ID: 1169072145

View in Genome Browser
Species Human (GRCh38)
Location 20:2739192-2739214
Sequence CTGGGTGATGGGAAGGCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 301}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169072145_1169072156 15 Left 1169072145 20:2739192-2739214 CCTGTAGCCTTCCCATCACCCAG 0: 1
1: 0
2: 1
3: 32
4: 301
Right 1169072156 20:2739230-2739252 CATGATTTGGTCCCAACCCCAGG 0: 1
1: 0
2: 1
3: 8
4: 78
1169072145_1169072152 2 Left 1169072145 20:2739192-2739214 CCTGTAGCCTTCCCATCACCCAG 0: 1
1: 0
2: 1
3: 32
4: 301
Right 1169072152 20:2739217-2739239 GATCCAAGTCCCGCATGATTTGG 0: 1
1: 0
2: 0
3: 5
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169072145 Original CRISPR CTGGGTGATGGGAAGGCTAC AGG (reversed) Intronic
900241907 1:1621240-1621262 CTGGGTGGTGGGTGGGCTCCTGG + Intronic
901823051 1:11842545-11842567 CTGGGTGATGGGGCTGCTAATGG - Exonic
902060597 1:13638888-13638910 ATGTGTTATGGGAAGGCTAATGG + Intergenic
904087926 1:27923033-27923055 CTGGGTGGTGAGGAGGCTTCTGG - Intergenic
904367907 1:30028388-30028410 CTGTGTGGTGGGAAGGTCACTGG - Intergenic
905852004 1:41281566-41281588 GTGGGTGGTGGGAAGGGGACAGG + Intergenic
905930501 1:41783514-41783536 CAGGGTGATGGGAGGGATGCGGG + Intronic
906382276 1:45340346-45340368 CTGGGAGAGGGGAAGGCCTCGGG + Exonic
908426371 1:64011626-64011648 CTGGCTGAAGGGAAGGATAAAGG + Intronic
912572429 1:110634290-110634312 CTGGGGGGTGGGAAGATTACAGG + Intergenic
912811661 1:112799671-112799693 CAGGGAGATTGGAAGGCTAGAGG + Intergenic
915213024 1:154324220-154324242 CTTGGAGAGGGGAAGGCTAAGGG + Intronic
915621838 1:157090982-157091004 CAGGGTGATGGGAAAGCCCCTGG + Intergenic
916124977 1:161561420-161561442 ATGTGTTATGGGAAGGATACTGG + Intergenic
916134871 1:161642765-161642787 ATGTGTTATGGGAAGGATACTGG + Intronic
916723616 1:167503790-167503812 CTGGAGGAGGGGTAGGCTACCGG + Intronic
920503018 1:206497363-206497385 CTGGTTTATGGGAAGGCTGGAGG - Intronic
920529999 1:206694861-206694883 CTGGCAGATGGGGAGGCCACAGG + Intronic
921593547 1:217030442-217030464 CAGTGTGGTGGGAAGGCCACTGG + Intronic
921986188 1:221315533-221315555 CTGGGGGAAGGGAAGGACACTGG + Intergenic
922035838 1:221846935-221846957 CTGGGAGAGGGGAGGGCTATGGG + Intergenic
922162834 1:223090891-223090913 CTAGGCCATGGGAAGGCCACGGG + Intergenic
922249236 1:223832519-223832541 CTGGGTTATAGGAAGCCTAGTGG - Intronic
922810742 1:228414312-228414334 CTGGGTCATGGAAAGCTTACAGG + Intronic
923081350 1:230658647-230658669 CTGGGGGAAGGGATGGCTGCGGG - Intronic
924579902 1:245314601-245314623 CTGGGTGAGGGGACGTCTCCTGG + Intronic
1063020477 10:2122152-2122174 CTGTGTGGTGTGAAGGCTGCTGG - Intergenic
1064563090 10:16611759-16611781 CTGGGTGAAAGCAAGGCTTCTGG + Intronic
1066157387 10:32692523-32692545 AAGGGTGATGGGGAGGCTACTGG - Intronic
1066494245 10:35926680-35926702 CTGGGGGAAGGGAAGTCTAGTGG - Intergenic
1066567036 10:36731545-36731567 CAGGGAGATAGGAAGGCTGCAGG - Intergenic
1067460478 10:46454580-46454602 GTGGGTGAGGGGAAGGGTAGTGG + Intergenic
1067626714 10:47930023-47930045 GTGGGTGAGGGGAAGGGTAGTGG - Intergenic
