426-202062448 GCTACTTGGGAGAGTGAGGCGGG - Intergenic
944791800 2:203137870-203137892 GCTTCTCGGGAGACTGAGGCAGG + Intronic
945452411 2:210008805-210008827 GCTTCTAGGCAGGCTGAGGCAGG - Intronic
945516181 2:210765803-210765825 GCTTCTGGGGACGAGGAGGCAGG - Intergenic
945833017 2:214809193-214809215 GATTCAGGGCAAGGGGAGGCCGG + Intronic
946024570 2:216664262-216664284 GCAGCTGGGAAGAGAGAGGCCGG - Exonic
946168866 2:217881845-217881867 GGTTATGGGCAGAGGGACTCTGG - Intronic
946170281 2:217891187-217891209 GCTTCTCGGCACAGGATGGCAGG - Intronic
946200099 2:218066293-218066315 GCTTCTGGGGAGGCTGAGGCAGG - Intronic
946319679 2:218944895-218944917 GTTTTTGGGAAGAGAGAGGCAGG + Intergenic
946734686 2:222742695-222742717 GCTACTCGGCAGACTGAGGCAGG - Intergenic
946738331 2:222776595-222776617 GCTACTGGGGAGACTGAGGCAGG + Intergenic
946767303 2:223052750-223052772 GGTCCTGGGCACAGGGAGGTGGG - Intronic
946853846 2:223933708-223933730 GCTACTTGGCAGACTGAGGCTGG + Intronic
947258237 2:228190131-228190153 GCTACTGGGGAGACTGAGGCAGG - Intergenic
947316668 2:228866402-228866424 GCTCCTGGGCAGAAACAGGCAGG + Intronic
947347733 2:229210399-229210421 GCTACTGGGGAGAGTGAGGCAGG + Intronic
947491781 2:230602031-230602053 GCTACTGGGAAGGCGGAGGCAGG - Intergenic
947500254 2:230666336-230666358 GCTACTGGGCAGGCTGAGGCGGG - Intergenic
947674760 2:231968207-231968229 GCTACTGGGGAGACTGAGGCAGG - Intronic
947865421 2:233394817-233394839 GCTACTGGGGAGGGTGAGGCAGG - Intronic
947876639 2:233471877-233471899 TCTGCTGTGCAGAGAGAGGCAGG + Exonic
948049958 2:234972613-234972635 GCTACTGGGAAGACTGAGGCAGG + Intronic
948118660 2:235512743-235512765 GCCACTGAGCAGAGGCAGGCAGG - Intronic
948425509 2:237884732-237884754 GCTTTAGGGCAGAGGGACGGAGG - Intronic
948450879 2:238070566-238070588 GCTTCTGGGGAGGTTGAGGCAGG + Intronic
948485370 2:238277675-238277697 GCCTCTGGCCAGATGGAGGCTGG - Intronic
948575419 2:238946760-238946782 GCTCCTGGGCAGAAGGGGGAGGG - Intergenic
948678282 2:239611883-239611905 CCTGGTGGGCAGAAGGAGGCCGG + Intergenic
948719690 2:239891194-239891216 GCTACTGGGGAGACTGAGGCAGG + Intergenic
948975629 2:241461779-241461801 GTTTCTGGGCAGGGAGAGGACGG + Intronic
1168757668 20:327418-327440 GCTTCTGGGGAGGAGGGGGCTGG + Exonic
1169068379 20:2707178-2707200 GCCACTGGGCTGGGGGAGGCAGG + Intronic
1169068415 20:2707347-2707369 GCTTCTGGGCAGAGGGAGGCTGG + Intronic
1169112262 20:3041853-3041875 GGGTGTGGGCAGTGGGAGGCAGG - Intergenic
1169141678 20:3230344-3230366 TCTTCCTGGCAGGGGGAGGCAGG - Intronic
1169279216 20:4252899-4252921 GCTACTTGGCAGGCGGAGGCAGG + Intergenic
1169497557 20:6129820-6129842 GCCTCTGGGGAATGGGAGGCTGG + Intergenic
1169568392 20:6880684-6880706 GCTGCTGGGGAGACTGAGGCAGG + Intergenic
1170035150 20:11981818-11981840 GCTACTTGGGAGAGTGAGGCAGG - Intergenic
1170295138 20:14816180-14816202 GTTGCGGGGCAGAGGGAGGATGG + Intronic
1170636028 20:18105386-18105408 GCTACTTGGCAGACTGAGGCAGG + Intergenic
1170721943 20:18889213-18889235 GATTCTGCGCAAAGGGAGGGAGG + Intergenic
1170925285 20:20717370-20717392 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1170960408 20:21020387-21020409 GTTTGCGGGCAGAGGGAAGCCGG - Intergenic
1171236923 20:23534938-23534960 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
1171237026 20:23535348-23535370 GCTTCTGAGTTGTGGGAGGCAGG - Intergenic
1171356182 20:24547200-24547222 GCTCCTGGGCACTGGGTGGCTGG + Intronic
1171425256 20:25044815-25044837 GGCTCCGGGCAGAGGAAGGCTGG + Intronic
1171489813 20:25508885-25508907 GCTTCAGGAAAGAGGAAGGCCGG - Intronic
1171858296 20:30370746-30370768 GCTTCTGGGGAGGTTGAGGCAGG - Intergenic
1171999862 20:31765555-31765577 GCTACTGGGAAGACGGAGGCAGG - Intronic
1172012452 20:31853573-31853595 GCTACTTGGGAGAGTGAGGCAGG + Intronic
1172254405 20:33504513-33504535 GCTACTCGGCAGACTGAGGCAGG - Intronic
1172402391 20:34660471-34660493 GCTACTTGGGAGAGTGAGGCAGG + Intronic
1172550299 20:35793884-35793906 GCTACTGGGGAGGGTGAGGCAGG + Intronic
1172682666 20:36728835-36728857 GCTACTTGGGAGATGGAGGCAGG - Intronic
1173166614 20:40690482-40690504 GGTCCTGGGCGGAGGAAGGCCGG + Intergenic
1173203257 20:40969634-40969656 GCTGCAGGGCAGCGGAAGGCAGG + Intergenic
1173290394 20:41709980-41710002 GCTACTGGGCAGGCTGAGGCAGG - Intergenic
1173308370 20:41873189-41873211 GCTGCTGGAGAGAGGGAGGGAGG + Intergenic
1173884585 20:46446012-46446034 GCTCCTGGGCAGAAGGGGGCAGG - Intergenic
1174037447 20:47677019-47677041 CTTCCTGGGCAGAGGGAGGGAGG + Intronic
1174254284 20:49242831-49242853 GCTTCTTGGGAGACTGAGGCAGG - Intronic
1174432918 20:50483653-50483675 GGCTCTGGGCAGAGAGATGCGGG + Intergenic
1174505741 20:51016323-51016345 GCTACTGGGAAGATTGAGGCAGG + Intronic
1174622987 20:51890807-51890829 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1174623000 20:51890878-51890900 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1174623013 20:51890949-51890971 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1175092375 20:56514933-56514955 GCTACTGGGGAGACTGAGGCAGG + Intronic
1175159067 20:56994554-56994576 GCTGCTGGGGAGAGGGAGTGAGG + Intergenic
1175206880 20:57317902-57317924 GCTTTTATGCTGAGGGAGGCGGG - Intergenic
1175286457 20:57840036-57840058 GCTTGTGAGCTGAGGGAGGTGGG + Intergenic
1175313678 20:58029845-58029867 TCTTCTGGCCAGAGGCAGCCTGG - Intergenic
1175756508 20:61533575-61533597 CCTCATGGGCAGAGGAAGGCAGG - Intronic
1175886234 20:62292415-62292437 GCGTCTGTGCACATGGAGGCTGG + Intronic
1175982241 20:62744441-62744463 GCTACTGGGGAGACTGAGGCAGG + Intronic
1176111783 20:63414190-63414212 GCTTCTGGGGGGAAGGAGACAGG + Exonic
1176175475 20:63721238-63721260 GCTACTGGGAAGACTGAGGCAGG + Intronic
1176723571 21:10412611-10412633 GCTTTTGGGTAGATGGAGGGGGG - Intergenic
1176973290 21:15290191-15290213 GCTCCTGGGCAGAAAGGGGCAGG - Intergenic
1177344657 21:19853958-19853980 GCTCCTGGGCAGAAAGGGGCGGG - Intergenic
1177957385 21:27616293-27616315 GCTACTCGGAAGGGGGAGGCAGG - Intergenic
1178237850 21:30864194-30864216 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1178269710 21:31178416-31178438 GCTACTCGGCAGACTGAGGCAGG - Intronic
1178312614 21:31542313-31542335 GCTTCTGGGGAGGCTGAGGCAGG + Intronic
1178312977 21:31544899-31544921 GCTTCTGGGGAGGCTGAGGCAGG + Intronic
1178467104 21:32858787-32858809 GCTCCTGGGCAGAAGGAGGTGGG - Intergenic
1178546556 21:33497333-33497355 GCTACTCGGCAGACTGAGGCAGG + Intergenic
1178675894 21:34631418-34631440 GCTTCAGGTCCGAGGGGGGCGGG + Intergenic
1178807153 21:35848829-35848851 GCTTCTGGGGACTTGGAGGCCGG - Intronic
1179144581 21:38756512-38756534 GCTACTGGGCAGGCTGAGGCAGG - Intergenic
1179207933 21:39301065-39301087 GCTGCTGGGGAGACTGAGGCAGG + Intronic
1179277360 21:39904551-39904573 GCTCCTGGGCACAGGGTGGCTGG + Intronic
1180091294 21:45534990-45535012 GCTTCTCTGAACAGGGAGGCGGG + Intronic
1180122590 21:45763810-45763832 GCTTCCGGGGAGAGAGAGGAAGG - Intronic
1180144000 21:45909709-45909731 GTATCTGGGCAGTGGGTGGCCGG - Intronic
1180144061 21:45909877-45909899 GTATCTGGGCAGTGGGTGGCCGG - Intronic
1180170301 21:46054982-46055004 TGTGCAGGGCAGAGGGAGGCAGG - Intergenic
1180170339 21:46055091-46055113 TGTGCGGGGCAGAGGGAGGCAGG - Intergenic
