ID: 1169075667

View in Genome Browser
Species Human (GRCh38)
Location 20:2758654-2758676
Sequence GACCCCAGGCTCCTTCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 695
Summary {0: 1, 1: 0, 2: 5, 3: 60, 4: 629}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169075667_1169075676 14 Left 1169075667 20:2758654-2758676 CCTGGGAGAAGGAGCCTGGGGTC 0: 1
1: 0
2: 5
3: 60
4: 629
Right 1169075676 20:2758691-2758713 GGAGGTAGGGAGCAAGGGCGTGG 0: 1
1: 0
2: 1
3: 112
4: 1514
1169075667_1169075671 -4 Left 1169075667 20:2758654-2758676 CCTGGGAGAAGGAGCCTGGGGTC 0: 1
1: 0
2: 5
3: 60
4: 629
Right 1169075671 20:2758673-2758695 GGTCGTCTCTCTCTTGAGGGAGG 0: 1
1: 0
2: 1
3: 6
4: 95
1169075667_1169075672 0 Left 1169075667 20:2758654-2758676 CCTGGGAGAAGGAGCCTGGGGTC 0: 1
1: 0
2: 5
3: 60
4: 629
Right 1169075672 20:2758677-2758699 GTCTCTCTCTTGAGGGAGGTAGG 0: 1
1: 1
2: 1
3: 30
4: 288
1169075667_1169075674 8 Left 1169075667 20:2758654-2758676 CCTGGGAGAAGGAGCCTGGGGTC 0: 1
1: 0
2: 5
3: 60
4: 629
Right 1169075674 20:2758685-2758707 CTTGAGGGAGGTAGGGAGCAAGG 0: 1
1: 0
2: 5
3: 54
4: 687
1169075667_1169075675 9 Left 1169075667 20:2758654-2758676 CCTGGGAGAAGGAGCCTGGGGTC 0: 1
1: 0
2: 5
3: 60
4: 629
Right 1169075675 20:2758686-2758708 TTGAGGGAGGTAGGGAGCAAGGG 0: 1
1: 0
2: 6
3: 100
4: 1766
1169075667_1169075670 -7 Left 1169075667 20:2758654-2758676 CCTGGGAGAAGGAGCCTGGGGTC 0: 1
1: 0
2: 5
3: 60
4: 629
Right 1169075670 20:2758670-2758692 TGGGGTCGTCTCTCTCTTGAGGG 0: 1
1: 0
2: 2
3: 11
4: 84
1169075667_1169075677 15 Left 1169075667 20:2758654-2758676 CCTGGGAGAAGGAGCCTGGGGTC 0: 1
1: 0
2: 5
3: 60
4: 629
Right 1169075677 20:2758692-2758714 GAGGTAGGGAGCAAGGGCGTGGG 0: 1
1: 0
2: 2
3: 29
4: 438
1169075667_1169075673 1 Left 1169075667 20:2758654-2758676 CCTGGGAGAAGGAGCCTGGGGTC 0: 1
1: 0
2: 5
3: 60
4: 629
Right 1169075673 20:2758678-2758700 TCTCTCTCTTGAGGGAGGTAGGG 0: 1
1: 0
2: 3
3: 17
4: 230
1169075667_1169075669 -8 Left 1169075667 20:2758654-2758676 CCTGGGAGAAGGAGCCTGGGGTC 0: 1
1: 0
2: 5
3: 60
4: 629
Right 1169075669 20:2758669-2758691 CTGGGGTCGTCTCTCTCTTGAGG 0: 1
1: 1
2: 1
3: 4
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169075667 Original CRISPR GACCCCAGGCTCCTTCTCCC AGG (reversed) Intronic
900011949 1:121340-121362 CACCGCAAGCTCCGTCTCCCGGG + Intergenic
900028054 1:297879-297901 CACCGCAAGCTCCGTCTCCCGGG + Intergenic
900042009 1:477353-477375 CACCGCAAGCTCCGTCTCCCGGG + Intergenic
900063447 1:712299-712321 CACCGCAAGCTCCGTCTCCCGGG + Intergenic