1068346374 10:55784491-55784513 CTGAGTGCTGGCAAGGCTGCAGG - Intergenic
1069774519 10:70918835-70918857 CTGGGTGACGGAGAGGCTGCAGG + Intergenic
1069774526 10:70918866-70918888 CTGGGTGACGGAGAGGCTGCAGG + Intergenic
1069774533 10:70918897-70918919 CTGGGTGACGGAGAGGCTGCAGG + Intergenic
1069818810 10:71215020-71215042 CTGGGCAATGAGAAGGCTGCAGG - Intronic
1070185485 10:74058265-74058287 TTGGGAGATGGGAAGGAAACAGG - Intronic
1070401063 10:76053961-76053983 CTGTGTGTTGGGAAGTCTCCAGG + Intronic
1071229918 10:83573605-83573627 CTGTGTGATGGGAAGGCACCTGG - Intergenic
1072918370 10:99554706-99554728 GTGGGTGATGGGAAAGCTGCGGG + Intergenic
1073376698 10:103041391-103041413 CTGGGTGATTGGAAATCTAATGG + Intronic
1073941243 10:108700777-108700799 CAGGGTGATGGGAGGCTTACAGG - Intergenic
1075954384 10:126509334-126509356 CTGGGTCATGGGAAGAGTACTGG - Intronic
1076628214 10:131834613-131834635 CTGGGTGATGGGGAGGGCACAGG + Intergenic
1078667772 11:13340612-13340634 GTGGCTGCAGGGAAGGCTACAGG - Intronic
1078814068 11:14801729-14801751 CTGGGGGAAGGGGTGGCTACGGG - Intronic
1079236745 11:18696481-18696503 CTAGGTGGTGGGAAGGCAAATGG + Intronic
1081314078 11:41610262-41610284 CAGGGTGATGTCAATGCTACTGG + Intergenic
1082270022 11:50160290-50160312 CTGAGTGATGGGAAGGCATTGGG + Intergenic
1083060670 11:59867524-59867546 CTGGGGGCTGGGAAGGCTAGTGG + Intergenic
1083204242 11:61138507-61138529 CTGGGTCCTGGGAAGGCACCAGG + Intronic
1083253807 11:61484512-61484534 GAGTGTGATGGGAAGGCTGCAGG + Intronic
1083697444 11:64452272-64452294 CTGGGGGATGGTATGGCTGCGGG - Intergenic
1084116537 11:67045888-67045910 CTGGGGGATGGGAAGGGGCCAGG + Intronic
1084309027 11:68305330-68305352 TTGGTTGCTGGGAAGGCTTCAGG - Intergenic
1085510514 11:77085816-77085838 CTGGGTGGAGGGGAGGCTGCAGG + Intronic
1089201840 11:116729390-116729412 CTGGCAGTTGGGAAGGCTTCTGG - Intergenic
1090185233 11:124734694-124734716 CTGGGTAAGAGGAAGGATACTGG + Intergenic
1092177317 12:6419127-6419149 CTGGGTGCTGGGCAGGATGCGGG - Intergenic
1092700329 12:11221875-11221897 TTGGGGTATAGGAAGGCTACTGG - Intergenic
1092857192 12:12685222-12685244 ATGGGTGATGGGATGGGGACAGG - Intronic
1092872020 12:12813618-12813640 TTGGGTGGTGGGAGGGCTGCTGG + Intronic
1093233377 12:16576174-16576196 CTGTGTTATAGAAAGGCTACCGG - Intronic
1094490952 12:30960302-30960324 CAGGGTGATGGGAAGTGTACAGG - Intronic
1094785571 12:33844927-33844949 CTAGATGATGGGAAGGATAGTGG - Intergenic
1095252457 12:39995411-39995433 CTGGAGGATGGGAAGGGTAGCGG - Intronic
1095330611 12:40957337-40957359 CTGGGAGAGGTGAAGGTTACTGG + Intronic
1096073718 12:48789370-48789392 CGGGGTGAAGGGAAGGGGACCGG - Intergenic
1097176142 12:57144091-57144113 CAGGGAGATGGGAAGGGGACCGG - Intronic
1097204686 12:57310553-57310575 CTGGGTTAAAGGAAGGCTGCTGG - Intronic
1099887950 12:88555321-88555343 CTGGTTGATGGGAGGATTACAGG - Intronic
1100819869 12:98420860-98420882 CTGGGAGATGGGCAGGTGACAGG + Intergenic
1101334164 12:103781564-103781586 ATGGCTGATGGGAAGGATGCAGG - Intronic
1101824538 12:108210024-108210046 CTGGGGGATGGGAGGGCTCTGGG - Intronic