1180182162 21:46122965-46122987 GCAGCTGGGCAGAGGCAGGGAGG + Intronic
1180304730 22:11065383-11065405 GCTTTTGGGTAGATGGAGGGGGG - Intergenic
1180635163 22:17258134-17258156 CTTTCTGGGCAGGGGGAGGGAGG + Intergenic
1180638140 22:17277132-17277154 GCTACTGGGGAGGCGGAGGCAGG - Intergenic
1180757301 22:18170944-18170966 GCATCTGGGGAGAGGCAGGATGG - Intronic
1180824495 22:18853307-18853329 GCAGCTGCGCAGAGGGAAGCAGG - Intronic
1180843529 22:18970106-18970128 GCTTCTGTGCAGGGGGCGGGGGG + Intergenic
1180860357 22:19076068-19076090 GCTACTGGGGAGACTGAGGCAGG - Intronic
1180938324 22:19640599-19640621 GCTACTGGGAAGACTGAGGCAGG - Intergenic
1180945258 22:19689024-19689046 GCCTGTGAGCAGAGGGTGGCAGG - Intergenic
1181006028 22:20013982-20014004 GCTGCTGGGGAGACTGAGGCAGG - Intronic
1181074478 22:20366521-20366543 GCATCTGGGGAGAGGCAGGATGG + Intronic
1181124918 22:20696462-20696484 GCAGCTGCGCAGAGGGAAGCAGG - Intergenic
1181188239 22:21121241-21121263 GCAGCTGCGCAGAGGGAAGCAGG + Intergenic
1181210957 22:21289252-21289274 GCAGCTGCGCAGAGGGAAGCAGG - Intergenic
1181397991 22:22634883-22634905 GCCACAGTGCAGAGGGAGGCGGG - Intergenic
1181545439 22:23599688-23599710 GCTGGAGGGCAGAGGGAGGAAGG - Intergenic
1181589044 22:23871628-23871650 GCTACTCGGCAGACTGAGGCAGG + Intronic
1181651414 22:24261175-24261197 GCCACAGTGCAGAGGGAGGCGGG + Intergenic
1181676611 22:24458115-24458137 GCTTCTTGGAAAAGTGAGGCAGG - Intergenic
1181814871 22:25430211-25430233 GCTGGAGGGCAGAGGGAGGAAGG + Intergenic
1181891343 22:26066369-26066391 GGTTGTGGGCTGAGTGAGGCAGG - Intergenic
1181915090 22:26273527-26273549 GGCTCTGGGCAGAGGCTGGCTGG + Intronic
1182237842 22:28890386-28890408 GCTACTGGGGAGACTGAGGCAGG + Intronic
1182491505 22:30675287-30675309 GGTTATGGGCAGAGGTGGGCAGG - Intergenic
1182519100 22:30875325-30875347 GCCACAAGGCAGAGGGAGGCTGG - Intronic
1182541230 22:31043499-31043521 GCTACTTGGGAGAGTGAGGCAGG + Intergenic
1182667116 22:31967996-31968018 GCTACTCGGGAGAGTGAGGCAGG + Intergenic
1182771872 22:32802028-32802050 GCTCCTGGGCAGCTGGAGCCTGG + Exonic
1183022602 22:35039358-35039380 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1183243380 22:36674765-36674787 GCCACTGGGAAGAGGGAGGTAGG + Intronic
1183334508 22:37238985-37239007 GCTTCTGGGCTGAGGATGGTAGG - Intronic
1183380945 22:37490215-37490237 GGCTCTGGGAAGAGGCAGGCGGG + Intergenic
1183385071 22:37509818-37509840 GCTTGTGGGCACAGGCTGGCAGG - Intronic
1183385114 22:37509937-37509959 GCTTGTGGGCACAGGCTGGCAGG - Intronic
1183504518 22:38201912-38201934 GCTCCTGGCCGGAGGGCGGCCGG + Exonic
1183579067 22:38712407-38712429 GAGGCTGGGCAGAGGAAGGCAGG + Intronic
1183617512 22:38954501-38954523 GCTTCTAGGCTGAGGAGGGCGGG + Intronic
1183733709 22:39631996-39632018 CCAGCTGGGCAGAGTGAGGCGGG + Intronic
1184066305 22:42123749-42123771 GCGTCTCTGCAGAGGGAGGTGGG - Intergenic
1184068773 22:42135901-42135923 GCGTCTCTGCAGAGGGAGGTGGG - Intergenic
1184138630 22:42564541-42564563 GCTACTTGGCAGACTGAGGCAGG - Intronic
1184185962 22:42865699-42865721 GCTTCTGGGCAAAGACAGCCAGG - Intronic
1184270593 22:43379856-43379878 GCTACTGGGAAGACTGAGGCAGG + Intergenic
1184583628 22:45433423-45433445 GCTGCTGGCCAGAGCGTGGCAGG - Intergenic
1184698810 22:46155424-46155446 GCTACTGGGGAGACTGAGGCAGG - Intronic
1184776104 22:46623891-46623913 GCTACTTGGAAGAGTGAGGCAGG - Intronic
1184865849 22:47201602-47201624 GCTTCTGGGCCGAAGGGGGCGGG - Intergenic
1184873770 22:47259433-47259455 AATTCAGGGCAGGGGGAGGCAGG + Intergenic
1184941212 22:47766853-47766875 GCTGCTGGGGAGGGTGAGGCAGG - Intergenic
1185003319 22:48259954-48259976 GCTTCTCAGCAAAGGGAGACAGG - Intergenic
1185070127 22:48651529-48651551 GGTTCTGGGCAGAGGTATGGTGG + Intronic
1185161664 22:49233666-49233688 TCCTCTGAGCAGAGGGAGGTGGG + Intergenic
1185236451 22:49716384-49716406 GCTTCTGGGAGGAGGAAGGTGGG - Intergenic
1185258597 22:49849551-49849573 GCCTCTGCGGAGAGGGAGGAAGG + Intergenic
1185262142 22:49873326-49873348 GTCTCAGGGAAGAGGGAGGCTGG + Intronic
1185282266 22:49978210-49978232 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1185378583 22:50495447-50495469 GCTGCTGGGGAGGGTGAGGCAGG - Intergenic
1203215988 22_KI270731v1_random:6178-6200 GCAGCTGCGCAGAGGGAAGCAGG + Intergenic
949194575 3:1289784-1289806 GCTGCTGGGGAGACTGAGGCAGG - Intronic
949309003 3:2674644-2674666 GCTACTGGGGAGGTGGAGGCAGG + Intronic
949885641 3:8691422-8691444 GCTGCTTGGGAGATGGAGGCAGG - Intronic
950106194 3:10390628-10390650 GCATCTGTGCAGGGAGAGGCTGG - Intronic
950182842 3:10927266-10927288 CCTGCCTGGCAGAGGGAGGCAGG + Intronic
950226884 3:11243023-11243045 GCTACTGGGGAGGGTGAGGCAGG - Intronic
950419341 3:12888239-12888261 GCTACTGGGCTGAATGAGGCGGG + Intergenic
950453100 3:13076509-13076531 GCATTTGGGAAGAGGGAGGACGG + Intergenic
950678508 3:14569096-14569118 GCGTCTGGGCAGAGTGGGGAAGG - Intergenic
951264735 3:20552543-20552565 GCTCCTGGACAGAAGGGGGCAGG - Intergenic
951400076 3:22222086-22222108 GCTACTCGGGAGAGTGAGGCAGG - Intronic
951538626 3:23761934-23761956 TCTTCTGCCCAGAGGAAGGCAGG + Intergenic
951562480 3:23982283-23982305 GTTCCTGGGCAGAAGGAGGCGGG - Intergenic
951563569 3:23990583-23990605 GCTACTGGGGAGGGTGAGGCAGG + Intergenic
951821589 3:26819846-26819868 GCACTTGGGCAGAGGGAGGTTGG - Intergenic
952010268 3:28892654-28892676 GCTACTGGGGAGACTGAGGCAGG + Intergenic
952109430 3:30105461-30105483 GCTACTTGGAAGAAGGAGGCAGG + Intergenic
952359706 3:32617633-32617655 GCTACTCGGGAGATGGAGGCAGG + Intergenic
952760692 3:36910956-36910978 GCTTCTTGGGAGACTGAGGCAGG + Intronic
952856160 3:37772294-37772316 GCTACTGGGGAGGGTGAGGCAGG + Intronic
952931194 3:38362095-38362117 GCTCCTGGACACAGGGAGTCTGG + Intronic
953250064 3:41237363-41237385 GCTACTGGGGAGACGGGGGCAGG + Intronic
953766539 3:45747388-45747410 GCTCCTGGGCAGAAAGGGGCGGG + Intergenic
954271632 3:49514580-49514602 GCTACTCGGGAGATGGAGGCAGG - Intronic
954376749 3:50198505-50198527 GCTTCTTGGGAGACTGAGGCAGG - Intergenic
954460091 3:50621484-50621506 GCTACTGGGGAGACTGAGGCAGG + Intronic
954510747 3:51122763-51122785 TCTTCTGGGCAGTGGGAAGCTGG - Intronic
954665462 3:52249087-52249109 CTTTCTGGGCAGATGGAAGCTGG - Intronic
954737002 3:52715046-52715068 GCTACTGGGCAGAAGGGGGCGGG + Intronic
954853185 3:53620400-53620422 GCTACTGGGCAGGCTGAGGCAGG - Intronic
954906510 3:54067738-54067760 CCCTCTGGGCAGAGGGGGCCAGG - Intergenic
955181274 3:56672930-56672952 GCTTCTTGGGAGGGTGAGGCAGG - Intronic
955383327 3:58458978-58459000 GCTTCTGGGGAGGCTGAGGCAGG - Intergenic
956616104 3:71174324-71174346 GCTACTGGGGAGGGTGAGGCAGG + Intronic
956636110 3:71367161-71367183 ACTTCTGTGCAGAAGGAGGGAGG + Intronic
957371294 3:79298143-79298165 ACCTCTGGGTAGAGAGAGGCAGG + Intronic
957426996 3:80051677-80051699 GCTCCTGGGCAGAAGGAGGCTGG + Intergenic
958040531 3:88221126-88221148 GCTACTTGGGAGAGTGAGGCAGG - Intergenic
958183489 3:90088519-90088541 GCTACTGGGGAGACTGAGGCAGG - Intergenic
958627453 3:96644320-96644342 GCTACTTGGGAGACGGAGGCAGG + Intergenic
958792419 3:98667191-98667213 GCTACTGGGAAGACTGAGGCAGG + Intergenic
958880337 3:99662268-99662290 GCTACTGGGGAGGCGGAGGCAGG + Intronic