900249897 1:1663119-1663141 GGCTCCAGGCTCCTTCTGCCAGG + Exonic
900260933 1:1729029-1729051 GGCTCCAGGCTCCTTCTGCCAGG + Intronic
900302215 1:1983525-1983547 GAACCGAGGCTCCTTCTGACTGG + Intronic
900310864 1:2032580-2032602 GCCCCCAGGCTCCTGCCCCAAGG + Intergenic
900585787 1:3431626-3431648 GGCCCGGGGCTCCCTCTCCCAGG - Intronic
900653813 1:3745162-3745184 GCCCCCAGGCTCCTTGGGCCTGG + Intergenic
900692424 1:3988587-3988609 CATCCCTGGCTCCTTCTCCCAGG - Intergenic
900902516 1:5526700-5526722 GCACCCATGCTCCCTCTCCCAGG - Intergenic
900963085 1:5938098-5938120 GACACCAGGCTCCACCTCCAAGG - Intronic
901210301 1:7520707-7520729 TACCCCAGGCTCCTACGCCAAGG + Intronic
901331649 1:8413977-8413999 CACCACAGCCTCCGTCTCCCGGG - Intronic
901524852 1:9814024-9814046 CACTGCAAGCTCCTTCTCCCAGG - Intronic
901878511 1:12180669-12180691 GACCCCACGCCCCCTCACCCTGG - Intronic
903080838 1:20811085-20811107 GACTACAGGCGCCTGCTCCCAGG + Intronic
903173736 1:21568873-21568895 GACCCCAAGCTCCAGCTCCTTGG + Intronic
903606576 1:24579166-24579188 TACCCCATGCACCTTTTCCCAGG - Intronic
904606948 1:31703358-31703380 GACTCCAGCCCCCTTCTCCCTGG + Intronic
905105837 1:35563194-35563216 ATCCCCAGGCTCCTCCTGCCTGG + Exonic
905644730 1:39617270-39617292 GCCCCCAGGCCCCTCCTCACAGG + Intergenic
905866475 1:41379671-41379693 GGCCCCAGGCTCCCTGTCTCTGG - Intronic
906413347 1:45598244-45598266 CACTGCAGCCTCCTTCTCCCAGG + Intronic
907247177 1:53115733-53115755 GGGCCCAGGCTCCTTGTCACAGG + Intronic
907305809 1:53512658-53512680 GACCCGAGGCTCCTACCCGCAGG + Intronic
907322921 1:53616965-53616987 GATCCCAGGCTCCCTCCTCCAGG + Intronic
907332933 1:53683138-53683160 GACCCCAGACTCCATATGCCAGG - Intronic
907421271 1:54348917-54348939 GACACTAGGCTACCTCTCCCAGG - Intronic
908936866 1:69386157-69386179 CACTGCAAGCTCCTTCTCCCAGG - Intergenic
910138656 1:84001092-84001114 GACCCAATGCTCCTGCTCCTCGG - Intergenic
911149042 1:94579764-94579786 CACCCCAGGCTCCCCATCCCAGG + Intergenic
911211178 1:95139532-95139554 CACTCCAGCCTCCGTCTCCCAGG + Intronic
912273389 1:108232019-108232041 GTCACCTGGCTCCTTCTCACAGG - Intronic
912294831 1:108462303-108462325 GTCACCTGGCTCCTTCTCACAGG + Intronic
912386054 1:109271718-109271740 GACCCCTGGCTCCCTCACCGAGG - Exonic
912439489 1:109687709-109687731 AGCCCCAGGCGCCCTCTCCCGGG + Intronic
912596807 1:110887137-110887159 CACTCCAAGCTCCGTCTCCCGGG + Intronic
912707935 1:111928730-111928752 GACCTCAGGGTCCTGGTCCCAGG + Intronic
912997319 1:114544062-114544084 CACCACAGTCTCCATCTCCCGGG + Intergenic
