ID: 1169070090

View in Genome Browser
Species Human (GRCh38)
Location 20:2721030-2721052
Sequence TTGATTATGATGTACATTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 277}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169070090 Original CRISPR TTGATTATGATGTACATTGA TGG Intronic
901434621 1:9239462-9239484 TTGATTTTTATCTGCATTGATGG + Intronic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
909250551 1:73348609-73348631 TTGCTTAGGATGTTCAGTGAAGG + Intergenic
910059827 1:83076894-83076916 ATGATTATCATCTATATTGAAGG + Intergenic
910520026 1:88109917-88109939 TTGATTTTCATGTACATTATAGG + Intergenic
910662026 1:89684036-89684058 TTCATAATGATGTATCTTGATGG + Intronic
911266110 1:95745077-95745099 TTGATTGTGATGTGCTTTGTTGG + Intergenic
912133414 1:106629808-106629830 TTAATTATAATTCACATTGAGGG - Intergenic
912277587 1:108275722-108275744 TTGTGTATGATGTTCATTGTAGG + Intergenic
912290639 1:108418636-108418658 TTGTGTATGATGTTCATTGTAGG - Intronic
914416075 1:147483528-147483550 TTGATTATAATGTACCTTGGTGG - Intergenic
915790025 1:158658678-158658700 TTGATTATGCTATAACTTGATGG - Intronic
917672332 1:177284598-177284620 TTGATTATTATGGACTTTAAAGG - Intergenic
918178083 1:182062370-182062392 TTTATTAGGATGAACATTCAGGG + Intergenic
918224279 1:182466195-182466217 TTGAGTATGATGTTCACTGTGGG - Intronic
918641410 1:186845324-186845346 ATGATTATTTTGTACATTTATGG + Intronic
919289955 1:195616559-195616581 TGGATTATAATGTACTGTGATGG - Intergenic
919677971 1:200405692-200405714 TTCATTAAAATGTACATTAAAGG + Exonic
921332865 1:214057393-214057415 TTGATAAGTATGTTCATTGAAGG + Intergenic
923227662 1:231954157-231954179 TTGGTTATGATGAATATTTATGG + Intronic
923443349 1:234042210-234042232 TTGATAATGATCCACATGGAAGG - Intronic
924078438 1:240366327-240366349 TTGGTTATGATTTACATTTTTGG - Intronic
924746514 1:246839203-246839225 TTGCTTATGATCTACATTCACGG + Exonic
1066001257 10:31105981-31106003 TTGATCATGAGGTGCTTTGAGGG + Intergenic
1066374509 10:34845459-34845481 TTGATGATGATGGATAATGATGG - Intergenic
1068032806 10:51724307-51724329 GTGATTATAATGTACATAGATGG + Intronic
1068147513 10:53090085-53090107 TTGATGTTGAAGAACATTGATGG + Intergenic
1071025539 10:81108527-81108549 ATGATTATGACGTACATCCATGG - Intergenic
1071780588 10:88839962-88839984 GTGATTCTGATGCACAGTGAGGG + Intronic
1072598848 10:96903720-96903742 TGGATTGTGATTTAGATTGAAGG + Intronic
1074659665 10:115639086-115639108 TTAATTATGATGTATTTTGGTGG - Intronic
1076962454 10:133775524-133775546 TTGATTATGATAAAAAATGATGG - Intergenic
1077698358 11:4416125-4416147 TTCATTAAGATTTACATTTATGG + Intergenic
1081260024 11:40948177-40948199 TTGAATATGGAGTATATTGAGGG - Intronic
1088453775 11:110012029-110012051 TTGATTATGTTGTACCTTGGTGG - Intergenic
1089902039 11:121996589-121996611 TTGATTATGTAGTTCATGGAGGG - Intergenic
1091372834 11:135075341-135075363 TTGATTATGATAAAAAATGATGG - Intergenic
1094424602 12:30305217-30305239 TTGATTATTATAAAGATTGAAGG - Intergenic
1095413756 12:41952940-41952962 TTGACCAAGATGTACATTGAAGG + Intergenic