959086523 3:101856160-101856182 GCTACTGGGCAGGCTGAGGCAGG - Intronic
959750926 3:109834137-109834159 GCTTCTGGGGTGAGAGAAGCTGG + Intergenic
959771984 3:110109281-110109303 GTTACTGGGCAGACTGAGGCAGG + Intergenic
959978286 3:112486003-112486025 GCTGCTCGGCAGACTGAGGCAGG + Intronic
960074366 3:113467401-113467423 GCTTCTGGGGAGGCTGAGGCAGG - Intronic
960091781 3:113647459-113647481 GCTACTGGGGAGACTGAGGCAGG - Intergenic
960554150 3:119009003-119009025 GCTTCTGTGTATATGGAGGCTGG - Intronic
960634257 3:119768189-119768211 GCTCCTGGGCAGAAGGGGGCAGG - Intergenic
960953358 3:123013816-123013838 GCTTCAGGGAAGAGGGGAGCTGG + Intronic
961273310 3:125706615-125706637 GCTGCTCGGGAGATGGAGGCAGG - Intergenic
961317654 3:126051483-126051505 ACCTGGGGGCAGAGGGAGGCAGG - Intronic
961330515 3:126135471-126135493 GCTTCTGGGCAGTGGCACGGGGG - Intronic
961526625 3:127504844-127504866 GCTACTGGGGAGACGGAGGCAGG + Intergenic
961640762 3:128363550-128363572 GCCCCTGGGAAGAGGGAGTCAGG + Intronic
961671344 3:128533726-128533748 GCTTCTCGGGAGACTGAGGCAGG - Intergenic
961869768 3:129978857-129978879 CTTTTGGGGCAGAGGGAGGCAGG + Intergenic
962786249 3:138770821-138770843 GCTTCTCGGGAGACTGAGGCAGG - Intronic
962793039 3:138828644-138828666 GCTACTGGGGAGACTGAGGCAGG + Intronic
962860188 3:139392354-139392376 GCTACTGGGGAGACTGAGGCAGG - Intergenic
964271998 3:154966750-154966772 GCTACTGGGGAGGTGGAGGCAGG - Intergenic
964272845 3:154977295-154977317 GCTACTAGGCAGACTGAGGCAGG + Intergenic
964328581 3:155575017-155575039 GCTTCTTGGGAGACTGAGGCAGG + Intronic
964451215 3:156815332-156815354 GCTGCTGGGGAGACTGAGGCAGG + Intergenic
964476025 3:157098408-157098430 GCTGCTGAGGACAGGGAGGCAGG + Intergenic
964576842 3:158180572-158180594 GCTACTCGGGAGAGTGAGGCTGG - Intronic
964590743 3:158360444-158360466 TCTCCTGGGCAGAGGGGGACAGG - Intronic
964790464 3:160449804-160449826 CCTTCGGGGCAGAGGAGGGCGGG - Exonic
965043580 3:163544799-163544821 GCTACTGGGCAGGCTGAGGCAGG - Intergenic
966190737 3:177270129-177270151 GCTACTGGGGAGGGTGAGGCAGG - Intergenic
966383382 3:179367037-179367059 GCTACTGGGCAGGCTGAGGCAGG - Intronic
966583992 3:181601335-181601357 GATTCTGGGCAGTGGCAGGGAGG + Intergenic
966818724 3:183908888-183908910 GGTTCTGGGGAGAGGGAAGGAGG + Intergenic
966829160 3:183991183-183991205 GCTACTTGGGAGATGGAGGCAGG + Intronic
966905091 3:184516839-184516861 ACTGGTGGGCAGAGGGAGGAAGG + Intronic
966927707 3:184656200-184656222 GCTTCTGGGGAGGCTGAGGCAGG + Intronic
967171350 3:186825557-186825579 CCTTCTGGGCAGAGGCATGGCGG - Intergenic
967444854 3:189554918-189554940 GCTCCTGGGCAGAAGGGAGCAGG - Intergenic
967945062 3:194797685-194797707 GCTTCTGGGCACATGCAGTCTGG + Intergenic
968110054 3:196037542-196037564 GCTACTGGGGAGGGTGAGGCAGG + Intronic
968123400 3:196141920-196141942 GCTACTCGGGAGAGTGAGGCAGG + Intergenic
968149820 3:196328186-196328208 GCTACTGGGGAGACTGAGGCAGG + Intronic
968267581 3:197374405-197374427 GCTTCTCGGGAGAATGAGGCAGG - Intergenic
968267680 3:197375280-197375302 GCATCTGGGCTCAGGGAGACAGG + Intergenic
968384950 4:127507-127529 GCATTTGGGCAAAGGGAGGAGGG - Intronic
968447650 4:660434-660456 GATTGTGGGCTGAGGGAGGTTGG - Intronic
968455775 4:698864-698886 GCTGCTGAGGACAGGGAGGCAGG - Intergenic
968496613 4:921212-921234 GCTACTGGGGAGACTGAGGCAGG - Intronic
968610437 4:1554489-1554511 GTTTCTGGGCAGTGGTAGGTGGG - Intergenic
968781744 4:2587578-2587600 GCTACTTGGCAGACTGAGGCAGG + Intronic
968920863 4:3521582-3521604 GCTTCCGGACAGAGTGAGACAGG - Intronic
968959588 4:3736316-3736338 GCTTCTGGGCAGCAGGGGGTGGG - Intergenic
968959742 4:3737412-3737434 GATGCTGGGCAGGGGCAGGCGGG + Intergenic
969066122 4:4482693-4482715 CATTCTGGGCAGAGAGAAGCAGG - Intronic
969166981 4:5324240-5324262 GCTACTGGGGAGGGTGAGGCAGG + Intronic
969291553 4:6243244-6243266 GCTGTTGGGCAGTGGGGGGCTGG + Intergenic
969618009 4:8264998-8265020 GGTCCTGGGAACAGGGAGGCCGG + Intergenic
969636766 4:8373974-8373996 GCTCCTGGGCAGAGTGAAGCAGG + Intronic
969735258 4:8984680-8984702 GCTGCTCGGGAGATGGAGGCAGG - Intergenic
969848398 4:9937584-9937606 GGAGCTGGGCAGAGGGAGGTGGG - Intronic
970251421 4:14120091-14120113 ACTTCGGGGCAGAGGGAGTGAGG - Intergenic
970452549 4:16185478-16185500 GCTACTGGGGAGACTGAGGCAGG - Intronic
971198440 4:24491438-24491460 GCCAGTGGGGAGAGGGAGGCAGG - Intergenic
971214015 4:24647083-24647105 GCATCTGGGCAGCTGGGGGCTGG + Intergenic
971350505 4:25851775-25851797 GCTACTGGGGAGACTGAGGCAGG + Intronic
971538591 4:27786405-27786427 GCTACTTGGGAGACGGAGGCAGG - Intergenic
971542232 4:27833415-27833437 GCTACTGGGCAGGCTGAGGCAGG + Intergenic
971834664 4:31748130-31748152 GTTCCTGGGCAGAAAGAGGCAGG - Intergenic
972075400 4:35080063-35080085 GCTTCTGGACAGGGGGAGTGCGG - Intergenic
972334216 4:38092621-38092643 GCTACTTGGAAGAGTGAGGCAGG + Intronic
972349995 4:38227618-38227640 GCTACTGGGGAGACTGAGGCAGG + Intergenic
972504552 4:39708006-39708028 GCTTCTCGGGAGACTGAGGCAGG - Intronic
972509211 4:39751853-39751875 GCTACTGGGGAGACTGAGGCGGG + Intronic
972531094 4:39962167-39962189 GCTGCTGGGCAGGTGGAGGCAGG - Intronic
972613296 4:40675096-40675118 GCTACTGGGGAGACTGAGGCGGG - Intergenic
972788161 4:42346410-42346432 GCTTCTGGGCAGAAAGGGGCAGG + Intergenic
972996921 4:44891681-44891703 GCTTCTCGGGAGGCGGAGGCAGG + Intergenic
972998660 4:44917143-44917165 TCTTCTGGGCAGAGAGAGAGTGG - Intergenic
973058038 4:45685293-45685315 GCTACTGGGCAGGCTGAGGCAGG + Intergenic
973175059 4:47195253-47195275 GCTACTTGGGAGAGTGAGGCAGG + Intronic
973293912 4:48494861-48494883 GCTACTAGGTGGAGGGAGGCTGG + Intergenic
974038219 4:56835648-56835670 GCTACTGGGGAGACTGAGGCAGG + Intergenic
974608896 4:64189423-64189445 GCTACTTGGCAGACTGAGGCAGG - Intergenic
974730025 4:65851452-65851474 GCTACTGGGGAGGCGGAGGCAGG - Intergenic
975040884 4:69743547-69743569 GCTCCTGGGCAGAAGGGGGTGGG - Intronic
975310486 4:72898297-72898319 GCTACTGGGGAGACTGAGGCAGG - Intergenic
975523227 4:75322348-75322370 GCTACTTGGGAGAAGGAGGCAGG + Intergenic
975640595 4:76496201-76496223 GCTTCTGGGGTGAGGAGGGCAGG + Intronic
975644030 4:76528662-76528684 GCTACTGGGGAGACTGAGGCAGG - Intronic
976179778 4:82387809-82387831 GCTACTGGGGAGGGTGAGGCAGG + Intergenic
976194285 4:82518202-82518224 GCTACTGGGGAGACTGAGGCAGG + Intronic
976276083 4:83279970-83279992 GCTACTGGGGAGGCGGAGGCAGG - Intronic
976367940 4:84251097-84251119 GCTTGAGGGAAGAGGGTGGCAGG + Intergenic
976700770 4:87966595-87966617 GCTCCTGGGCAGAAGGGGGCAGG + Intergenic
977411945 4:96677487-96677509 TCTGCTGGGGAGAGAGAGGCAGG + Intergenic
977486046 4:97647789-97647811 TGTTCTGGGCAGAGGGAAACAGG + Intronic
977849455 4:101807971-101807993 GCTACTCGGGAGAGTGAGGCAGG + Intronic
977990927 4:103441659-103441681 ACTTGTTGGCAGAGGAAGGCAGG + Intergenic
978124088 4:105114987-105115009 GCTACTTGGGAGATGGAGGCAGG - Intergenic
978251319 4:106634481-106634503 GCTACTGGGGAGGCGGAGGCAGG - Intergenic
978386192 4:108177727-108177749 GCTTCTGGGCAGAGGCAACAAGG - Intergenic
978387694 4:108192309-108192331 CCCTCTGGGCAGAGGGAATCAGG + Intergenic
978529689 4:109701537-109701559 GCTACTGGGGAGACTGAGGCAGG - Intronic
979010776 4:115365815-115365837 GCTCCTGGGCAGAAAGAGGTGGG + Intergenic