913048930 1:115098476-115098498 CTCCCCAGGCACCTTCCCCCAGG - Intergenic
914379393 1:147102837-147102859 GTCCTCAGTTTCCTTCTCCCAGG - Intergenic
915320658 1:155054349-155054371 GTCCCCAGGCCCCTGCTCCAGGG - Exonic
915712736 1:157916906-157916928 GACAAAAGTCTCCTTCTCCCAGG - Intergenic
916058872 1:161085621-161085643 GACCTCAGCCGCCTTCTCCACGG + Intronic
917735206 1:177913920-177913942 GTCCCCAAGCACCTTCTCCTTGG - Intergenic
917794151 1:178520912-178520934 GACCCCTGGCTCCGGCTCCCTGG + Intronic
919658115 1:200217268-200217290 CACTGCAGCCTCCTTCTCCCGGG + Intergenic
919721680 1:200843945-200843967 CACTGCAGGCTCCATCTCCCAGG + Intronic
919735529 1:200947985-200948007 GACTCTAGGCTCCTTTGCCCAGG - Intergenic
919792276 1:201299962-201299984 GACCACAGCCTCCTACTCCCAGG + Intronic
919940194 1:202281085-202281107 GATCCCAGGTTCCTACTCCCTGG - Intronic
920253572 1:204638890-204638912 ACCCCCAGGCTCCTGCTCCCAGG + Intronic
920373296 1:205493003-205493025 AACCCCAGGCTCTTCCTCACTGG + Intergenic
920564165 1:206960450-206960472 GTCCCCAGGGTCCTACTGCCGGG + Exonic
921955342 1:220977490-220977512 CACTGCAAGCTCCTTCTCCCCGG - Intergenic
922260377 1:223937818-223937840 CACCGCAAGCTCCGTCTCCCGGG + Intergenic
922360809 1:224819680-224819702 GGCCCCTGCCTCTTTCTCCCTGG + Intergenic
922558622 1:226550859-226550881 GACCCCTGGCTCCTTGCCCTGGG + Intronic
922964125 1:229673886-229673908 GGACCCAGGCTCCTTCTCCCTGG - Intergenic
923338843 1:232991252-232991274 GTCCCCAGTGTCCCTCTCCCAGG - Intronic
924341551 1:243040009-243040031 CACCGCAAGCTCCGTCTCCCGGG + Intergenic
1062799593 10:369243-369265 GACCTCAGGCTGCTCTTCCCTGG - Intronic
1063008186 10:1994789-1994811 AAGCCCAGGCTCCTGCTCCAAGG - Intergenic
1063517890 10:6714250-6714272 CACTGCAGCCTCCTTCTCCCAGG + Intergenic
1064628940 10:17289607-17289629 CACTGCAGGCTCCGTCTCCCGGG + Intergenic
1064946255 10:20793627-20793649 CACCGCAGCCTCCATCTCCCAGG + Intronic
1065264415 10:23959989-23960011 CACCGCAAGCTCCTCCTCCCGGG + Intronic
1065546542 10:26827295-26827317 CACCGCAAGCTCCTTCTCCCAGG + Intronic
1065617071 10:27538009-27538031 CACCACAGGCTCCTCCTCCTTGG - Exonic
1066518925 10:36194601-36194623 TACCCCCTGCTCCTCCTCCCCGG - Intergenic
1066550365 10:36549093-36549115 CACCGCAAGCTCCGTCTCCCGGG - Intergenic
1067234338 10:44435694-44435716 GTCCCCAGGCTCCCTCCTCCAGG + Intergenic
1068371792 10:56126371-56126393 GACTGCAGGCTCCGCCTCCCGGG - Intergenic
1068783441 10:60944762-60944784 TAGCCCAGCCTCCTCCTCCCTGG + Intronic
1070389460 10:75956632-75956654 GGGCCCAGGCTGCTTCTACCTGG + Intronic