1097691715 12:62740166-62740188 TTGATAATAATCTACATTCAGGG + Intronic
1099963903 12:89424346-89424368 ATGATTATAATGTACAGTCAGGG + Intronic
1100580111 12:95930709-95930731 TGGAATTTGATGTACATTGCAGG - Intronic
1101133378 12:101712355-101712377 TTAATTACGATGTGCCTTGATGG + Intronic
1101311335 12:103582649-103582671 TTCATTATGCTGTACTCTGAGGG - Intergenic
1105981647 13:25522520-25522542 TTGAGTATGATGTTGATTGTGGG + Intronic
1106040924 13:26092444-26092466 TTGATTATGTTGTATTTTGAGGG + Intergenic
1107952076 13:45472274-45472296 TTGAATATGATGTGCACAGAGGG + Intronic
1108271536 13:48765024-48765046 TTGTTTATTATATATATTGAAGG + Intergenic
1108938785 13:55921944-55921966 TTCATTTTCATGTACAGTGAAGG - Intergenic
1108989474 13:56637145-56637167 TTGTTTATCATGTATACTGATGG - Intergenic
1109413769 13:62008812-62008834 GTGATTATGATGTTCAATGTAGG - Intergenic
1109447458 13:62461036-62461058 TGGATTATGAAGTGCATTGTAGG + Intergenic
1109490626 13:63094398-63094420 TTGCTTATAATGTAGATTTATGG + Intergenic
1110477518 13:75934201-75934223 TTTACTTTCATGTACATTGAAGG - Intergenic
1111605954 13:90539284-90539306 TTGATTATTATGTGTCTTGAGGG - Intergenic
1111748668 13:92298894-92298916 TTAATTATGATTTGCATTTATGG - Intronic
1112376047 13:98842090-98842112 TTCAATATGATGTACAGTAAAGG + Intronic
1112555381 13:100463261-100463283 TAGATTCTGAGGTTCATTGAAGG + Intronic
1112790563 13:102997903-102997925 TTTATTTTGATGTACTTGGAGGG + Intergenic
1113988962 13:114343433-114343455 TTGATTATGATCAAAAATGATGG - Intergenic
1115197241 14:30814610-30814632 TTGATTATGGTGTGCTTTGGGGG - Intergenic
1115989489 14:39137733-39137755 GTGATCATGTTGTACATTTATGG - Intergenic
1116113275 14:40613936-40613958 TTGATTAGGAATTACATTCATGG + Intergenic
1119914941 14:78389704-78389726 TTGTTTATGATGTTCTTTGAGGG + Intronic
1120236570 14:81898416-81898438 TTGAGTATGATGTTCACTGCTGG + Intergenic
1121187566 14:91989300-91989322 TTGTTTATGATGTAAGGTGAGGG + Intronic
1121944226 14:98103761-98103783 GTGATTCTGATGTACAGAGAAGG + Intergenic
1122332248 14:100929460-100929482 TAGATTATAAAATACATTGAGGG - Intergenic
1125197219 15:37060918-37060940 TTAATTATCATCTACTTTGAGGG + Intronic
1125372836 15:38996885-38996907 CAGATTATGATGTACAATAAAGG + Intergenic
1125388946 15:39171472-39171494 ATTATTGTGATGGACATTGACGG + Intergenic
1126213208 15:46123922-46123944 TTGAATATGATGTAAGTTGTAGG + Intergenic
1126244908 15:46493455-46493477 TTCAGTATGATGTTCATTGTGGG - Intergenic
1127651398 15:61011923-61011945 TTGATAGAGATGTAAATTGAGGG - Intronic
1128799931 15:70490843-70490865 TTGATTCTGATGCCCAGTGAAGG - Intergenic
1130644137 15:85708846-85708868 TTGATTCTGATGCACATTCCAGG - Intronic
1135056295 16:19234562-19234584 TTGATGATGATGATAATTGATGG + Intronic
1135179579 16:20261160-20261182 TTGATTGTGTTGAACATTGTTGG + Intergenic
1135912054 16:26570434-26570456 TTTATTGAGCTGTACATTGATGG - Intergenic
1136555887 16:31007675-31007697 TTTATTTTGGAGTACATTGAGGG - Intronic
1138799623 16:60012239-60012261 TTCATTGTGATGTATCTTGACGG - Intergenic