979280652 4:118863721-118863743 GCTACTGGGAAGACTGAGGCAGG - Intronic
979448225 4:120839711-120839733 GCTCCTGGGCAAAAGGGGGCAGG - Intronic
979548322 4:121962294-121962316 GCTTCTGGGGAGGCTGAGGCAGG + Intergenic
979602811 4:122604707-122604729 GCTTCTTGGGAGACTGAGGCAGG + Intergenic
979874931 4:125876476-125876498 GCTACTTGGGAGGGGGAGGCAGG + Intergenic
979956134 4:126955847-126955869 GCTTCTGGGCAGAAAGGGGTGGG + Intergenic
980271490 4:130590231-130590253 GCTGCTGGGGAGACTGAGGCGGG - Intergenic
980696700 4:136365718-136365740 GCTACTGGGGAGACTGAGGCAGG + Intergenic
980703128 4:136457755-136457777 GCTTCAGGGCAGAAAGCGGCAGG + Intergenic
980796272 4:137687726-137687748 GCTACTGGGGAGACTGAGGCAGG - Intergenic
980804502 4:137794287-137794309 GCTACTTGGGAGAGTGAGGCAGG + Intergenic
980831341 4:138132911-138132933 GCTTCTTGGGAGACTGAGGCAGG - Intergenic
980877665 4:138678225-138678247 GCTTGGGGGCACAGTGAGGCTGG + Intergenic
981108910 4:140913147-140913169 GCTACTGGGGAGACTGAGGCAGG + Intronic
981140773 4:141266087-141266109 GCTACTGGGGAGAATGAGGCAGG + Intergenic
981463509 4:145038399-145038421 GCTACTGGGGAGACTGAGGCAGG + Intronic
982172462 4:152675042-152675064 GCTACTGGGGAGGGTGAGGCAGG + Intronic
982226080 4:153167872-153167894 AATTCTGGGCAGAGGGATTCAGG - Intronic
982268632 4:153564175-153564197 GCTACTGGGGAGGGTGAGGCAGG + Intronic
982483325 4:155937724-155937746 GCTACTGGGGAGACGGAGGTGGG - Intronic
983171738 4:164543656-164543678 GCTACTGGGAAGACTGAGGCAGG - Intergenic
983373779 4:166898287-166898309 ACCTCTGGGCAGGGGGAGGAAGG + Intronic
983520622 4:168704550-168704572 GCTACTGGGCAGGCTGAGGCAGG + Intronic
983580139 4:169301328-169301350 GCTACTGGGGAGACTGAGGCAGG + Intergenic
983583343 4:169330449-169330471 AATCCTGGGCAGAGAGAGGCAGG - Intergenic
984215737 4:176910899-176910921 CCTCCTGGGCAGAGGAAGGGCGG + Intergenic
984228650 4:177066254-177066276 GCTTCTAGGGAGACTGAGGCAGG + Intergenic
984263760 4:177471854-177471876 GCTACTGGGCAGGCTGAGGCAGG + Intergenic
984454817 4:179952314-179952336 GCTACTGGGCAGGCTGAGGCAGG - Intergenic
984769816 4:183427631-183427653 GCTTCTGGGGAGGCTGAGGCAGG - Intergenic
985281120 4:188286172-188286194 GCTACTGGGGAGGGTGAGGCAGG + Intergenic
985404998 4:189629043-189629065 GCTTCAGGGGAGAGGGATGGGGG + Intergenic
985478729 5:94105-94127 GCTTCTTGGCAGTGAGATGCTGG - Intergenic
985676246 5:1232688-1232710 GCTTCTGGGCAGAGGGAGCTGGG + Intronic
985689295 5:1298341-1298363 GGTTCTGGGAAGAGGCGGGCAGG - Intergenic
985767396 5:1787219-1787241 GCTGCTGGGCAGGCTGAGGCTGG + Intergenic
985950943 5:3220878-3220900 GCGTCTGGGCAGATGCAGGCCGG + Intergenic
986305855 5:6515560-6515582 GCCTCTAGGCAGACTGAGGCCGG + Intergenic
986308540 5:6533369-6533391 GCTTCTGGGGAGGCTGAGGCAGG + Intergenic
986503886 5:8429808-8429830 GTTCCTGGGCAGAAGGGGGCAGG - Intergenic
986594231 5:9404044-9404066 GCTACTGGGGAGACTGAGGCGGG - Intronic
987218854 5:15768764-15768786 GCCACTGTGCACAGGGAGGCAGG - Intronic
987306080 5:16639181-16639203 GCTACTTGGCAGACTGAGGCAGG - Intergenic
987537694 5:19208979-19209001 GCTTCTGGGCAGAAAGGGGCAGG + Intergenic
988210232 5:28194461-28194483 GCTACTTGGGAGATGGAGGCGGG - Intergenic
988214466 5:28253144-28253166 GCTTCTGGGGAGGCTGAGGCAGG + Intergenic
988404280 5:30804381-30804403 GCTACTCGGGAGAGTGAGGCAGG - Intergenic
988631816 5:32939745-32939767 GCTACTTGGGAGATGGAGGCAGG - Intergenic
988694279 5:33604387-33604409 GCTACTGGGCAGGCTGAGGCAGG + Intronic
988940372 5:36139433-36139455 GCTCCTGGGCAGAAGTGGGCAGG + Intronic
989425432 5:41290788-41290810 GCTTCTCAGCAGAAAGAGGCGGG - Intergenic
989590511 5:43108630-43108652 GCTTCTCGGGAGACTGAGGCAGG - Intronic
989739642 5:44755616-44755638 GCTTGTGGTCAGATGGTGGCTGG - Intergenic
990131920 5:52596588-52596610 GCTACTGGGGAGACTGAGGCAGG - Intergenic
990208969 5:53461024-53461046 GCTACTTGGGAGAGTGAGGCAGG - Intergenic
990265319 5:54069783-54069805 GCTACTCGGGAGACGGAGGCAGG - Intronic
990406028 5:55491744-55491766 GCTACTGGGCAGACTGAAGCAGG + Intronic
990411435 5:55544944-55544966 GCTACTGGGGAGACTGAGGCAGG - Intergenic
990502156 5:56407458-56407480 GCATGTGGGCAGAGTGGGGCTGG + Intergenic
990570223 5:57071036-57071058 GCTTTTAGGCAGATGGAGGAAGG + Intergenic
991420773 5:66439159-66439181 GCTACTGGGGAGACAGAGGCAGG - Intergenic
991716207 5:69453328-69453350 GCTACTGGGGAGACTGAGGCAGG + Intergenic
991729419 5:69569784-69569806 GCTACTCGGGAGGGGGAGGCAGG - Intronic
991775890 5:70085351-70085373 GCTACTGGGAAGACTGAGGCAGG - Intergenic
991805854 5:70424923-70424945 GCTACTCGGGAGGGGGAGGCAGG - Intergenic
991865533 5:71058096-71058118 GCTACTCGGGAGGGGGAGGCAGG + Intronic
991958528 5:72019326-72019348 GCTTGTGGTGAGAGGGTGGCAGG - Intergenic
992366092 5:76091447-76091469 CATTCTGGGCAGTGAGAGGCAGG - Intronic
992993654 5:82311471-82311493 GCTTTTAGGCAAAGAGAGGCGGG - Intronic
993063319 5:83067614-83067636 GCTACTGGGGAGACTGAGGCAGG - Intronic
993364591 5:87020160-87020182 GGTTCTGAGGAGAGGGAGGGAGG - Intergenic
993501632 5:88673220-88673242 CCTTCTGGGGAGAGGGAGAAGGG + Intergenic
993668416 5:90729975-90729997 GCTACTGGGGAGACTGAGGCAGG - Intronic
994245425 5:97471248-97471270 GCTTCTGGGCAGAAGAGAGCAGG - Intergenic
994449969 5:99929536-99929558 TCTCCTGGGCAGAAGGGGGCAGG - Intergenic
994605787 5:101964399-101964421 GCTTCTGGAAGGAGTGAGGCAGG - Intergenic
994692397 5:103034759-103034781 GCTTCTGGGCAGAAAGGGGCAGG - Intergenic
994890940 5:105635696-105635718 GCTACTGGGCAGGCTGAGGCAGG - Intergenic
995194205 5:109345403-109345425 GCTACTGGGGAGACTGAGGCAGG + Intronic
995386592 5:111595961-111595983 GCTCCTGGGCAGAAAGGGGCAGG + Intergenic
995742402 5:115368793-115368815 GCTCCTGGGCAGAAAGGGGCAGG + Intergenic
995977506 5:118058242-118058264 GCTTCTGGGGAGGCTGAGGCAGG - Intergenic
996089923 5:119340628-119340650 GGTTCTGGGCAGGGTGTGGCAGG + Intronic
996214505 5:120850343-120850365 GCTACTGGGGAGGGTGAGGCAGG + Intergenic
997137211 5:131339134-131339156 GCTACTCGGCAGACTGAGGCAGG + Intronic
997305920 5:132836424-132836446 GCTACTGGGGAGGCGGAGGCAGG - Intergenic
997324402 5:133008111-133008133 GCTACTGGGGAGACTGAGGCAGG + Intronic
997645545 5:135479249-135479271 GCTGGTGGGCAGAATGAGGCAGG - Intergenic
997646436 5:135485046-135485068 GCCTCTGGGCAGACTGATGCCGG + Intergenic
997748587 5:136322124-136322146 GCTTCTTGGGAGACTGAGGCAGG - Intronic
997830580 5:137146241-137146263 GTTCCTGGGGAGAGGGAGGAAGG - Intronic
998212636 5:140211833-140211855 GCTACTGGGGAGACTGAGGCAGG + Intronic
998230966 5:140361174-140361196 GTGTCTGGGCAGAGGGAGAAGGG + Intronic
998422413 5:141999740-141999762 GCTACTGGGCAGTCTGAGGCAGG + Intronic
998474313 5:142407791-142407813 GCTACTGGGGAGACTGAGGCAGG + Intergenic
998697575 5:144657437-144657459 GCTACTGGGGAGACTGAGGCAGG + Intergenic
998885209 5:146686889-146686911 ACTCCTGGGCAGCGGGAGGTTGG + Intronic
999029154 5:148270785-148270807 GATTCTTATCAGAGGGAGGCAGG + Intronic
999222450 5:149991820-149991842 GCTACTTGGGAGAGTGAGGCAGG - Intronic
999280092 5:150359400-150359422 GCCCCTGGGGAGATGGAGGCAGG + Intronic
999462724 5:151771176-151771198 GCTGCGGGGCAGAGGAAGGAGGG - Intronic