1102453403 12:113057197-113057219 CCGGGGGAAGGGAAGGCTCCGGG + Intronic
1103361920 12:120359613-120359635 CTGGGGGAAGGGAAGGAGACTGG + Intronic
1103974262 12:124691910-124691932 GTGGGTGTTGGGAAGGCATCCGG + Intergenic
1106311283 13:28556761-28556783 GTGGGAGCTGGGAAGGCTGCAGG + Intergenic
1111903478 13:94228726-94228748 CTGGAGGATGGGATGGCTTCAGG - Intronic
1112462915 13:99618706-99618728 CTGGGTGGGGGGAAGGGAACAGG - Intronic
1112733582 13:102394282-102394304 CTGAGGGATGGGAAAGCCACAGG - Intronic
1114617488 14:24076037-24076059 ATGAGTGGTGGGGAGGCTACAGG - Intronic
1116996015 14:51325719-51325741 GTTGCTGATGGGAAGTCTACTGG + Intergenic
1117282353 14:54253508-54253530 GTTGGTCTTGGGAAGGCTACAGG + Intergenic
1118117952 14:62802702-62802724 CTGGGTACTGGGAAGGCAAAGGG + Intronic
1118629423 14:67689216-67689238 CTGTGAGATGGGAAGGAAACTGG - Intronic
1119771336 14:77221993-77222015 CAGGGTGAGGGGAAGGATATGGG - Intronic
1121244839 14:92454192-92454214 GTGGCTGATGGGCAGGCTTCTGG - Intronic
1121285806 14:92734932-92734954 CTGGGTGCTGGGAACTCAACAGG + Intronic
1121562991 14:94887960-94887982 CTGGGTGATTAGAAGCCTGCCGG - Intergenic
1122203296 14:100135684-100135706 CTGGGGAAGGGGAAGGCTACAGG - Intronic
1122883276 14:104699595-104699617 CTGGGTGAGTGGACGGCCACTGG + Intronic
1124340130 15:28885394-28885416 CGGGGTGCTGGGATGGTTACCGG + Intronic
1124419236 15:29505300-29505322 CTGGGGGATGGGACAGCTATGGG + Intronic
1125409071 15:39385816-39385838 CTGGTTGATGGAAAGGTTAAGGG - Intergenic
1125879715 15:43183577-43183599 CTGGGTCATGAGAAGGTAACTGG - Intronic
1126197634 15:45949789-45949811 CTGGGTGCTGGGTGGGGTACAGG + Intergenic
1127775053 15:62257978-62258000 CTGGGAGGTGGGAAGGCTGCAGG - Intergenic
1130844002 15:87727122-87727144 CTGGGTCATGGGAAGAATACAGG - Intergenic
1131482310 15:92792679-92792701 CTGGGGGATGTGAATGCTGCTGG - Intronic
1132090675 15:98945960-98945982 GTGGGTGATGGTAAGGCTCTTGG + Intronic
1133009690 16:2904372-2904394 CTGGGTCCTGGGGAGGCTGCTGG - Intergenic
1134313553 16:13097776-13097798 CTGGGTGATGGGGAGTGGACAGG + Intronic
1136032282 16:27512242-27512264 CTGGGTGCTGGGAAGGGAACAGG - Intronic
1137697158 16:50469016-50469038 CTGGGTGATGGGGGTGCTGCAGG - Intergenic
1139503022 16:67383531-67383553 CTGGGTGATGCTATTGCTACTGG + Intronic
1142532827 17:594474-594496 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532844 17:594546-594568 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532860 17:594619-594641 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532875 17:594690-594712 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532892 17:594762-594784 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532907 17:594835-594857 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532922 17:594906-594928 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532939 17:594979-595001 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532955 17:595050-595072 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532970 17:595121-595143 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532986 