ID: 1169074381

View in Genome Browser
Species Human (GRCh38)
Location 20:2752176-2752198
Sequence CACCCACACCCCGCCGTCGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169074364_1169074381 18 Left 1169074364 20:2752135-2752157 CCCCCCGCGCACCCGGGCCGCTC 0: 1
1: 0
2: 4
3: 27
4: 278
Right 1169074381 20:2752176-2752198 CACCCACACCCCGCCGTCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 74
1169074372_1169074381 1 Left 1169074372 20:2752152-2752174 CCGCTCGCACCCCTGGCCCCGAG 0: 1
1: 0
2: 0
3: 29
4: 376
Right 1169074381 20:2752176-2752198 CACCCACACCCCGCCGTCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 74
1169074370_1169074381 7 Left 1169074370 20:2752146-2752168 CCCGGGCCGCTCGCACCCCTGGC 0: 1
1: 0
2: 0
3: 21
4: 279
Right 1169074381 20:2752176-2752198 CACCCACACCCCGCCGTCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 74
1169074373_1169074381 -8 Left 1169074373 20:2752161-2752183 CCCCTGGCCCCGAGCCACCCACA 0: 1
1: 0
2: 1
3: 30
4: 412
Right 1169074381 20:2752176-2752198 CACCCACACCCCGCCGTCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 74
1169074365_1169074381 17 Left 1169074365 20:2752136-2752158 CCCCCGCGCACCCGGGCCGCTCG 0: 1
1: 0
2: 0
3: 18
4: 197
Right 1169074381 20:2752176-2752198 CACCCACACCCCGCCGTCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 74
1169074366_1169074381 16 Left 1169074366 20:2752137-2752159 CCCCGCGCACCCGGGCCGCTCGC 0: 1
1: 0
2: 1
3: 21
4: 222
Right 1169074381 20:2752176-2752198 CACCCACACCCCGCCGTCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 74
1169074375_1169074381 -10 Left 1169074375 20:2752163-2752185 CCTGGCCCCGAGCCACCCACACC 0: 1
1: 1
2: 6
3: 61
4: 546
Right 1169074381 20:2752176-2752198 CACCCACACCCCGCCGTCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 74
1169074368_1169074381 14 Left 1169074368 20:2752139-2752161 CCGCGCACCCGGGCCGCTCGCAC 0: 1
1: 0
2: 1
3: 12
4: 144
Right 1169074381 20:2752176-2752198 CACCCACACCCCGCCGTCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 74
1169074374_1169074381 -9 Left 1169074374 20:2752162-2752184 CCCTGGCCCCGAGCCACCCACAC 0: 1
1: 0
2: 0
3: 36
4: 432
Right 1169074381 20:2752176-2752198 CACCCACACCCCGCCGTCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 74
1169074367_1169074381 15 Left 1169074367 20:2752138-2752160 CCCGCGCACCCGGGCCGCTCGCA 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1169074381 20:2752176-2752198 CACCCACACCCCGCCGTCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 74
1169074371_1169074381 6 Left 1169074371 20:2752147-2752169 CCGGGCCGCTCGCACCCCTGGCC 0: 1
1: 0
2: 1
3: 30
4: 385
Right 1169074381 20:2752176-2752198 CACCCACACCCCGCCGTCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169074381 Original CRISPR CACCCACACCCCGCCGTCGT GGG Exonic