1000843532 5:166251504-166251526 GCTACTCGGGAGACGGAGGCAGG + Intergenic
1000854252 5:166379425-166379447 GCTCCTGGGCAGAAAGGGGCTGG - Intergenic
1001064446 5:168525106-168525128 GCTGCTGGGGAGGGTGAGGCAGG - Intergenic
1001111255 5:168897994-168898016 GCTTCTGAGCTGAGGGGGACTGG - Intronic
1001276593 5:170355749-170355771 GATTCTGAGCAGAGAGAGGGAGG - Intronic
1001366091 5:171141493-171141515 GCTTCTGGGGAGGCGGAGGGAGG + Intronic
1001566873 5:172705334-172705356 GCTTCTGGGGAGGTTGAGGCAGG + Intergenic
1001600140 5:172923244-172923266 GCATCTGGGAGGAGGGAGGAGGG + Intronic
1001971862 5:175962634-175962656 GCTGCTTGGCAGACTGAGGCAGG - Intronic
1002182526 5:177438254-177438276 GCTACTCGGCAGACTGAGGCAGG + Intronic
1002197858 5:177510911-177510933 GCATCTGGTGAGAGGTAGGCAGG - Intronic
1002245580 5:177881145-177881167 GCTGCTTGGCAGACTGAGGCAGG + Intergenic
1002327399 5:178418765-178418787 GCTTGTCGGCACTGGGAGGCAGG + Intronic
1002558896 5:180066911-180066933 GCTACTGGGGAGACTGAGGCAGG + Intronic
1003092843 6:3118663-3118685 GCTTCGGGGCAGAGTGGGCCGGG + Intronic
1003209975 6:4054019-4054041 GCTACTGGGGAGGCGGAGGCAGG - Intronic
1003594560 6:7462660-7462682 GCTACTTGGGAGACGGAGGCAGG + Intergenic
1003889286 6:10549681-10549703 GCTACTGGGGAGACTGAGGCAGG - Intronic
1003919805 6:10822340-10822362 GCTACTTGGGAGACGGAGGCAGG + Intronic
1003980097 6:11381249-11381271 GCTTCTGGGCAGGGGAAGGAGGG + Intronic
1003998073 6:11563856-11563878 GCTACTGGGAAGACTGAGGCAGG + Intronic
1004194633 6:13492067-13492089 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1004196967 6:13513931-13513953 GCTGCTGGGCAAAGGGAAGTAGG + Intergenic
1004216404 6:13708312-13708334 GCTACTTGGGAGATGGAGGCAGG + Intronic
1004621512 6:17334599-17334621 GCTACTTGGGAGGGGGAGGCAGG + Intergenic
1005237863 6:23786645-23786667 GCTTCTGGGGAGGCTGAGGCAGG + Intergenic
1005632673 6:27723228-27723250 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1005826069 6:29632591-29632613 GGTTGGGGGCCGAGGGAGGCAGG - Intronic
1005899452 6:30205127-30205149 GCTACTGGGCAGGCTGAGGCAGG + Intronic
1006092512 6:31636413-31636435 GCTTCAGGTAAGAGGGGGGCAGG + Exonic
1006209414 6:32382637-32382659 GTTTCTAGATAGAGGGAGGCTGG - Intergenic
1006225853 6:32535530-32535552 TCTCCTGGGCAGAAGGGGGCAGG + Intergenic
1006338261 6:33432044-33432066 GCTGAGGGGCAGAGGGAGGTGGG + Intronic
1006404709 6:33838196-33838218 GTTTGCGGGCAGAGGGAGGAGGG + Intergenic
1007396126 6:41578820-41578842 GCTGCTGGGCAGAGGGGGAGGGG - Intronic
1007415576 6:41689426-41689448 GCGAAGGGGCAGAGGGAGGCAGG - Intronic
1007442944 6:41879589-41879611 GCTGCTGGGCAGAGGATGGGAGG + Intronic
1007597498 6:43060394-43060416 ACCTGTGGGCAGAGGGAGGGAGG + Intronic
1007613524 6:43166338-43166360 GCTTCTGGGGAGTCTGAGGCAGG - Intergenic
1007676810 6:43602777-43602799 GCTACTGGGCAGGCTGAGGCAGG - Intronic
1007685827 6:43666857-43666879 GCTACTTGGGAGACGGAGGCAGG - Intronic
1007718795 6:43873030-43873052 GCTGCTAGGCAAAGGGATGCTGG + Intergenic
1007753044 6:44081583-44081605 GCTGCGGGGCAGAGGGATTCTGG - Intergenic
1008072703 6:47113624-47113646 GCTTCTGGGGAGGCTGAGGCAGG + Intergenic
1008255826 6:49298169-49298191 AATTCTGGGCAGAAGAAGGCGGG - Intergenic
1008307779 6:49925989-49926011 GCTACTTGGCAGACTGAGGCAGG - Intergenic
1008434340 6:51457448-51457470 GCTGCTTTCCAGAGGGAGGCTGG + Intergenic
1008736479 6:54550431-54550453 ACTTCTGGCCAGATGGTGGCAGG + Intergenic
1008846806 6:55976188-55976210 GCTTCTTGGGAGGCGGAGGCAGG + Intergenic
1009762991 6:68032065-68032087 GCTACTCGGGAGATGGAGGCAGG + Intergenic
1010126398 6:72437177-72437199 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1010255035 6:73747979-73748001 GCTACTCGGGAGATGGAGGCAGG - Intronic
1010332103 6:74635310-74635332 TGTTCTAGGCAGAGGCAGGCAGG - Intergenic
1011070542 6:83376689-83376711 GCTTCTTGGGAGACTGAGGCAGG + Intronic
1011525813 6:88263763-88263785 GCTGCAGGGCAGAAGGAGGGAGG + Intergenic
1011547686 6:88499222-88499244 GGGTCTGGGCAGAGGGAGCAGGG + Intergenic
1011563938 6:88654589-88654611 GTTACTGGGAAGAGGGAGGAAGG - Intronic
1011624155 6:89269974-89269996 TCTTCTGGGTGGAGGAAGGCTGG + Intronic
1011694270 6:89897970-89897992 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1012408561 6:98929457-98929479 GCTACTCGGGAGAGTGAGGCAGG + Intronic
1013546950 6:111167778-111167800 GCTTCTTGGCAGGCTGAGGCAGG - Intronic
1013713015 6:112923779-112923801 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1014787071 6:125631341-125631363 GCTTGGGGCCAGTGGGAGGCAGG - Intergenic
1014994982 6:128131596-128131618 ACTTCTGGTCAGAGGGACACTGG - Intronic
1015234132 6:130951434-130951456 GCTACTGGGGAGACTGAGGCAGG - Intronic
1015243195 6:131049170-131049192 GTTTTCGGGCAGAGGGAGGTGGG + Intronic
1015423655 6:133039480-133039502 GCTGCTAGGTAGAGTGAGGCAGG + Intergenic
1015467964 6:133568721-133568743 GCTACTGGGAAGACTGAGGCAGG + Intergenic
1015628054 6:135202478-135202500 GCTTCTCGGGAGACTGAGGCAGG - Intronic
1016081452 6:139862095-139862117 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1016102686 6:140122255-140122277 GCTACTTGGGAGAGTGAGGCAGG - Intergenic
1017089053 6:150742451-150742473 GCTACTGGGGAGACTGAGGCGGG + Intronic
1017102246 6:150858974-150858996 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1017123308 6:151044252-151044274 CTTTCTGGGCAGAGGGTGACAGG + Intronic
1017135680 6:151145589-151145611 GCTACTTGGGAGACGGAGGCAGG - Intergenic
1017354457 6:153486624-153486646 GCTACTGGGGAGGGTGAGGCAGG + Intergenic
1017392199 6:153953139-153953161 GCTACTCGGGAGAGTGAGGCAGG + Intergenic
1017417614 6:154238365-154238387 GCTACTTGGGAGAGTGAGGCAGG - Intronic
1017469252 6:154723437-154723459 GCTTCTGGGGAGGGTGAGGCAGG - Intergenic
1018091328 6:160348645-160348667 GGCTCTGGGCCGCGGGAGGCGGG - Exonic
1018512102 6:164534999-164535021 GCTTCTGGGGAGGCTGAGGCAGG + Intergenic
1018784465 6:167097599-167097621 GCTTCTCGGGAGACTGAGGCAGG - Intergenic
1018857212 6:167683374-167683396 GCTTCTGTCCAGAGGCAGGAGGG - Intergenic
1019099273 6:169614574-169614596 GCTACTGGGGAGACTGAGGCAGG + Intronic
1019289101 7:241267-241289 GCTCCCGGGCAGAGGGCAGCAGG - Intronic
1019304936 7:329054-329076 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1019314331 7:377486-377508 GCCTCTGCGGAGAGGGAGTCGGG + Intergenic
1019395342 7:815307-815329 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1019483944 7:1279472-1279494 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1019490598 7:1311461-1311483 GCTTCTGGGGAGAGGGCAGGGGG + Intergenic
1019597214 7:1863698-1863720 GCTCCTGGGTGGAGGGTGGCCGG + Intronic
1019738085 7:2660257-2660279 GCAACTGGGCAGGGGGAGCCTGG - Intronic
1020236264 7:6358100-6358122 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1020267702 7:6572278-6572300 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1020381470 7:7552057-7552079 GCATCTTGGAAGAGGGAGGTAGG - Intergenic
1020509428 7:9034769-9034791 GCTTCTGTGAGGATGGAGGCAGG + Intergenic
1020547164 7:9546768-9546790 GCTACTCGGGAGAAGGAGGCAGG + Intergenic
1020715391 7:11668304-11668326 GCTTCTCGGGAGACTGAGGCAGG + Intronic
1020748658 7:12111729-12111751 GCGTCAGGGCAGAGGGAGGCGGG + Intergenic