17:595192-595214 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533001 17:595265-595287 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533016 17:595336-595358 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533033 17:595408-595430 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533048 17:595481-595503 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533065 17:595552-595574 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533082 17:595624-595646 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533100 17:595696-595718 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533116 17:595767-595789 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533131 17:595838-595860 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533146 17:595909-595931 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533161 17:595980-596002 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142952848 17:3497792-3497814 CTGGGTGATGCGGATGCTGCTGG + Intronic
1142965726 17:3579919-3579941 CTGGGGGATGGGGAAGCTCCAGG + Intronic
1142965735 17:3579945-3579967 CTGGGGGATGGGGAAGCTCCAGG + Intronic
1144253740 17:13445027-13445049 CTAGGTGATGGGGAGGCTGCTGG - Intergenic
1144848840 17:18233945-18233967 GTGGGTGCTGGGAAGCCCACCGG - Intronic
1145911329 17:28544995-28545017 CTGGGTGCTGGGGTAGCTACAGG - Intronic
1145957046 17:28861774-28861796 GTGGGTTATGGGAAGGGGACTGG + Intergenic
1146286136 17:31575285-31575307 CTGGTGGGTGGGAAGGCTGCAGG - Intronic
1146427267 17:32753299-32753321 CTGGGTGATAGGTAAGCTAGAGG + Intronic
1146594256 17:34155797-34155819 CTGGTTGCAGGGAAGGCTACCGG - Intronic
1147258237 17:39194747-39194769 CAGGGTGATGGGGTGGCTCCAGG + Intronic
1147719125 17:42527486-42527508 CTGTGTGATAGGCAGGCAACTGG + Intergenic
1148493325 17:48037336-48037358 GTGGGTGATGGGCATGCTTCTGG - Intronic
1148938530 17:51186060-51186082 CTGGGAGGTGGGAAGGCCTCCGG + Intronic
1149348183 17:55759785-55759807 ATGGGTGATGGGACATCTACAGG + Intronic
1149813301 17:59698940-59698962 CTGGATGATGGGGATGCAACAGG + Exonic
1150870866 17:68910094-68910116 CTGGGGGATGGGAAGATTTCTGG - Intronic
1151381602 17:73729654-73729676 ATGGGTGATAGGAAGGGGACGGG - Intergenic
1152120747 17:78416877-78416899 CTGGGTTGTGGGGAGGCTAGAGG - Intronic
1153540225 18:6146080-6146102 CTGGGTGAGGGGAAGGGTGGCGG + Intronic
1160534907 18:79586558-79586580 CTGGGTGGTGGGAAGGCGTGCGG + Intergenic
1161310251 19:3589941-3589963 CTGGGGGGAGGGAAGCCTACGGG + Intronic
1162141031 19:8585738-8585760 CTGGGTGATTGGAAGGGTGGGGG - Intronic
1162392851 19:10400006-10400028 CAGGGTGGTGGGCAGGCTCCAGG - Intronic
1162565639 19:11444802-11444824 CTGGGAGATGGGGAGGATACAGG - Intronic
1163287688 19:16358663-16358685 CTGGGCGATGGGATGGCCCCGGG + Intronic
1164919271 19:32076774-32076796 GTGGGTGATGGGAAGGACAGAGG + Intergenic
1166301181 19:41913008-41913030 CTGGGAGAGGGGAAGGCCCCGGG - Intronic
1167636056 19:50656386-50656408 TGGGGTGATGGGAAGGGCACAGG + Intronic
1168185886 19:54698927-54698949 CTGAGTGCTGGGGAGGCTGCAGG - Intronic