900463747 1:2813636-2813658 CACCCACACCCCTCAGCCCTTGG - Intergenic
901340778 1:8497043-8497065 CACCCCCACCCCTCTGTAGTGGG + Intronic
903656987 1:24955554-24955576 CACCCACACCCCTCTGGCTTAGG - Intronic
905791491 1:40792019-40792041 GACCCACACCCCGCCAAAGTTGG - Intronic
907909657 1:58815085-58815107 CTCCCAGACCCCGCCGTCCTGGG - Intergenic
914733923 1:150398117-150398139 CACCCCCACCCCGCAGTAGCTGG + Intronic
916107227 1:161441052-161441074 CACCCGCCCCCCGCCACCGTTGG + Intergenic
916108814 1:161448470-161448492 CACCCGCCCCCCGCCACCGTTGG + Intergenic
916110402 1:161455851-161455873 CACCCGCCCCCCGCCACCGTTGG + Intergenic
916111987 1:161463261-161463283 CACCCGCCCCCCGCCACCGTTGG + Intergenic
916113574 1:161470642-161470664 CACCCGCCCCCCGCCACCGTTGG + Intergenic
1063459250 10:6204631-6204653 CACCCACATCCCCCAGTCCTGGG - Intronic
1070795328 10:79213047-79213069 CACCCCCACCCCGCCACCGTGGG + Intronic
1070810798 10:79296754-79296776 CACCCACCCCTCGCTGTCCTTGG - Intronic
1072840543 10:98769562-98769584 CACCCACACCCCGCACTCATGGG - Intronic
1076074537 10:127522766-127522788 CACCCACACCTGGCTGTCCTTGG + Intergenic
1077386307 11:2271064-2271086 CACCCACGCCCCACCCTCCTGGG + Intergenic
1083774811 11:64889192-64889214 TGCCCACACCCCGGCTTCGTGGG - Intergenic
1089496447 11:118910615-118910637 CACCCCCACCCCGCCCCCTTCGG + Exonic
1092899386 12:13044464-13044486 CACCCAGTCCCCGCCGGTGTTGG + Intronic
1114267552 14:21081763-21081785 CACCGTCTGCCCGCCGTCGTCGG - Exonic
1114422782 14:22598451-22598473 CACCCACCCCCCGCCCTCCCCGG - Intronic
1114661253 14:24346648-24346670 CAGCCCCACCCCTCCGTCCTAGG + Intergenic
1117183574 14:53217515-53217537 CGCCCACACCCCTCAGTCCTTGG + Intergenic
1122077606 14:99246135-99246157 CGCCCACCCCCCGCCTTCCTCGG + Intronic
1133125539 16:3643534-3643556 CACCCACTCCGCTCCGTGGTGGG - Intronic
1134134305 16:11669056-11669078 GTCCCACACCCCGCCTCCGTCGG + Intronic
1140927564 16:79599142-79599164 CACCCGCACCACGCCGCCGGCGG - Exonic
1144950667 17:18991931-18991953 CTCCCACACCCTGCCATCTTGGG - Intronic
1149356564 17:55845605-55845627 CTCCCCCACCCCGCCGTGGGAGG + Intergenic
1151468120 17:74300958-74300980 CGCCCTCACCCCACCGTCCTGGG - Intronic
1152180981 17:78821723-78821745 CCACCACACCCAGCCCTCGTGGG + Intronic
1152729658 17:81963211-81963233 CACCCACACCCCGGCGGGGAAGG + Intergenic
1153773397 18:8433094-8433116 GACCCCCACCCCGCCGCCGAGGG - Intergenic
1157492825 18:48136252-48136274 CACCCACACCGGGCCGTCTCCGG + Intronic
1160200439 18:76791518-76791540 CACCCCCACCCCGCCTTCCAGGG + Intergenic
1160718839 19:588975-588997 CACCCACGCCCAGCCGGCTTCGG + Intergenic
1161684573 19:5696476-5696498 CACCCACACCCTGCCTTGGACGG + Intronic
1165453571 19:35898716-35898738 CACCTGCACCCCGCCAGCGTCGG + Exonic