1021097235 7:16547864-16547886 GTTCCTGGGCAGAGGGGGGCAGG + Intronic
1021719166 7:23489773-23489795 GCTACTGGGCAGGCTGAGGCAGG - Intergenic
1022310746 7:29194305-29194327 ACTGCTGGACAGGGGGAGGCGGG - Intronic
1022339489 7:29455059-29455081 CCTTCAGGGCAGGGGTAGGCAGG + Intronic
1022408288 7:30114008-30114030 GCTACTGGGGAGGGTGAGGCAGG - Intronic
1022564543 7:31384845-31384867 GCTCCCGTGCAGAGGGAGACAGG - Intergenic
1023286620 7:38627541-38627563 GCTACTGGGCAGGCTGAGGCAGG + Intronic
1023494848 7:40784168-40784190 GCTTCCGGGCAAAGAGAAGCAGG + Intronic
1025143152 7:56482646-56482668 GCTACTGGGAAGGGTGAGGCAGG + Intergenic
1025236621 7:57239208-57239230 GCATCTGGGCAGCGGGTGGGGGG - Intergenic
1025785661 7:64641315-64641337 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1025830691 7:65046579-65046601 GGTTCTGGGCACATGGAGGGAGG + Intergenic
1025917858 7:65880491-65880513 GGTTCTGGGCACATGGAGGGAGG + Intronic
1026069065 7:67101625-67101647 GCTACTGGGGAGACTGAGGCAGG - Intronic
1026707834 7:72710694-72710716 GCTACTGGGGAGACTGAGGCAGG + Intronic
1026796820 7:73371347-73371369 GCTACTCGGGAGAGTGAGGCAGG - Intergenic
1026925103 7:74186323-74186345 GCTGCTGGGCAGGCTGAGGCAGG - Intronic
1027378833 7:77582670-77582692 GCTTCTCGGGAGACTGAGGCAGG + Intronic
1027506307 7:79020652-79020674 GCTACTGGGGAGACTGAGGCAGG + Intronic
1027710819 7:81599455-81599477 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1028164565 7:87523222-87523244 GCTACTTGGCAGACTGAGGCAGG - Intronic
1028541329 7:91945393-91945415 GCTACTGGGGAGGTGGAGGCAGG + Intronic
1028655032 7:93195336-93195358 GCTTCTTGGGAGACCGAGGCAGG - Intronic
1029015481 7:97311577-97311599 GGTCCTGGGCAGAGGGAGCATGG + Intergenic
1029148635 7:98464693-98464715 GCTGGTGAGCACAGGGAGGCAGG + Intergenic
1029229473 7:99054416-99054438 GCTACTGGGGAGACTGAGGCAGG - Intronic
1029348290 7:99994530-99994552 GCTACTCGGCAGACTGAGGCAGG - Intergenic
1029488661 7:100858476-100858498 GCTACTTGGCAGACTGAGGCAGG + Intronic
1029602601 7:101577583-101577605 GCTACTGGGGAGGGTGAGGCAGG - Intergenic
1030208277 7:106972015-106972037 GCTTCTTGGCAGACTGAGGCAGG + Intergenic
1030881676 7:114888178-114888200 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1030981124 7:116186386-116186408 GCTCCTGGGCAGAAAGGGGCAGG - Intergenic
1031836435 7:126685803-126685825 GCTCCTGGGCAGAAGGGGGAAGG + Intronic
1032203710 7:129843108-129843130 GCTGCTGGGGAGACTGAGGCAGG - Intronic
1032396019 7:131590613-131590635 GCTACTGGGGAGGGTGAGGCAGG + Intergenic
1032411306 7:131694805-131694827 GCTACTCGGGAGACGGAGGCAGG + Intergenic
1032921995 7:136559202-136559224 GCTACTGGGGAGAGTGAGGCTGG + Intergenic
1032989404 7:137375161-137375183 GCTTCTGTGAACAGGGAGTCGGG + Intergenic
1033024035 7:137755402-137755424 GTTTAAGGGCAGAGGGAGGAGGG + Intronic
1033170148 7:139076778-139076800 GCTTCTCGGGAGACTGAGGCAGG + Intronic
1033274208 7:139958906-139958928 GTTTCTCCGCAGAGTGAGGCTGG + Intronic
1033675038 7:143532632-143532654 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1033696798 7:143796808-143796830 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1033871691 7:145762164-145762186 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1034117087 7:148592950-148592972 GCTACTGGGGAGGGTGAGGCAGG - Intronic
1034210429 7:149358235-149358257 GCTCCTGGGCAGAAAGGGGCAGG - Intergenic
1034336288 7:150325576-150325598 GCTTCTTGGCAGTCTGAGGCAGG - Intronic
1034391659 7:150792015-150792037 GCCTCTGGGCAGCGTGAGTCTGG - Intronic
1034422116 7:150995768-150995790 GGGTCGGGGCAGAGGGAGGAGGG - Intronic
1034424471 7:151007328-151007350 GAATCAGGGCAGAGTGAGGCAGG - Intronic
1034433794 7:151053599-151053621 CCTCCTGGGCAGAGGAAGGGAGG + Intergenic
1034456206 7:151172010-151172032 GCTACTGGGCAGGCTGAGGCGGG + Intronic
1034928128 7:155139940-155139962 GCTTCTGGGAAGAGAGGGGGAGG + Intergenic
1034953865 7:155320980-155321002 GCTTCTTGGGAGACTGAGGCAGG - Intergenic
1034975456 7:155446723-155446745 GCTTCTGGGGAGGCTGAGGCAGG + Intergenic
1035153497 7:156893609-156893631 GGACCTGGGCAGAGGGAAGCAGG + Intergenic
1035184063 7:157112079-157112101 CGTTCTGGGCAGAGGAGGGCAGG - Intergenic
1035317401 7:158005184-158005206 GCTACTCGGCAGACTGAGGCAGG - Intronic
1035356896 7:158281175-158281197 GCTGCTTGGGAGAGTGAGGCAGG + Intronic
1035432705 7:158834255-158834277 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1035629589 8:1097529-1097551 TCTACTGAGCAGAGGGAGGTGGG - Intergenic
1035629656 8:1097799-1097821 TCTCCTGAGCAGAGGGAGGTGGG - Intergenic
1035637187 8:1155924-1155946 GCTTCGGGGCTCGGGGAGGCTGG + Intergenic
1035966321 8:4196097-4196119 GCTGCTGGGGAGACTGAGGCAGG + Intronic
1036286085 8:7445184-7445206 GCTTCTCTGCAGAGTGAGGGAGG + Intronic
1036335389 8:7866345-7866367 GCTTCTCTGCAGAGTGAGGGAGG - Intronic
1036397349 8:8380485-8380507 GCTTCTTGGGAGGGTGAGGCAGG + Intronic
1036517227 8:9455513-9455535 ACTACTGGGGAGAGGGAGGAGGG + Intergenic
1036560645 8:9898377-9898399 GCTTCTGTGGAGAGGGTTGCGGG + Intergenic
1036620673 8:10422985-10423007 TGTGCTGGACAGAGGGAGGCAGG - Intronic
1036808334 8:11850305-11850327 GCTACTGGGGAGACTGAGGCAGG + Intronic
1036820256 8:11934353-11934375 GTTTCTGGACTGAGGGAGACCGG - Intergenic
1036833677 8:12040965-12040987 GTTACTGGACAGAGGGAGACCGG - Intergenic
1036855523 8:12287530-12287552 GTTACTGGACAGAGGGAGACCGG - Intergenic
1036915470 8:12799793-12799815 GCTTCCGGGCAGAAGGAGGTGGG - Intergenic
1037145678 8:15569519-15569541 GCTTATGGCCAGAAGGAGCCAGG + Intronic
1037417630 8:18668100-18668122 GTTTCTGGGCTGACCGAGGCCGG - Intronic
1037529952 8:19763497-19763519 GCTACTGGGCAGGCTGAGGCAGG - Intergenic
1037639360 8:20728801-20728823 GCCTCTGGGTAGAGGAAGGATGG - Intergenic
1037865870 8:22441519-22441541 GGCTCGGGGCGGAGGGAGGCTGG + Intronic
1038289871 8:26239465-26239487 GTTTCTGGGCAGAGTGAAGGAGG - Intergenic
1038764886 8:30418326-30418348 GCTACTGGGGAGACTGAGGCGGG - Intronic
1039048076 8:33468126-33468148 GCTACTGGGGAGACTGAGGCAGG + Intronic
1039062195 8:33580765-33580787 GCTCCTTGGCAGTCGGAGGCGGG + Intergenic
1039248045 8:35631200-35631222 GCTACTGGGGAGACTGAGGCAGG + Intronic
1039338813 8:36624054-36624076 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1039401675 8:37275179-37275201 GCTGCTGGGCAGAGCCAGGCAGG + Intergenic
1039555972 8:38475233-38475255 TCCTCTGGGCAGAGGCAGCCGGG - Intergenic
1039780202 8:40777597-40777619 GCATCTGGGCAGAGGGGCGGAGG + Intronic
1039874309 8:41572736-41572758 GCTACTGGGGAGGGTGAGGCAGG - Intergenic
1040314253 8:46252637-46252659 GCTTCTGGGATGGGAGAGGCCGG - Intergenic
1040352246 8:46581228-46581250 GCTACTGGGGAGATTGAGGCAGG + Intergenic
1041274397 8:56142422-56142444 GCTCCTGGGCGGAAGGAGGCAGG + Intergenic
1041319627 8:56599795-56599817 GCTTCTGGGGAGGCCGAGGCAGG + Intergenic
1041488939 8:58410603-58410625 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1041956034 8:63558872-63558894 GCTACTGGGCAGAAAGGGGCAGG + Intergenic
1042250887 8:66755145-66755167 GCTGCTGGGCAGGCTGAGGCAGG + Intronic
1042337070 8:67640223-67640245 GCTCCTGGGCAGAAGGGGGCAGG - Intronic
1042396281 8:68295071-68295093 GGTTATGGTCAGCGGGAGGCAGG - Intergenic