1143230634 17:5351441-5351463 GTGTTTATGATATACATTTAGGG + Intronic
1146699666 17:34945543-34945565 TGGATTAGGATGTACTTAGAAGG - Intronic
1149903610 17:60505296-60505318 TGGATTATGTTCTACATTGGGGG - Intronic
1150414978 17:64979953-64979975 TTGATGATAATGTCCAATGATGG + Intergenic
1150796656 17:68243726-68243748 TTGATGATAATGTCCAATGATGG - Intergenic
1152603294 17:81276261-81276283 TTCATTATGAAGTGGATTGAAGG - Intronic
1152951568 17:83237189-83237211 TTGATTATGATCAAAAATGATGG - Intergenic
1153558329 18:6341827-6341849 TTGATTATAATGTATCTTGGTGG - Intronic
1153908006 18:9680359-9680381 TTTATTATGATGTGCATTGATGG + Intergenic
1154249658 18:12733742-12733764 TTGTATATGATGTAGATTAAGGG - Intergenic
1155275154 18:24180333-24180355 TTGTATATGTTGTACATGGATGG - Intronic
1155899451 18:31370140-31370162 TTGGTTGTGATGAACATGGATGG + Intergenic
1157422760 18:47560162-47560184 ATGATGATGATGTGCAGTGAAGG + Intergenic
1159470254 18:68844112-68844134 TTCTTTATGATGTATATTTAAGG + Intronic
1162288203 19:9756808-9756830 TTGATTATGAAGTACTATGAAGG + Intronic
1164036699 19:21462205-21462227 TTGATAATGTTGTGAATTGAAGG + Intronic
1164801193 19:31078277-31078299 TTAATTTTGAAGAACATTGAGGG - Intergenic
1168566059 19:57424777-57424799 TTGTTTAACATTTACATTGAAGG + Intronic
1168727599 19:58596228-58596250 TTGATTATGATCAAAAATGATGG - Intergenic
924958553 2:12363-12385 TTGATTATGATCAAAAATGATGG + Intergenic
925518727 2:4716038-4716060 TTGATTATTATATGCCTTGAGGG - Intergenic
927768093 2:25831783-25831805 TTAATTATGATGTATCTTGGTGG - Intronic
928953071 2:36832234-36832256 ATGATTGTGATGTACCATGAAGG + Intergenic
930741655 2:54837853-54837875 TAGATTCTGGTGTACATTGAGGG + Intronic
931076559 2:58720996-58721018 GTGTTTGTGAGGTACATTGATGG + Intergenic
931297269 2:60939732-60939754 TTGACTATGAAGGACACTGATGG + Intergenic
931793491 2:65687351-65687373 TTGGTTTTGATTTACAATGAGGG - Intergenic
932085886 2:68760216-68760238 TTGAGTATGATGTTCACTGTGGG - Intronic
933376214 2:81482477-81482499 TTGAGTATGATGTTAATTGTGGG + Intergenic
933891537 2:86776013-86776035 TTAATTATAATGTACATCAAAGG + Exonic
934620723 2:95803064-95803086 TTGCTTAAGGTATACATTGAAGG + Intergenic
934739761 2:96711751-96711773 TAGATAATGATGGATATTGATGG - Exonic
934812716 2:97296653-97296675 TTGCTTAAGGTATACATTGAAGG - Intergenic
934824978 2:97411819-97411841 TTGCTTAAGGTATACATTGAAGG + Intergenic
935137203 2:100317902-100317924 TTGACTATAATGTACTTGGATGG + Intronic
935935756 2:108181497-108181519 TTGATTTTGACCTACTTTGATGG - Intergenic
935962175 2:108436492-108436514 TTTATTATAATGGACATTGGTGG + Intergenic
936547266 2:113403481-113403503 TTGCTTAAGGTATACATTGAAGG - Intergenic
936570955 2:113614966-113614988 TTGATTATGATCAAAAATGATGG + Intergenic
939221066 2:139302057-139302079 TTGATTAACTAGTACATTGAGGG + Intergenic
939455123 2:142423968-142423990 TAGTTTCTGATGTACATTTAAGG + Intergenic
939691175 2:145262777-145262799 ATGATTATGTTGAACAGTGATGG - Intergenic
939775025 2:146374387-146374409 TTAATTATGATATGCATTAAAGG + Intergenic