1168462827 19:56574537-56574559 CTGAGTCATGGGGAGGCAACAGG - Intronic
1168553456 19:57318831-57318853 CTGGGGGATGGGGAGGCCACAGG + Intergenic
925484464 2:4312952-4312974 CTGGGTGAAGGGGAGGCTGTAGG - Intergenic
927180899 2:20446394-20446416 CTGGGGGTTGGGAAGGGTAGGGG + Intergenic
927888655 2:26734378-26734400 ATAAGTTATGGGAAGGCTACTGG - Intergenic
928377774 2:30789956-30789978 CTGGGGGAAGGGAAGGCTTGGGG + Intronic
928803461 2:35123248-35123270 CTGGGTGAGGTAGAGGCTACAGG - Intergenic
929425329 2:41839407-41839429 CTGAGTCATGGGAAGATTACTGG - Intergenic
934575193 2:95395821-95395843 CTGGATGGTGGGAAGTCTATTGG + Intergenic
934657080 2:96122047-96122069 CTGGGTGGTGGGAGGGGTACAGG - Intergenic
935181374 2:100693657-100693679 CTGGGGGTTGGGAAGGCTGTGGG + Intergenic
936404350 2:112188948-112188970 CTGGGTGGTGTGCAGGCTTCTGG - Intergenic
937155937 2:119719021-119719043 CTGGGTGATGTTAATGCTGCTGG + Intergenic
937862525 2:126722229-126722251 ATGGGTGATGGGGGGGCTATTGG + Intergenic
937917256 2:127105421-127105443 CTGGGGGCTGGGAAGACTTCAGG - Intronic
938799258 2:134745764-134745786 CTGGGTGCTGGGCAGACTGCTGG - Intergenic
939233063 2:139455225-139455247 CTGTGTGATGGCACTGCTACAGG - Intergenic
939394612 2:141612735-141612757 CTGAGTGATGCGAAGGCGAAAGG - Intronic
939912929 2:148005399-148005421 CTGGGGGATGGGGGGGCTAAGGG + Intronic
939996619 2:148926244-148926266 CTGGGAGATGAGAAGGCTCTGGG + Intronic
940065742 2:149626395-149626417 CTCGGTGATGGTAAGGATATAGG + Intergenic
940857537 2:158741226-158741248 GTGGGAGATGGGGAGGCTTCTGG + Intergenic
941044969 2:160664583-160664605 TTGGGTGGTGGGAAGGCTCAAGG + Intergenic
941127380 2:161600923-161600945 CCAGGTGATAGGAATGCTACTGG - Intronic
944184299 2:196929927-196929949 CTGGGTGATGCCAATGATACTGG + Intergenic
944392223 2:199229185-199229207 CTGGGTGATGGGTATGCGGCAGG - Intergenic
944405458 2:199378930-199378952 CTGGAAGATAGGAAGGCTATTGG - Intronic
946686559 2:222277247-222277269 CTGGGGGTTGGGGAGGCTTCTGG + Intronic
946858941 2:223981458-223981480 CTGGGTGATGCTAATGCTGCTGG + Intronic
947911705 2:233804924-233804946 CTGGGCTCTGGGAATGCTACGGG - Intronic
947980351 2:234403447-234403469 CAGGGTGATGGGATGGCCGCTGG - Intergenic
948171628 2:235908066-235908088 CTGGCTGATGGGCAGGGAACGGG - Intronic
948813684 2:240499081-240499103 CTGTGTGCTGGGAAGGCACCTGG + Intronic
1168857922 20:1022194-1022216 CTAGGTGATAGGAAGGGGACAGG + Intergenic
1169072145 20:2739192-2739214 CTGGGTGATGGGAAGGCTACAGG - Intronic
1169091588 20:2864284-2864306 CTGGGTGAGGGCAAGGCTGGGGG + Exonic
1172149502 20:32780142-32780164 CTTGGTGAGGGGGAGGCTATGGG + Intronic
1172566704 20:35936243-35936265 CTGGGTCCTGGGTAGGCTCCTGG + Intronic
1173290758 20:41712919-41712941 CTTGGTGATGGACTGGCTACAGG - Intergenic
1173720388 20:45253152-45253174 CTGGGTGAGAGTGAGGCTACCGG + Intronic
1174031776 20:47634407-47634429 CTAGGTGATGGGAAGGCTAATGG + Intronic
1174666792 20:52265524-52265546 CTGGGTGGTGGGAAGAGAACAGG - Intergenic
1174684267 20:52438475-52438497 CTGGGGGATGGGAGTGCTATTGG + Intergenic