1042406274 8:68408898-68408920 GCTACTGGGGAGACTGAGGCAGG - Intronic
1043388496 8:79769473-79769495 GCTTCTGGGGAGGCCGAGGCAGG - Intergenic
1043568141 8:81570942-81570964 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
1043735033 8:83731000-83731022 GCCCCTGGGCAGAAGGAGGTGGG - Intergenic
1043885566 8:85595800-85595822 GCTACTCGGCAGACTGAGGCAGG + Intergenic
1043988086 8:86717449-86717471 GCTACTGGGGAGACTGAGGCTGG + Intronic
1044588145 8:93886992-93887014 GCTACTCGGCAGGGTGAGGCAGG + Intronic
1044823992 8:96179157-96179179 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1045328671 8:101136561-101136583 GCTACTCGGGAGAGTGAGGCAGG + Intergenic
1045463695 8:102449362-102449384 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1045541941 8:103094879-103094901 GCCTCAGGGAATAGGGAGGCCGG + Intergenic
1045673019 8:104577697-104577719 GCTACTCGGGAGGGGGAGGCAGG + Intronic
1045782910 8:105888442-105888464 GCATTTGGGAAGAGGGTGGCTGG - Intergenic
1046395297 8:113632869-113632891 GCTCCTGGGCAGAAGGGGGCAGG - Intergenic
1046488444 8:114916382-114916404 GCTTCTGGGTAGGCTGAGGCAGG - Intergenic
1046758352 8:117994497-117994519 GCTACTAGGGAGAGTGAGGCAGG + Intronic
1046775556 8:118159829-118159851 GCTACTTGGGAGAGTGAGGCAGG - Intergenic
1047025052 8:120814875-120814897 GCTACTTGGGAGATGGAGGCAGG + Intergenic
1047384806 8:124399020-124399042 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1047547435 8:125832747-125832769 GCTACTGGGCAGGCTGAGGCAGG + Intergenic
1047681065 8:127254544-127254566 GCTTCTTGGGAGGGTGAGGCAGG + Intergenic
1047704701 8:127486137-127486159 GCTACTGGGAAGAGTGAGGCAGG + Intergenic
1047841524 8:128759004-128759026 GCTACTCGGGAGACGGAGGCAGG + Intergenic
1047848480 8:128829681-128829703 GCTTCTCGGGAGGGTGAGGCAGG - Intergenic
1047965700 8:130045081-130045103 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1047972700 8:130099123-130099145 GCTACTGGGCAGACTGAGGTAGG - Intronic
1048339144 8:133525536-133525558 GCTCCTGGGCAGAAAGGGGCAGG - Intronic
1048716102 8:137272030-137272052 GCTTGGGGGCAGAGGGTGGGAGG + Intergenic
1048817968 8:138351799-138351821 GCTACTGGGAAGACTGAGGCAGG - Intronic
1048929546 8:139301424-139301446 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1048986067 8:139735736-139735758 GCTCCTGGGCAGAGCCACGCTGG + Intronic
1048987082 8:139740460-139740482 CATGCTGGGCAGGGGGAGGCAGG + Intronic
1049089135 8:140500940-140500962 GCTTCTGGGGAGGCTGAGGCAGG - Intergenic
1049111693 8:140649080-140649102 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1049117049 8:140697939-140697961 GCTTCTCGGCAGGTTGAGGCAGG - Intronic
1049206757 8:141367155-141367177 GAAGCTGGGGAGAGGGAGGCTGG + Intronic
1049365242 8:142233901-142233923 GATTCTGTGCAGGGGGAAGCTGG - Intronic
1049443804 8:142620952-142620974 CATTCTGGGTGGAGGGAGGCTGG - Intergenic
1049749909 8:144278167-144278189 GCCACTGGGCAGAGGCAGGCGGG + Intronic
1049764354 8:144346884-144346906 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1049829343 8:144690222-144690244 GCTTCTGGGGAGGCTGAGGCAGG - Intergenic
1049851232 8:144831901-144831923 GCTACTGGGGAGAGCGAGGAGGG + Intronic
1049960777 9:736067-736089 GCTACTGGGGAGGGTGAGGCAGG - Intronic
1050182310 9:2934375-2934397 GCTCCTGGGCAGAAGGGGACGGG + Intergenic
1050600767 9:7247999-7248021 GCTACTTGGGAGAGTGAGGCAGG + Intergenic
1050848771 9:10258010-10258032 GCTTGTGGGGAGAAGGGGGCAGG + Intronic
1051014565 9:12459528-12459550 GCTTCTGGGGAGACTGAGGCAGG + Intergenic
1051077594 9:13258971-13258993 GCTACTGGGGAGACCGAGGCAGG + Intronic
1051077618 9:13259258-13259280 GCTACTGGGGAGACTGAGGCAGG - Intronic
1051631469 9:19144915-19144937 GCTACTTGGGAGAGTGAGGCAGG - Intronic
1051899469 9:22023629-22023651 GCTACTGGGGAGACTGAGGCAGG + Intronic
1051936230 9:22446690-22446712 CCTTCTGGGAGGAGGGCGGCGGG - Intergenic
1052114040 9:24626974-24626996 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1052580637 9:30349899-30349921 GTTTCTGAGCAGAGAGGGGCAGG - Intergenic
1052633590 9:31071757-31071779 ATTCCTGGGCAGAAGGAGGCAGG - Intergenic
1052652405 9:31321428-31321450 GCTCCTGGGCGGAAGGAGGTGGG - Intergenic
1052707541 9:32011063-32011085 GTTCCTGGGCAGAAGGGGGCAGG + Intergenic
1052929194 9:34042364-34042386 GCTACTCGGGAGATGGAGGCTGG + Intronic
1053330528 9:37202591-37202613 GCTACTGGGGAGACTGAGGCAGG - Intronic
1053445364 9:38149046-38149068 GGTTCTTGTAAGAGGGAGGCAGG + Intergenic
1053561094 9:39194902-39194924 GCTACTGGGCAGGCTGAGGCAGG - Intronic
1053684662 9:40510384-40510406 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1053825190 9:42015139-42015161 GCTACTGGGCAGGCTGAGGCAGG - Intronic
1053883507 9:42619212-42619234 GCTGCTGGGGAGGGTGAGGCAGG + Intergenic
1053889162 9:42675087-42675109 GCTGCTGGGGAGGGTGAGGCAGG - Intergenic
1053934628 9:43138662-43138684 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054136025 9:61424045-61424067 GCTACTGGGCAGGCTGAGGCAGG + Intergenic
1054222527 9:62426679-62426701 GCTGCTGGGGAGGGTGAGGCAGG + Intergenic
1054228183 9:62482493-62482515 GCTGCTGGGGAGGGTGAGGCAGG - Intergenic
1054279064 9:63114581-63114603 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
1054297756 9:63345846-63345868 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054395772 9:64650357-64650379 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054430416 9:65155552-65155574 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054499964 9:65865969-65865991 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
1054605377 9:67172220-67172242 GCTACTGGGCAGGCTGAGGCAGG + Intergenic
1055430761 9:76241110-76241132 GTTTGTGGGTAGAGGGAGGGGGG + Intronic
1055464838 9:76554265-76554287 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1055489217 9:76787795-76787817 TCCTGTGGGCAGTGGGAGGCGGG - Intronic
1055751178 9:79507058-79507080 GCTTCTGAGCAGGCTGAGGCAGG - Intergenic
1055857440 9:80707232-80707254 TCTGGTGGGAAGAGGGAGGCTGG - Intergenic
1056532197 9:87497824-87497846 CCTTTTGGGCGGAGGGCGGCCGG - Intronic
1056738551 9:89231788-89231810 GCTACTGGGGAGGGTGAGGCAGG + Intergenic
1056863648 9:90210503-90210525 GCTGCTCGGGAGATGGAGGCAGG - Intergenic
1056916262 9:90748944-90748966 GCTGCTCGGGAGATGGAGGCAGG + Intergenic
1056951082 9:91041265-91041287 GATACTGGGCAAAGGGAGGTGGG - Intergenic
1056983658 9:91341193-91341215 CATTGTGGGCAGTGGGAGGCTGG - Intronic
1057205515 9:93169822-93169844 GTTTTTGAGCAGAGAGAGGCTGG + Intergenic
1057371347 9:94477210-94477232 GCTTCTGGGGAGGCTGAGGCAGG + Intergenic
1057523906 9:95783262-95783284 GCTTCTGGGGAGGCTGAGGCAGG + Intergenic
1058120732 9:101135837-101135859 CCTGCTGGGCAGACAGAGGCAGG - Intronic
1058270664 9:102968034-102968056 GCTCCTGGGCAGACAGGGGCAGG - Intergenic
1058645553 9:107128468-107128490 GCTTCTGAACAGCGGAAGGCAGG - Intergenic
1058760666 9:108128294-108128316 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1058805533 9:108587423-108587445 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1059020399 9:110570590-110570612 GCTACTTGGGAGACGGAGGCAGG - Intronic
1059341918 9:113602154-113602176 CCTGCGGGGCAGAGGGAGGGAGG + Intergenic