940922922 2:159329678-159329700 TTGATTTTGATATATAATGAAGG - Intronic
941141273 2:161785718-161785740 TTGAGTATGATGTAAACTGTAGG - Intronic
941467773 2:165850353-165850375 TTTATTATGATGTTAATTGAGGG + Intergenic
942014750 2:171801445-171801467 TTGATTATGATATCTATTGTGGG - Intronic
943849711 2:192702735-192702757 TTCATTATGAAGTAAAATGAGGG + Intergenic
944213079 2:197226681-197226703 GTGATTCTGATGTATAGTGAGGG + Intronic
944522056 2:200581611-200581633 TTAATTAGGATGTACTTTCATGG + Intronic
945400103 2:209371004-209371026 TTAATTATTATATACATTTATGG + Intergenic
945670552 2:212797621-212797643 TTGATGATGATGAGCTTTGAAGG + Intergenic
947475334 2:230442540-230442562 TTGATTAAGATGCATATTCAAGG + Intronic
947784370 2:232802365-232802387 TTGAATATGATGTCCACTGTGGG + Intronic
947887665 2:233587257-233587279 TTGTTTATAATTTCCATTGAAGG + Intergenic
947893885 2:233650286-233650308 TTGTTTATAATTTCCATTGAAGG + Intronic
1169070090 20:2721030-2721052 TTGATTATGATGTACATTGATGG + Intronic
1171098815 20:22361890-22361912 TTGAGTATGATGTCAATTGTGGG - Intergenic
1173230711 20:41194204-41194226 TTGAGTATGATGTTAATTGTGGG + Intronic
1175972591 20:62694250-62694272 TTTATTATGAAGGACATTGCAGG + Intergenic
1177168673 21:17631822-17631844 TTGATTATGATGACAATTAAAGG + Intergenic
1177863877 21:26489276-26489298 TTGAATATGTTGTAGATTGTAGG + Intronic
1180263039 21:46688030-46688052 TTGATTATGATCAAAAATGATGG - Intergenic
1180922571 22:19528713-19528735 TGGTTTATGATGTACTTTGGTGG - Intergenic
1181004717 22:20007464-20007486 TTTATTCTGATGTAAATGGACGG - Intronic
1181391358 22:22584595-22584617 TTGATTATGATGTTAGTTGTGGG + Intergenic
1185429240 22:50795904-50795926 TTGATTATGATCAAAAATGATGG - Intergenic
949221931 3:1645626-1645648 TTGATTGTGAACTACTTTGAGGG - Intergenic
950796943 3:15517841-15517863 TTCATTATGATGAACATGAATGG - Intronic
952596028 3:35018503-35018525 TTGATTATGAAAATCATTGAAGG + Intergenic
953564892 3:44022864-44022886 TTTATTTTCATGTACCTTGATGG - Intergenic
953850251 3:46460597-46460619 TTTAGTATGATGTTCATTGCAGG - Intronic
954993692 3:54862908-54862930 TTGAATATGAGGTACAATTAGGG - Intronic
958729080 3:97941148-97941170 TTTATTCTGATGTACACTGCAGG - Exonic
959002820 3:100984587-100984609 GTGATTTTGATGAACATTTAAGG - Intronic
959174104 3:102883540-102883562 TTTTTAATGATGCACATTGAGGG + Intergenic
960083051 3:113561661-113561683 GGGATTCTGATGTACATGGATGG - Intronic
960544396 3:118896101-118896123 ATGATTATGATATCCAGTGAGGG + Intergenic
960796362 3:121492569-121492591 TTGATTTTGATCTGCTTTGATGG - Intronic
961073122 3:123955268-123955290 TTGATTATGTTGTCCCTTGGAGG - Intronic
963920075 3:150896882-150896904 ATGATTTTGATTTCCATTGAAGG - Intronic
964032726 3:152156263-152156285 TTGACTATTATTTTCATTGAAGG + Intergenic
964792045 3:160461427-160461449 CTGATTATGATGAACATGAAAGG - Intronic
965859992 3:173137121-173137143 CTGATTTAGATGTACAGTGATGG - Intronic
967635945 3:191803084-191803106 TTGAGTATGATGTTTATTGTGGG - Intergenic
968338433 3:197934159-197934181 TTCATTATGATGTTCATTCTGGG + Intronic