1174892295 20:54408978-54409000 GATGGAGATGGGAAGGCTACTGG + Intergenic
1175124533 20:56741408-56741430 GTGGATGATGGGAAAGCTCCTGG + Intergenic
1177984274 21:27954131-27954153 TTGGGTGATGGGCAGACAACTGG + Intergenic
1178685730 21:34709223-34709245 ATGGGTGCTGGGAAGGCAGCAGG - Intronic
1180675162 22:17581572-17581594 CTGGGTCCTGGTAAGGCTTCCGG + Intronic
1182760748 22:32720702-32720724 CTGTGGGGTGGGAAGGCCACGGG - Intronic
1184252892 22:43270974-43270996 CTGGGTGAGGGGCAGCCTCCCGG + Intronic
1184645937 22:45895603-45895625 CTGGGTCCTGGGAAGGCTTCTGG - Intergenic
1185409902 22:50676362-50676384 CCTGGGGATGGGAAGGCGACGGG + Intergenic
950161434 3:10764038-10764060 GTGAGTGAGGGGAAGGCAACAGG - Intergenic
950484730 3:13266443-13266465 CTGGGTGACGGGGAGCCCACAGG + Intergenic
951019917 3:17771605-17771627 CCGGGTGATGTTAATGCTACCGG - Intronic
952405532 3:33001453-33001475 CTGAGTGATGAGAAGGCTTCAGG - Intronic
952776958 3:37055849-37055871 CTGGGAGATGGGAAGGCATGGGG - Intronic
953376296 3:42431265-42431287 CTGGCTGCTGGGAGTGCTACTGG + Intergenic
953821760 3:46212834-46212856 ATGGAGGATGGGAAGGCTTCAGG - Intronic
955271789 3:57506787-57506809 CTGGGTGAAGGTAAAGCCACTGG + Intronic
959741129 3:109721033-109721055 TTGGGTGATGGGTATGCTAAAGG - Intergenic
960639938 3:119814897-119814919 CTGGATTATGGGATGGCTGCTGG + Intronic
960980961 3:123225845-123225867 CTGGAGGATGGGAAGGGTAGTGG - Intronic
961330497 3:126135411-126135433 CTGGGTCCTGGGGAGGCTATGGG - Intronic
963248636 3:143084941-143084963 CTGGGACATGGGAAGCCCACCGG + Intergenic
967807811 3:193730821-193730843 GTGGCTGATGGGAAGGACACGGG + Intergenic
969465836 4:7355878-7355900 CTGGGTGATGGCAGGCCCACTGG + Intronic
969945868 4:10782627-10782649 CAGGTTGATGGGAAGGATCCAGG - Intergenic
970343452 4:15130632-15130654 CTGGGTGATGGGGAAGTCACTGG - Intergenic
971215876 4:24661798-24661820 CTGGGTGATGCCCAGGCTGCTGG - Intergenic
971559147 4:28052597-28052619 CTGGGTGTTGAGTAGGCAACTGG + Intergenic
973147598 4:46847185-46847207 CTGGGAGATGGGAATCATACAGG - Intronic
973588908 4:52420524-52420546 CTGGGTGAGGGGCAGCCTCCAGG + Intergenic
976509342 4:85890245-85890267 CAGGGGGCTGGGAAGTCTACAGG - Intronic
980183689 4:129434516-129434538 TTGGGGGATGGGGAGGCTAGGGG - Intergenic
980511231 4:133790340-133790362 CTAGTTGATGGGAAGGCATCTGG + Intergenic
983262385 4:165470941-165470963 CTTGTTGATGGGAAGTCTAGGGG + Intronic
986242675 5:5975246-5975268 GTGGGGGATGGGAAGGCTGCAGG + Intergenic
986315635 5:6584585-6584607 CTTGGTGATGGGAAGGCCAAGGG + Intergenic
986838785 5:11672377-11672399 CTGGGGGAAGGGGTGGCTACAGG - Intronic
988626085 5:32876387-32876409 CTAGAGGATGGGAAGGGTACAGG - Intergenic
989633922 5:43514638-43514660 CTGGGTGATGAGAACGCAAGCGG - Intronic
991632963 5:68675142-68675164 CGGGGTGGTGGGAGTGCTACTGG + Intergenic
992499488 5:77327860-77327882 CTGTGTGGGGGGAAGGCTCCCGG - Intronic
993984273 5:94578837-94578859 CTGGGTGATGGTAACACTGCTGG + Intronic
996489321 5:124074205-124074227 CTGGAGGATGGGAAGGGTAGAGG - Intergenic
997649382 5:135504372-135504394 CTGGGTGAGGTTAAGGCCACAGG + Intergenic