1072715302 10:97748205-97748227 GGCCCCAGGCTCCACTTCCCAGG + Intronic
1073390631 10:103173539-103173561 CACTGCAGGCTCCGTCTCCCGGG - Intronic
1074042694 10:109808078-109808100 CAGCCCAGGCTCCTTCTCATTGG - Intergenic
1074500459 10:114018804-114018826 CACCGCAAGCTCCATCTCCCGGG - Intergenic
1075804719 10:125178227-125178249 GACACCAGGCACATTCTCTCAGG - Intergenic
1076187991 10:128463835-128463857 GAAACCAGCCTCATTCTCCCCGG + Intergenic
1076223731 10:128756726-128756748 GACCACAACCTCCATCTCCCGGG - Intergenic
1076293111 10:129362727-129362749 CACCCTAGGCTGTTTCTCCCGGG - Intergenic
1076634587 10:131874051-131874073 GACCCCGTGCAACTTCTCCCAGG + Intergenic
1076734256 10:132451711-132451733 GCCTCCAGGAACCTTCTCCCAGG + Intergenic
1076754006 10:132558626-132558648 GAGCCCTTCCTCCTTCTCCCTGG + Intronic
1076859534 10:133134075-133134097 GACCCCAGGCTGCATCCCCCCGG + Intergenic
1076890223 10:133279787-133279809 GGCCCCCGGCTCCTGCACCCAGG - Exonic
1076968280 11:113560-113582 CACCGCAAGCTCCGTCTCCCGGG + Intergenic
1076996152 11:298438-298460 GACCCCAGGCTGCTGCCCCTGGG - Exonic
1077030430 11:463301-463323 CACCGCAAGCTCCGTCTCCCGGG + Intronic
1077121408 11:910659-910681 GACCCCACGCCCGTCCTCCCGGG + Intronic
1077191870 11:1259066-1259088 GACCCGAGGCACCTGCCCCCAGG + Intronic
1077191889 11:1259119-1259141 GACCCGAGGCACCTGCCCCCAGG + Intronic
1077191924 11:1259225-1259247 GACCCGAGGCACCTGCCCCCAGG + Intronic
1077191933 11:1259251-1259273 GACCCGAGGCACCTGCCCCCAGG + Intronic
1077191957 11:1259330-1259352 GACCCGAGGCACCTGCCCCCAGG + Intronic
1077197377 11:1288214-1288236 GACACCAGGCTCCTCCCCACAGG - Intronic
1077282323 11:1751281-1751303 GACCCCTGGCTCCCTCTCAGTGG - Intronic
1078287452 11:9971601-9971623 CACCACAGCCTCCATCTCCCAGG - Intronic
1079117952 11:17652547-17652569 TACTCCAGGCTCCTTCTTCCTGG + Intergenic
1079939421 11:26659619-26659641 GACTCCAGCCTCCATCTCCTGGG - Intronic
1080854838 11:36103311-36103333 GACTGCAGGCTCCACCTCCCGGG + Intronic
1081436235 11:43030362-43030384 CACTGCAAGCTCCTTCTCCCGGG - Intergenic
1081493460 11:43583848-43583870 CACCCCAGGCTACTCCTTCCGGG + Intronic
1081666859 11:44921629-44921651 TGGCCCAGGCTCCTTCTCTCTGG - Intronic
1081736766 11:45409742-45409764 GACATCAGGCCCCTTCTCCAGGG - Intergenic
1081874736 11:46400902-46400924 GACACCCGGCTCCAGCTCCCAGG + Intronic
1083322815 11:61857636-61857658 GGCCCCAGGCATCTCCTCCCTGG + Intronic
1083573025 11:63769755-63769777 GACCCCAGGCTGCTGCGCCCCGG - Intergenic
1083593392 11:63907987-63908009 GAGCAGAGGCTCCTTCTCCCCGG + Intronic