968373483 4:17274-17296 TTGATTATGATAAAAAATGATGG + Intergenic
971142402 4:23938520-23938542 CTGTTTAAGATGTACAATGATGG + Intergenic
971298085 4:25418021-25418043 TTGATTTTGTTGTAAATTGATGG + Intronic
971645113 4:29189506-29189528 TTCATTATGATATATATTTATGG - Intergenic
971803543 4:31324433-31324455 TTCATAATGATGTACCTTAAAGG - Intergenic
972139465 4:35938993-35939015 TATATTATAATGTAGATTGAAGG - Intergenic
973037856 4:45428884-45428906 TTGATTATGTTGTACATGTGTGG - Intergenic
973194238 4:47421486-47421508 TTGATTATGAAGAACATTCCAGG - Intronic
974093205 4:57334008-57334030 TTGTTTAAGATGTAAAATGAGGG + Intergenic
974361237 4:60882604-60882626 TTTATTATGATGTACATATTAGG - Intergenic
974606091 4:64152786-64152808 ATGATTCTAATGTACAGTGAAGG + Intergenic
975242893 4:72082552-72082574 ATATTTATGGTGTACATTGATGG + Intronic
977009559 4:91620212-91620234 TTGATGATTAGTTACATTGATGG + Intergenic
977174742 4:93806596-93806618 TTGTTTACGATGGACATTTAAGG + Intergenic
978349053 4:107802046-107802068 TTGATTCAAATGTACATGGAAGG + Intergenic
978411187 4:108427774-108427796 TTGATTATGCTGCCCATTGCAGG - Intergenic
979336268 4:119466525-119466547 TTGTTTCTGATGTACATGGTAGG + Intergenic
979659428 4:123237026-123237048 GTGATTGTGATGCACAGTGAAGG + Intronic
979973122 4:127162232-127162254 TTTATTGTGCTGTCCATTGAGGG - Intergenic
980030775 4:127826896-127826918 GTAATTATGTTGTACATAGAGGG + Intronic
980833295 4:138157756-138157778 TTGAAGATGATGTGAATTGATGG - Intergenic
980999175 4:139811625-139811647 TTTATTTTGATGCACATAGATGG + Intronic
981132867 4:141177510-141177532 TTGATATTAATGTACATTGCAGG - Intronic
982048472 4:151474318-151474340 CTCATTATGCTTTACATTGATGG + Intronic
982140451 4:152312591-152312613 TTCATAATGATGAACATGGATGG + Intergenic
983120421 4:163877353-163877375 TTAATTCTGATGTGCAATGAGGG - Intronic
983239171 4:165211868-165211890 TTGTTTCTGATGTACATGGTAGG + Intronic
983642892 4:169959963-169959985 TTGATCATCTTGAACATTGAAGG + Intergenic
983698868 4:170566924-170566946 TTGACTTTTATGTACATTAAAGG + Intergenic
985068029 4:186142533-186142555 TTGATTATGGAGTACAGTGGAGG + Intronic
985461912 4:190115279-190115301 TTGATTATGATAAAAAATGATGG - Intergenic
985465687 4:190193004-190193026 TTGATTATGATAAAAAATGATGG - Intergenic
985910259 5:2873972-2873994 TTGATTATGATCTTCAGTGTTGG - Intergenic
986768669 5:10951304-10951326 TGGTCTATGATGTACATAGATGG - Intergenic
988189124 5:27904155-27904177 TTATATATGATGTACATTAAAGG + Intergenic
988403540 5:30794452-30794474 TTGATTTTTATGTGCACTGATGG - Intergenic
989270119 5:39522841-39522863 TAGATTAAGCTGAACATTGAGGG - Intergenic
989615172 5:43331560-43331582 TTTATTATTGTATACATTGAAGG + Intergenic
989750846 5:44891417-44891439 TTGATTTTTGTGTACAGTGAGGG + Intergenic
991902597 5:71475409-71475431 TTGCTTATGAAGTGCACTGAAGG - Intronic
992257925 5:74940617-74940639 ATGGGTATGATGTACATTAATGG + Intergenic
993700850 5:91117367-91117389 TTTATTATAATATATATTGAGGG - Intronic
994166161 5:96610547-96610569 TTCAGTATGATGTTCATTGTGGG - Intronic