1166344328 19:42155969-42155991 CACCCCCACCCCGTGGTTGTTGG - Intronic
1166828063 19:45621582-45621604 CCCAAACACGCCGCCGTCGTGGG + Exonic
925304833 2:2840727-2840749 GACCCACAGCCAGCCGTGGTCGG - Intergenic
928655438 2:33446443-33446465 CACCCACACCCGGCCCAAGTAGG + Intronic
931699653 2:64899322-64899344 CACCCACAGCCCACCTTTGTCGG - Intergenic
932770975 2:74500660-74500682 CACCCACAGCCCTCCTTTGTAGG + Intronic
937401892 2:121591457-121591479 CACCCACACACCGCAGCAGTGGG - Intronic
942463777 2:176188290-176188312 CGCCCACACTCCGCCCTCGAGGG + Intergenic
948681066 2:239635003-239635025 CTCCCACACCTGTCCGTCGTTGG + Intergenic
1169074381 20:2752176-2752198 CACCCACACCCCGCCGTCGTGGG + Exonic
1174064178 20:47852809-47852831 CACCCAGACCCTGCTGTGGTCGG + Intergenic
1174296337 20:49547951-49547973 CTCCCACACCACCGCGTCGTAGG + Exonic
1180557042 22:16586331-16586353 CACCCCCACCCCCCCGCCGCAGG - Intergenic
1181450515 22:23017140-23017162 CCCCCGCTCCCCGCCGCCGTGGG - Intergenic
1181494914 22:23282319-23282341 CACCCACACCCCGCCTGCCGAGG - Intronic
1181591954 22:23890848-23890870 CACACACACACCGCTGTCTTTGG + Intronic
1183366620 22:37410417-37410439 CACCCACTGCCCGCACTCGTGGG - Intronic
1183981746 22:41544529-41544551 CACCCCCACCCCGCCGAGGCGGG + Intronic
950197045 3:11016659-11016681 CACCCAGACACCTCCGTAGTGGG + Intronic
951117375 3:18880696-18880718 CACCAACACCCCTCCTTCATTGG + Intergenic
959422802 3:106148999-106149021 CACCCACACTCCTCAGTCCTTGG - Intergenic
975129277 4:70816434-70816456 CCACCACACCCAGCCGTCATTGG - Exonic
982260182 4:153488026-153488048 CACACACACCCCTCAGTCATAGG - Intronic
989261661 5:39425200-39425222 CACCCGCCCCCCGCCCGCGTCGG - Intronic
994197621 5:96936625-96936647 CACCCCCACCCCGCCCTATTAGG - Intronic
996695374 5:126388857-126388879 CACCCCCACCCCACCCTCTTTGG - Intronic
999782137 5:154858186-154858208 CCCCCCCACCCCCCCGCCGTGGG - Intronic
1001990659 5:176113231-176113253 CACTCAGACCCCGCTGTCCTGGG - Intronic
1002226214 5:177724909-177724931 CACTCAGACCCCGCTGTCCTGGG + Intronic
1019526107 7:1481223-1481245 CACCCACACCCACCCGACCTCGG + Intronic
1024247192 7:47479481-47479503 CTCCCCCACCCCCCCGTCGGCGG + Intronic
1027640037 7:80722053-80722075 CACCCACAGCCTGCAGTCGTAGG - Intergenic
1029407129 7:100382006-100382028 CACCCCCACCCCACCCCCGTAGG + Intronic
1040014509 8:42689786-42689808 CCCCCCCACCCCGCCTCCGTGGG + Intergenic
1048859503 8:138713709-138713731 CACCCCCACCGCCCCGCCGTAGG + Intronic
1049540889 8:143208271-143208293 CACCCTCTCCCCGCCGCTGTGGG + Intergenic
1060174317 9:121486316-121486338 CACCTACACCACGCCCACGTGGG + Intergenic
1198443894 X:136692074-136692096 CACCCACACTCTCCCTTCGTGGG + Intronic
1199846372 X:151695198-151695220 CCCCCACACCCCGCCGTTCCAGG - Intronic
1200224437 X:154409376-154409398 CACCCAGACCCCGCCTTCCCGGG + Intronic