1083623776 11:64061490-64061512 GTCCCCAGGCAGCTCCTCCCCGG + Intronic
1083668036 11:64285861-64285883 GACCCGGGGCTCCGGCTCCCCGG - Intronic
1083736381 11:64683836-64683858 GACCCTCGGCTGCTTCTTCCTGG - Intronic
1083773704 11:64882710-64882732 GGCCTCAGGCTCTTTCTCACTGG - Intronic
1083825486 11:65201018-65201040 CACTGCAAGCTCCTTCTCCCGGG + Intronic
1083992763 11:66257265-66257287 GACCCCAGGCTCCGCATCCCGGG - Intergenic
1084481306 11:69422137-69422159 GACCCCAAACTCCGCCTCCCAGG + Intergenic
1084640574 11:70423573-70423595 GAGCCCAGGCTACTGCTCCCTGG - Intronic
1084684493 11:70685770-70685792 GACACAAGTCTCCTTCTCACTGG + Intronic
1084949213 11:72655339-72655361 GTCCCCAGGCTGCCTCACCCTGG - Intronic
1084974980 11:72792123-72792145 CACCGCAAGCTCCGTCTCCCGGG + Intronic
1085056860 11:73409661-73409683 GACCTCAGCCTCTTTCCCCCAGG - Exonic
1086347147 11:85908473-85908495 GACCACAGCCTCCACCTCCCAGG - Intronic
1089271309 11:117303280-117303302 GACCCCAGGCTGCAGCTCCCTGG - Intronic
1089645397 11:119875579-119875601 GACCCCAGGCTTCTCCTCACTGG - Intergenic
1089691789 11:120191414-120191436 GAGCCCAGTTTCCTCCTCCCTGG - Intergenic
1090184757 11:124730019-124730041 TCCCCCAGGCTCTGTCTCCCAGG + Intergenic
1090196470 11:124821043-124821065 GAGCACAAACTCCTTCTCCCAGG - Intergenic
1090824278 11:130373168-130373190 CACCGCAAGCTCCTCCTCCCGGG - Intergenic
1091381054 12:60039-60061 CACCGCAACCTCCTTCTCCCAGG - Intergenic
1091434338 12:460898-460920 GACCCCACGGACCTCCTCCCCGG - Intronic
1091583724 12:1804302-1804324 GACCCGAGTCTTCTGCTCCCTGG + Intronic
1091632176 12:2170626-2170648 GTCTCCTGGCTCCTGCTCCCTGG + Intronic
1091635886 12:2196191-2196213 GACCCCAGACTCCTTGCCCCAGG - Intronic
1091688270 12:2578976-2578998 GGCCACAGCCTCCTCCTCCCTGG + Intronic
1092124425 12:6065555-6065577 GAACCCACGCTCCTGCTTCCAGG + Intronic
1092145993 12:6215059-6215081 GACCCCAGGTTCCCTCCCCGTGG + Intronic
1092162356 12:6322803-6322825 CACCGCAGGCTCTATCTCCCGGG - Intronic
1092241189 12:6837497-6837519 GACCCAGGCCTACTTCTCCCCGG + Exonic
1096184933 12:49572685-49572707 GGCCCCAGGCTCCATCTTCTGGG + Intronic
1096286837 12:50307792-50307814 CACTGCAAGCTCCTTCTCCCGGG + Intergenic
1096309196 12:50505253-50505275 GGCCCCGGGCGCCCTCTCCCCGG - Intronic
1097333931 12:58361286-58361308 GAGCTAAGGCTCCTTCTCCCTGG - Intergenic
1097552790 12:61097352-61097374 CACCTCAAGCTCCGTCTCCCGGG - Intergenic
1099105567 12:78491779-78491801 GACCCAAGCTTCCCTCTCCCAGG - Intergenic
1100353695 12:93808988-93809010 CACTTCAGCCTCCTTCTCCCAGG + Intronic