995704010 5:114966560-114966582 TTGATTATGATGTTCATCATGGG - Intergenic
996153586 5:120070716-120070738 CTTATTATGATGTACTTTAATGG - Intergenic
999190739 5:149745334-149745356 TTGATTCTGATGTGCACTCATGG - Intronic
999718699 5:154382427-154382449 TTGATTCTGAGGTACACAGAAGG - Intronic
1004960073 6:20778112-20778134 TTTATTTTTATGTACAGTGAAGG - Intronic
1005558845 6:27016771-27016793 TTGATTATGATGTTAGTTGTGGG - Intergenic
1005633977 6:27735677-27735699 TTGAATATGATGTTAGTTGAAGG + Intergenic
1005824754 6:29626103-29626125 GTGATTCTTATGTACACTGAAGG + Intronic
1007990194 6:46247112-46247134 GTGATTCTGATGTACAGTAAAGG - Intronic
1008128204 6:47691812-47691834 GTGATTCTAATGTACATTCAAGG + Intronic
1008145582 6:47887956-47887978 TTGATAATGTTGTTCAATGAGGG + Intronic
1009964174 6:70560735-70560757 TTAATTATTATGTACATATAAGG - Exonic
1010243886 6:73644410-73644432 TTGATTATGATGAACTTTTATGG + Exonic
1010338402 6:74717767-74717789 TTGAGTATGATGTTCACTGTGGG + Intergenic
1010804198 6:80215665-80215687 TTTATTATGATTTACATTTTAGG + Intronic
1010830351 6:80520248-80520270 TTGGTAATGATGTAGATTTATGG + Intergenic
1013768916 6:113605425-113605447 TTCATTATGATAAAGATTGAAGG - Intergenic
1014134144 6:117868078-117868100 TTTATAATGATATACATTTATGG - Intergenic
1014189727 6:118480863-118480885 TTGATTAAGATGATCATTGCAGG + Intronic
1016235716 6:141863086-141863108 TTTATAATGATATACATTTATGG - Intergenic
1018150816 6:160936445-160936467 TTGATTATGATGTTAACTGTGGG + Intergenic
1020641945 7:10766380-10766402 TTTATTATGAAGTTCATTGGAGG - Intergenic
1021463514 7:20915123-20915145 TTGATTATGATATACACAAAGGG + Intergenic
1021529456 7:21627443-21627465 TTGATTTTTGTTTACATTGAGGG + Intronic
1021858384 7:24880565-24880587 ATCATTATGGTGTACTTTGAAGG - Intronic
1024515876 7:50255117-50255139 TTTATTGTGATGTTCTTTGAAGG + Intergenic
1024726164 7:52198190-52198212 TTGAGTATGATGTTCATGGTGGG + Intergenic
1026433459 7:70371286-70371308 ATGATTCTGATGCACAGTGAGGG + Intronic
1027853183 7:83475196-83475218 TTCATTATTATGTAAAATGAAGG + Intronic
1027853343 7:83477361-83477383 ATAATTAAGATGTACATTGATGG - Intronic
1028901932 7:96111334-96111356 TTCATTATGATGTACTTTGGTGG + Intergenic
1030156816 7:106464111-106464133 TTGATTTTGATCCACATTGATGG + Intergenic
1030259450 7:107547399-107547421 TTGATTATGATGTTAGTTGTGGG - Intronic
1030303662 7:107999289-107999311 TTGTTTATGATTTGCCTTGATGG - Intronic
1030453086 7:109737502-109737524 TTGATTATGATGTGCCTTAGTGG - Intergenic
1030923256 7:115419073-115419095 TTTATTTTGCTGTACATTAATGG + Intergenic
1035323312 7:158048513-158048535 ATGATTATGATGCTTATTGATGG - Intronic
1035513915 8:215418-215440 TTGATTATGATCAAAAATGATGG + Intergenic
1039172465 8:34763346-34763368 TTGAATAAAATGTCCATTGAAGG - Intergenic
1040523741 8:48199881-48199903 AGGATTATGATGTACAATGTGGG - Intergenic
1040922526 8:52638100-52638122 TTGAGTATGATGTTAATTGTGGG + Intronic
1041463097 8:58133041-58133063 TTTATTTTAATGTATATTGAAGG + Intronic
1042670241 8:71254603-71254625 TTGAGTATGATGTTCGTTGTGGG - Intronic