998204692 5:140150101-140150123 CTGGCAGAAGGGAAGGCTTCTGG - Intergenic
998377068 5:141698273-141698295 CTGGGGGAAGGGGAGGGTACTGG - Intergenic
998511329 5:142716918-142716940 CTGGGTGACGCCAAGGCTGCTGG - Intergenic
999585162 5:153081956-153081978 CTAGAGGTTGGGAAGGCTACTGG + Intergenic
1000602362 5:163289816-163289838 CTGGGTGGAGGGAAGGCTTCTGG + Intergenic
1001378499 5:171285591-171285613 CTGGGGCATTGGAAGGCTGCAGG - Intronic
1001785557 5:174409712-174409734 CCGGGGGATGGGAAGGATGCTGG - Intergenic
1002387687 5:178880783-178880805 TTGGGTGATGGGCTGGGTACAGG - Intronic
1003308125 6:4946936-4946958 CTGGCTGCTGGGATGGCTACTGG - Intronic
1005384986 6:25277591-25277613 CTGGGTGATGGAAAGAATAAAGG - Intergenic
1005495361 6:26383414-26383436 CTGGGAGACAGGAAGCCTACTGG + Intronic
1005664796 6:28041618-28041640 TTGTGTGATGGGAAGGATCCTGG + Intergenic
1005888663 6:30117804-30117826 CTGGGGGATAGGAGTGCTACTGG - Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006615993 6:35327328-35327350 CAGGGTGATGGAAAGGACACAGG - Intergenic
1008084390 6:47229004-47229026 CTGGGTGATGTGGATGCTCCCGG - Intergenic
1010402663 6:75464800-75464822 ATGGGGGTGGGGAAGGCTACAGG - Intronic
1019215197 6:170438856-170438878 CTGGGGGATGGGCTGGGTACTGG + Intergenic
1019801499 7:3091459-3091481 CTGGGTGGTGGGAGGGCTGCTGG + Intergenic
1020029334 7:4921747-4921769 CTGGGTGTCGGGGAGGCTAGCGG - Intronic
1020824286 7:13007898-13007920 CTGAGTGATGCCAATGCTACCGG - Intergenic
1021566656 7:22023188-22023210 CTGGGTGATGCCAATGCTACTGG + Intergenic
1021605150 7:22402621-22402643 CTGGGTGGTAGGAAGGCCAGTGG + Intergenic
1022097063 7:27147696-27147718 CTGGCCGCTGGGAAGGCTCCCGG + Exonic
1022190678 7:28014259-28014281 TTGGGTGATGGGAGGGTTACTGG - Intronic
1022259548 7:28690982-28691004 CTGGGTGGAGGGAAGGACACAGG + Intronic
1022524423 7:31028184-31028206 CTTGGAGATGGGAAGTCCACGGG - Intergenic
1022682664 7:32564818-32564840 TAGGGTGATGGGAAGGCAACTGG + Intronic
1023551449 7:41374318-41374340 CAGGGTGCTTGGAAGGCTTCTGG + Intergenic
1023686192 7:42737860-42737882 CTGGGTGATGAGAAGGCCAGAGG - Intergenic
1026455699 7:70570765-70570787 ATGGGAGATGGGAATGCAACAGG - Intronic
1026474840 7:70726041-70726063 CTGGGAGAAGGGAAGGCTAGAGG + Intronic
1027526374 7:79274345-79274367 CTGGGTGATGCTAATGCTGCTGG + Intronic
1030109405 7:106013671-106013693 CTGGGTGAGGGGAAGGGTAGCGG - Intronic
1030395852 7:108985934-108985956 CTGGGTAATGGAAAAGCCACTGG - Intergenic
1032019137 7:128396834-128396856 CTAGGTGATGGTATGGCTCCTGG - Intronic
1034449431 7:151129426-151129448 CTGGGTGATGGCCAGGACACAGG - Intronic
1034455558 7:151168005-151168027 CTGGGTGGAGGGAAGGGGACCGG - Intronic
1035054189 7:156023013-156023035 CTGGGTGAGGCGGATGCTACAGG - Intergenic
1035058208 7:156050902-156050924 GTGGGTGAGGGGAGGGCTCCAGG - Intergenic
1036639021 8:10570540-10570562 CTGGATGCTGGGGAGGCTGCTGG + Intergenic
1036807605 8:11846237-11846259 CTAGCTGATGGGAAAGATACTGG + Intronic
1037885810 8:22595668-22595690 CTGAGTGATGGGGTGGCTGCTGG + Intronic
1038038268 8:23704329-23704351 CTGGGTGAAAGGAAGACTTCAGG - Intronic