1100475535 12:94932040-94932062 GCCCCCAGGTGCCTTCTACCTGG - Intronic
1101706469 12:107225414-107225436 CACCGCAGCCTCCATCTCCCGGG - Intergenic
1101840748 12:108325905-108325927 GACCCCAGGCTCCTCATCCAGGG + Intronic
1101947156 12:109146188-109146210 TACCCCTGGCCTCTTCTCCCAGG - Intronic
1101997841 12:109537778-109537800 CACTGCAGGCTCCGTCTCCCAGG + Intergenic
1103465716 12:121140457-121140479 GACTCCAGGAACCTTCTCACTGG - Intronic
1103634738 12:122294251-122294273 CACTGCAAGCTCCTTCTCCCAGG - Intronic
1103745592 12:123121054-123121076 CAGCCCAGGCTCCTTCTCTGGGG + Intronic
1103795456 12:123500005-123500027 CACTGCAGGCTCCTCCTCCCGGG + Intronic
1104232700 12:126900521-126900543 GAACCCAGGCTGCTCCTTCCCGG - Intergenic
1104679658 12:130740608-130740630 GAGCCCAGGCTTCTAGTCCCAGG - Intergenic
1104786481 12:131452951-131452973 GACCCCATTCTCCTTATGCCTGG - Intergenic
1104858735 12:131913940-131913962 GGCCCCTGCCTTCTTCTCCCAGG + Intronic
1104943673 12:132406262-132406284 GACCCAAGGCTCTGTCCCCCAGG + Intergenic
1104952531 12:132448129-132448151 GACCCCAGGCTGTGTCTCCTGGG - Intergenic
1105544514 13:21341939-21341961 GAACCCAGGCTGCTCCTCCCGGG + Intergenic
1105745008 13:23369618-23369640 CACTGCAAGCTCCTTCTCCCAGG + Intronic
1106191961 13:27461229-27461251 CACCGCAAGCTCCTCCTCCCGGG - Intergenic
1106698999 13:32208945-32208967 GACAGCAGGCTCCTCCTCCCGGG + Exonic
1107195377 13:37644795-37644817 CACCACAGGCTCCACCTCCCGGG - Intronic
1107954717 13:45499940-45499962 CACCCCAGCCTCCATCTCCCGGG - Intronic
1108393964 13:49975185-49975207 CACCGCAGCCTCCATCTCCCTGG + Intergenic
1109189745 13:59310037-59310059 CACTGCAGCCTCCTTCTCCCAGG + Intergenic
1109715810 13:66220404-66220426 GTCCCCAGGCTGCTTTTCTCTGG + Intergenic
1110519413 13:76457375-76457397 CACTGCAAGCTCCTTCTCCCGGG - Intergenic
1111996202 13:95168297-95168319 GAACCCAGGCTCCCTATTCCTGG + Intronic
1112377156 13:98853992-98854014 GAGCCCAGGCGCCATCACCCAGG + Intronic
1112436549 13:99394786-99394808 GACCCCACGCTCCCTATCTCAGG + Intergenic
1113074871 13:106458417-106458439 GACCACACTCTCCTTCTCCATGG + Intergenic
1113144062 13:107187264-107187286 GACCCCAGTGACCTTCTCTCTGG - Intronic
1113309122 13:109112677-109112699 CACCACAACCTCCTTCTCCCAGG - Intronic
1113749770 13:112769125-112769147 GCCCCCCGGCTCCTCCTTCCAGG + Intronic
1113800936 13:113085902-113085924 GACCCTTGGCACCTGCTCCCCGG - Intronic
1113906944 13:113823740-113823762 ACCCCCAGGCTGTTTCTCCCTGG + Intronic
1114063020 14:19037616-19037638 GACCCCTGCCCCCTGCTCCCCGG - Intergenic