1043657567 8:82689264-82689286 TTTAGTATGATGTTCATTGTGGG - Intergenic
1044043589 8:87401292-87401314 TTGATTTTGATGTAAATTTAGGG - Intronic
1044532977 8:93329174-93329196 TTTAGTATAATGTACACTGATGG + Intergenic
1044638326 8:94351620-94351642 TTGAATATGATATTCATTGCAGG - Intergenic
1045124787 8:99077687-99077709 TTGAGTATAATGTACCTTGGAGG + Intronic
1046096231 8:109564924-109564946 TTTATCATTATGCACATTGAAGG - Exonic
1046157832 8:110316752-110316774 TGAATTATGTTTTACATTGATGG + Intergenic
1047527383 8:125645171-125645193 GTAATTATGAAGTACATTGGAGG - Intergenic
1050045840 9:1544391-1544413 ATTAGTATGATGTTCATTGAGGG + Intergenic
1050072748 9:1833775-1833797 CTGATGATTATGTACCTTGAAGG + Intergenic
1050796439 9:9550863-9550885 GTGATTTTAATTTACATTGATGG - Intronic
1051600675 9:18869781-18869803 TTGACTATGATGTGCATAGGTGG + Intronic
1051616994 9:19015990-19016012 TTGATTCTCAGGTACACTGAAGG + Intronic
1051846791 9:21460366-21460388 TTGAGTATGATGTTAATGGAGGG + Intergenic
1051980531 9:23009803-23009825 TTTATTATTATGTATATTTAAGG + Intergenic
1052062298 9:23975110-23975132 TTGCTTAGAATGTACACTGAGGG - Intergenic
1053552235 9:39095426-39095448 TTGAGTATGATGTTAATTGCAGG + Intronic
1053737920 9:41113373-41113395 TTTATTATGATCCACATTGCAGG + Intergenic
1054690429 9:68317947-68317969 TTTATTATGATCCACATTGCAGG - Intergenic
1055803849 9:80070707-80070729 GTGATTTTAATGTACATCGAGGG + Intergenic
1055817244 9:80221029-80221051 ATGATTATGATGTACAACTAGGG - Intergenic
1055856609 9:80695995-80696017 TTGATTATGCTACACATTGAAGG - Intergenic
1056336242 9:85572789-85572811 TTGTTTAGGAGGTACTTTGAAGG + Intronic
1056472618 9:86920641-86920663 ATGATTATGATTTACATAGGTGG + Intergenic
1057421744 9:94918355-94918377 CTGGCTATGATGTAGATTGAGGG + Intronic
1057848586 9:98545625-98545647 GTGATTATGATGCTCAGTGAGGG + Intronic
1059181013 9:112212203-112212225 TTTATTATAATGTTCCTTGATGG + Intergenic
1059980709 9:119768914-119768936 TGGTTTATGATGTGGATTGAGGG - Intergenic
1060610150 9:124956693-124956715 TAAATTATGATGTAAATTGTTGG - Intronic
1186519092 X:10189597-10189619 TTGATTTGGATGCACTTTGAAGG + Intronic
1188054900 X:25529557-25529579 TTGATGATCATTTTCATTGATGG + Intergenic
1190583726 X:51915937-51915959 TTGATTATGATATTAATTGTGGG - Intergenic
1190619826 X:52275292-52275314 ATGATTATGAAGTAGATTCAAGG - Intergenic
1192033349 X:67538515-67538537 TTGATTGTGATGGACTTTAAAGG + Intergenic
1192754171 X:74029208-74029230 TTGATTATGATGTTAGTTGTGGG - Intergenic
1194676304 X:96797874-96797896 GTGATTATGATGTACTTTTGAGG + Intronic
1195113671 X:101673705-101673727 TTAATTATGGTGTAAAATGAAGG + Intergenic
1197089190 X:122516592-122516614 TTTATTATGATGTAGGCTGAGGG - Intergenic
1198623311 X:138538397-138538419 TTGTTTATGATGTAAGGTGAGGG - Intergenic
1198691017 X:139284586-139284608 TTGAGTGTGATGTTCATTGTGGG + Intergenic
1199054104 X:143272243-143272265 TTGACAATTATGTATATTGATGG + Intergenic
1200300288 X:154967482-154967504 TTGATTATGAGGAACAGGGAAGG + Intronic
1200866094 Y:8045244-8045266 TAGATTATCATGTCCATTGTAGG - Intergenic