1039200310 8:35083837-35083859 CTGGGTGATGGGATCGATAGAGG + Intergenic
1039555144 8:38469802-38469824 GTGGGTGATGGTAAGGGAACAGG - Intergenic
1039600165 8:38829851-38829873 CTGGGTGTGGGAATGGCTACAGG + Intronic
1039876998 8:41595496-41595518 ATGGTTGATAGGAAGGCTACAGG + Intronic
1040972413 8:53151017-53151039 CTGAGAGGTGGGAAGGATACAGG - Intergenic
1041396176 8:57393866-57393888 CTGTGTGATGGAAAGACTATGGG + Intergenic
1042944604 8:74142526-74142548 CTGGGTGTTGGCAAGACTATGGG + Intergenic
1043399089 8:79866266-79866288 CTGGGAGATTGGACAGCTACAGG + Intergenic
1044952956 8:97451435-97451457 CTGTGTTGTGGGAAGGTTACCGG - Intergenic
1045720657 8:105106676-105106698 CTGGGTGATGGGTAGCATAGAGG + Intronic
1047137623 8:122098317-122098339 TTGGATGAAGGGAAGGCTAGGGG + Intergenic
1049000545 8:139823179-139823201 CTGGGCACTGGGAAGGGTACTGG - Intronic
1050112504 9:2231524-2231546 CTGGGTTATGGGAATTTTACTGG - Intergenic
1050993082 9:12176146-12176168 CTGGGTGATGCCATGGCAACAGG + Intergenic
1051571438 9:18563607-18563629 CTGGGTGAAGGGGAGGCTGTGGG - Intronic
1052296390 9:26900246-26900268 CTAAGTGATGGTAAGGCTATTGG + Intergenic
1053175156 9:35917360-35917382 CTGGGTGTTGGGGTGGCTGCTGG + Intergenic
1053430969 9:38041497-38041519 ATGGGTGATGGGAAGGAGAAGGG + Intronic
1054709016 9:68492363-68492385 CTAGGTGATGAGAGGGCTGCTGG - Intronic
1055238177 9:74149524-74149546 CTGGGTGATGGAAAGAACACAGG + Intergenic
1057082774 9:92185199-92185221 GTGGGGGATGGGAAGGGTGCTGG + Intergenic
1057368727 9:94450043-94450065 TTGGGGGATGGGAAGGTTAGGGG + Intronic
1059722146 9:116970328-116970350 CTAGGTCATGCGAATGCTACTGG + Intronic
1060612048 9:124975943-124975965 CTGGTTGTTGGCAAGGCTTCTGG + Intronic
1061667704 9:132170016-132170038 ATGGGCGATGGCAAGGCTAAGGG - Intronic
1061866222 9:133493010-133493032 CTGGGGGCTGGGGAGGCCACGGG + Intergenic
1062413877 9:136438457-136438479 CTGGGAGATGGGGTGGCTGCGGG + Intronic
1062607448 9:137354528-137354550 CTGGGTGAAGGGGAGGCCATGGG - Intronic
1185830638 X:3299578-3299600 TTGTGTGATAGGAAGGCTGCAGG + Intergenic
1186354260 X:8773485-8773507 CTGGGGGAAGGGATGGCTATGGG + Intergenic
1186873877 X:13798257-13798279 CTGGGTGATGGGAACCCTCCAGG + Intronic
1189271828 X:39757519-39757541 TTGGGTGATGCCAAGGCTGCTGG + Intergenic
1190681335 X:52829781-52829803 CTGGGAACTGGGAAGGCTGCGGG - Intergenic
1190916853 X:54817475-54817497 CTGGGTGATGGGGAGGTTCAAGG + Intergenic
1192549834 X:72045108-72045130 CTAGATGCTGGGAAGGCTGCTGG - Intergenic
1193166429 X:78285894-78285916 CTGGGTGATAGGGAGGGTAAAGG + Intronic
1193980386 X:88175427-88175449 CTGGGAGATGGGGATGATACAGG - Intergenic
1194359555 X:92932647-92932669 CTTGGTGATGGGAATTCTATGGG - Intergenic
1195374789 X:104216320-104216342 CTGAATGATGGGAAGGGTAGTGG + Intergenic
1197269779 X:124413012-124413034 CTGACTGATGGGATGTCTACTGG + Intronic
1197365652 X:125562320-125562342 CTGGGAGGTGGGAAGCCCACTGG - Intergenic
1197839162 X:130727036-130727058 CTGGGTGAAGGGAAGACAACAGG + Intronic
1200124657 X:153807609-153807631 CTGGGGGACGGGAACGCTAGAGG - Intronic
1200750904 Y:6943287-6943309 CTTGGGGATGGGGAGGCTGCTGG + Intronic