1114099239 14:19362381-19362403 GACCCCTGCCCCCTGCTCCCCGG + Intergenic
1114495144 14:23126964-23126986 CACCCCAGGGTCCATGTCCCAGG - Exonic
1114501744 14:23174757-23174779 GCCCCCAGATCCCTTCTCCCTGG - Intronic
1114672766 14:24420624-24420646 GACCCCAGGCCCCTGCACCATGG - Intergenic
1115642092 14:35341491-35341513 TCCACCAGGCTCCTTCTCCAGGG + Intergenic
1115753541 14:36513566-36513588 GGCCCCAGGCTACTTCCCACCGG + Exonic
1115854546 14:37616619-37616641 CACCGCAAGCTCCGTCTCCCGGG - Intronic
1116249779 14:42465927-42465949 CACCCCAACCTCCGTCTCCCGGG - Intergenic
1119183975 14:72624412-72624434 CACTGCAGCCTCCTTCTCCCGGG + Intronic
1119221498 14:72911768-72911790 GACCCCAGAATCCTACTCCTAGG - Intergenic
1119393294 14:74306244-74306266 GACCGCAGCCTCCATCTCCTGGG + Intronic
1119548994 14:75494482-75494504 CACCGCAAGCTCCATCTCCCGGG + Intergenic
1119743384 14:77028059-77028081 GAGCTCAGGCGCCTTCTTCCTGG + Exonic
1119984017 14:79115247-79115269 GACCGCAGCCTCCGTCTCCCAGG - Intronic
1120094808 14:80376333-80376355 CACCACAACCTCCTTCTCCCAGG - Intronic
1120178386 14:81318773-81318795 GATCACAGGTTCCGTCTCCCAGG - Intronic
1120311324 14:82831880-82831902 CACTGCAAGCTCCTTCTCCCGGG + Intergenic
1120601988 14:86521987-86522009 TAGCCAAGTCTCCTTCTCCCTGG - Intergenic
1121695990 14:95912864-95912886 CACTGCAGGCTCCATCTCCCAGG + Intergenic
1122091143 14:99341369-99341391 CACCTCAGGCTCCATCTCCAAGG + Intergenic
1122745723 14:103896253-103896275 AGCCCCAGGCTCCTTCCTCCAGG + Intergenic
1122773702 14:104108053-104108075 GACCCCAGGCTCAGACACCCCGG - Intronic
1122776802 14:104120611-104120633 TACTCTAGGCTCCTGCTCCCAGG - Intergenic
1122911196 14:104828489-104828511 CACTGCAGGCTCCGTCTCCCGGG + Intergenic
1123020640 14:105396271-105396293 TGCCCCAGGCTCCTGGTCCCAGG - Exonic
1123206995 14:106723517-106723539 GAACCCAGGCTGCTTCTCAGTGG - Intergenic
1123212014 14:106770520-106770542 GAACCCAGGCTGCTTCTCAGTGG - Intergenic
1123891091 15:24780331-24780353 CACTCCAGGCTCCTGCTCTCAGG + Intergenic
1124155660 15:27223348-27223370 GTATCCAGGCTCCTCCTCCCTGG - Intronic
1124410410 15:29432289-29432311 GACACCAGGCTCAGACTCCCAGG + Intronic
1124625693 15:31306429-31306451 CTCCCCAGTCTCCTTCTTCCAGG + Intergenic
1125505417 15:40265157-40265179 CTCCCCAGCCTCCTTCGCCCTGG - Intronic
1125532800 15:40424515-40424537 GTCCCCTTTCTCCTTCTCCCTGG + Intronic
1125679478 15:41522015-41522037 GAACCCAGCCTGCTTCTGCCAGG - Intronic
1125846091 15:42855758-42855780 CACCGCAGGCTCCGCCTCCCGGG + Intronic
1126746380 15:51829944-51829966 GACTCCAGGCTCCTTCCCGACGG + Intronic