1059402272 9:114077792-114077814 GCTGCAGGGCAGTGGCAGGCAGG + Intronic
1059404964 9:114093835-114093857 GCCTCTGGACAGAGGGCAGCTGG - Intronic
1059426376 9:114223334-114223356 AATTCTGCTCAGAGGGAGGCTGG + Intronic
1059437102 9:114283611-114283633 GCTGCTGGGCGGAGCGGGGCTGG + Intronic
1059691145 9:116687313-116687335 GCGCGTGCGCAGAGGGAGGCAGG + Exonic
1059713073 9:116887404-116887426 GCTTTTGGACAGAGGGAGAAAGG + Intronic
1059937145 9:119322609-119322631 GCACCTGGGCGGAGGGAGGGAGG - Intronic
1060424113 9:123490475-123490497 GCTACTGGGGAGGGTGAGGCAGG + Intronic
1060565386 9:124586555-124586577 GCTACTTGGCAGACTGAGGCAGG - Intronic
1060571691 9:124647024-124647046 GCTACTGGGAAGACAGAGGCAGG - Intronic
1060595116 9:124843123-124843145 GCTACTGGGCAGGCTGAGGCAGG + Intergenic
1060603197 9:124891754-124891776 GCTACTCGGGAGGGGGAGGCAGG - Intronic
1060734454 9:126057715-126057737 GCTTCTGGGGAAAGGGCCGCCGG - Intergenic
1060863895 9:126979623-126979645 GCTGCTGGAAGGAGGGAGGCGGG + Intronic
1060869998 9:127032070-127032092 GCCCCTGGGAAGAGGAAGGCAGG + Intronic
1061078213 9:128354590-128354612 GCTCCTGGGCTGGGGGAGGGTGG + Intronic
1061349792 9:130054969-130054991 GCTTCTGGGGAGGCTGAGGCTGG + Intronic
1061395784 9:130342715-130342737 GCTGATGGGCACAGGGGGGCAGG - Intronic
1061429896 9:130524196-130524218 GCCTCAGGGGAGAAGGAGGCAGG + Intergenic
1061432520 9:130540245-130540267 GCTGCTGGGGAGACTGAGGCGGG + Intergenic
1061679690 9:132236808-132236830 GATTCTGGGCAGTGGAAGGCAGG + Intronic
1061807134 9:133142813-133142835 GCTGCTGGGCAGGGCGGGGCTGG - Intronic
1061979311 9:134091396-134091418 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1062002842 9:134225457-134225479 TCTGCTGGGCAGTGGGAGGTGGG + Intergenic
1062012089 9:134272837-134272859 GGGTCTGGGCAGTGGCAGGCAGG - Intergenic
1062121580 9:134836676-134836698 GATGCTGGGCAGGGGGAGGCGGG - Intronic
1062252573 9:135605677-135605699 GGCTCTGAGCAGAGGGAGCCAGG - Intergenic
1062280105 9:135748051-135748073 GCTTCTGGGGAGGCTGAGGCAGG - Intronic
1062465190 9:136677753-136677775 GTTGCTGGGGAGACGGAGGCAGG - Intronic
1062468721 9:136692748-136692770 TCCTGTGGGCAGAGGCAGGCGGG + Intergenic
1062523624 9:136969687-136969709 GAGGCAGGGCAGAGGGAGGCTGG - Intronic
1062626973 9:137447812-137447834 GCTGCTGGGCACAGCCAGGCTGG - Exonic
1185542643 X:915804-915826 GTTTCTGAGAAGAGGGAAGCAGG - Intergenic
1185646738 X:1621427-1621449 GCTACTGGGGAGGGTGAGGCAGG - Intronic
1185657210 X:1695144-1695166 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1185722303 X:2391813-2391835 GCTACTGGGGAGACTGAGGCAGG + Intronic
1186750183 X:12613863-12613885 GCTTCTGGGGAGGCTGAGGCAGG + Intronic
1187168876 X:16831319-16831341 GCTGCTCGGAAGAGTGAGGCAGG + Intronic
1187174589 X:16884586-16884608 GCTTCTGGGGAGGCTGAGGCAGG + Intergenic
1187388337 X:18868861-18868883 GCTACTGGGCAGACTGAGGCAGG - Intergenic
1187572096 X:20515139-20515161 GCCACTGGGCAGAGGTAGGATGG - Intergenic
1187879280 X:23831261-23831283 GCTACTCGGCAGACTGAGGCAGG + Intergenic
1187921391 X:24205740-24205762 GCTTCTTGGGAGACTGAGGCAGG + Intronic
1188453529 X:30335575-30335597 GCTTGTGGGTGGGGGGAGGCGGG + Intergenic
1188774346 X:34194910-34194932 GGTTCTGGGGTGAGGGAGGGAGG - Intergenic
1188859893 X:35244185-35244207 GCTCCTGGGCAGAAGGGGCCAGG - Intergenic
1189068517 X:37837648-37837670 GCTACTCGGCAGGCGGAGGCAGG - Intronic
1189429564 X:40934847-40934869 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1189435749 X:40991173-40991195 GCTACTGGGCAGACTGAGGCAGG - Intergenic
1189620972 X:42836952-42836974 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1189665841 X:43354114-43354136 GCTACTCGGCAGATTGAGGCAGG - Intergenic
1189816696 X:44831807-44831829 GCTACTGGGGAGGGTGAGGCAGG - Intergenic
1190141204 X:47846716-47846738 GCTTCTGGGCAGCTGGAATCTGG - Intronic
1190290776 X:48990801-48990823 GCTGATGGGGTGAGGGAGGCAGG - Intronic
1190338634 X:49278906-49278928 GCTTCTTGGATGAGGGAGACTGG - Intronic
1190388311 X:49906352-49906374 GCTACTGGGCAGGCTGAGGCAGG + Intergenic
1190767456 X:53487397-53487419 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1190880256 X:54486873-54486895 GCTACTGGGAAGACTGAGGCAGG + Intronic
1191660377 X:63643468-63643490 GCTACTGGGGAGATTGAGGCAGG - Intronic
1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG + Intergenic
1192087028 X:68110368-68110390 GCCTTTGGGCAGATAGAGGCAGG + Intronic
1193572797 X:83164119-83164141 GCTACTCGGGAGACGGAGGCAGG + Intergenic
1194055013 X:89121062-89121084 GCTACTTGGGAGAGTGAGGCAGG - Intergenic
1194290710 X:92068649-92068671 GCTACTTGGGAGACGGAGGCTGG - Intronic
1194983066 X:100460225-100460247 GCTTCTGGGGAGGCTGAGGCAGG + Intergenic
1194992812 X:100563400-100563422 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1195007252 X:100698212-100698234 GCTGCTGGGGAGACTGAGGCAGG - Intronic
1195655002 X:107324854-107324876 GCTTCTGGGCTGAAGGGGGCGGG + Intergenic
1195920463 X:109978312-109978334 GCATCTGGGCAGAGACCGGCAGG + Intergenic
1197149827 X:123207997-123208019 GCTTCTGAGCAGCAGGAGGAAGG - Intronic
1197213392 X:123846381-123846403 GCTGCTGGGGAGACTGAGGCAGG + Intergenic
1197218812 X:123892253-123892275 GCTACTGGGGAGACTGAGGCAGG + Intronic
1197492948 X:127140727-127140749 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1197512426 X:127386790-127386812 GCTGCTGGGAAGACTGAGGCAGG - Intergenic
1197707391 X:129644062-129644084 GCTTCTTGGGAGGGTGAGGCAGG + Intergenic
1197782652 X:130172626-130172648 ACCTGTGGGCAGAGGGAGGCAGG + Intronic
1198189470 X:134288015-134288037 GCTCCTGGGCAGAAAGGGGCAGG + Intergenic
1198276167 X:135097784-135097806 GCCTCTGCGGAAAGGGAGGCCGG + Intergenic
1199188012 X:144939484-144939506 GCTTCTGGGTGGAAGGGGGCAGG - Intergenic
1199425727 X:147698706-147698728 GCTTCTTGGGAGACTGAGGCAGG + Intergenic
1200061784 X:153487048-153487070 GCTCCTGGAGGGAGGGAGGCTGG - Exonic
1200091284 X:153637290-153637312 GCTCCTGGGCAGAGAGAAGGTGG - Intergenic
1200102120 X:153693405-153693427 GCTGCTGGGCAGGGCGGGGCAGG - Intronic
1200244818 X:154517309-154517331 TCTCATGGGCAGAGGGAGCCCGG - Intergenic
1200269120 X:154664871-154664893 GCCTCTGGGGAGATTGAGGCAGG - Intergenic
1200381054 X:155837678-155837700 GCTACTGGGGAGACTGAGGCAGG + Intergenic
1200412336 Y:2873171-2873193 GCTACTTGGCAGACTGAGGCAGG - Intronic
1200608222 Y:5293239-5293261 GCTACTTGGGAGACGGAGGCTGG - Intronic
1200848373 Y:7856016-7856038 GCTACTGGGGAGACTGAGGCAGG - Intergenic
1201317833 Y:12665043-12665065 GCTTCTCGGGAGACTGAGGCAGG + Intergenic
1201570985 Y:15414238-15414260 GCATGGGGGCAGAGAGAGGCAGG + Intergenic
1202167230 Y:22002798-22002820 GTTGCTGGGCAGATGGAGGATGG + Intergenic
1202244001 Y:22797551-22797573 GCTACTTGGGAGAGTGAGGCAGG + Intergenic
1202318985 Y:23612089-23612111 GTTGCTGGGCAGATGGAGGATGG + Intergenic
1202376394 Y:24241537-24241559 GCTTCTTGGCAGGTTGAGGCAGG + Intergenic
1202396989 Y:24431301-24431323 GCTACTTGGGAGAGTGAGGCAGG + Intergenic
1202473794 Y:25238791-25238813 GCTACTTGGGAGAGTGAGGCAGG - Intergenic
1202494386 Y:25428582-25428604 GCTTCTTGGCAGGTTGAGGCAGG - Intergenic
1202551784 Y:26057968-26057990 GTTGCTGGGCAGATGGAGGATGG - Intergenic