1126786194 15:52179626-52179648 GGCCCCAGGGCCCTGCTCCCGGG + Intronic
1127136003 15:55924317-55924339 GACCCCTGGTTCCTACTCCATGG - Intronic
1128510472 15:68311185-68311207 GACCCCAGCTCCCTTCTCCCAGG - Intronic
1129317576 15:74754724-74754746 TCCCCCAGGCACCTCCTCCCAGG + Intronic
1129611200 15:77059156-77059178 CACTGCAGGCTCCGTCTCCCAGG + Intronic
1129841968 15:78749546-78749568 GACTGCAGCCTCCATCTCCCAGG + Intergenic
1130920442 15:88339549-88339571 GAACCCAGCGTCCTTCTCACTGG - Intergenic
1131483494 15:92801669-92801691 GTTCCCTGGCTCCTTCTTCCAGG + Intronic
1132225822 15:100140714-100140736 GAACACAGGCTCCTTCCCACTGG + Intronic
1132567640 16:630693-630715 GACCCCAGGCTCCTATGCCATGG - Intronic
1132766067 16:1534724-1534746 GCCCCAAGGCCCCCTCTCCCTGG + Intronic
1132946869 16:2536602-2536624 GCCCCGAGGCTCCTCCACCCTGG + Intergenic
1133134467 16:3700241-3700263 CACCCCATCCTCCTCCTCCCGGG + Intronic
1133277624 16:4648249-4648271 GTCACCCGGCTCCTCCTCCCGGG + Intronic
1133277660 16:4648357-4648379 GTCACCCGGCTCCTCCTCCCGGG + Intronic
1133277699 16:4648465-4648487 GTCACCTGGCTCCTCCTCCCGGG + Intronic
1133277769 16:4648642-4648664 GTCACCCGGCTCCTCCTCCCGGG + Intronic
1133277808 16:4648750-4648772 GTCACCCGGCTCCTCCTCCCGGG + Intronic
1133631808 16:7629148-7629170 GGCCCTGGGCTGCTTCTCCCTGG + Intronic
1133744719 16:8677314-8677336 GTCCCCAGGCACCTTGGCCCTGG - Intronic
1135155227 16:20047184-20047206 CACTGCAGGCTCCGTCTCCCAGG + Intronic
1135403813 16:22184102-22184124 GACCACATGCTCCCTCTACCGGG - Intronic
1135422483 16:22314356-22314378 GGCCCCAGCTTCCTGCTCCCAGG - Intronic
1135691356 16:24540024-24540046 AACCCCTGGCGCCTGCTCCCCGG - Intronic
1135917160 16:26615526-26615548 GTCCTCTGGCTCCTGCTCCCAGG + Intergenic
1136174901 16:28509903-28509925 GACCGCAAGCTCCACCTCCCGGG + Intronic
1136189616 16:28608061-28608083 CACCACAACCTCCTTCTCCCGGG + Intronic
1137398104 16:48131397-48131419 GACCTCACTCTCCTGCTCCCAGG + Intronic
1138098396 16:54231722-54231744 CAACCCAGGCTTCATCTCCCAGG - Intergenic
1138579657 16:57932476-57932498 CACCCCAAGCTCCTTCTCCTGGG + Intronic
1139508906 16:67415381-67415403 CACCGCAGGCTCCGGCTCCCGGG - Intronic
1139585346 16:67899409-67899431 CACTGCAAGCTCCTTCTCCCGGG + Intronic
1139914486 16:70419632-70419654 GACCCGAGGCTGCTGCACCCAGG - Intronic
1139930409 16:70521775-70521797 CACTGCAAGCTCCTTCTCCCTGG + Intronic
1140676684 16:77338876-77338898 CACTGCAGGCTCCATCTCCCGGG - Intronic
1140797600 16:78454579-78454601 GACCCCAAGCTCCGCTTCCCAGG + Intronic
1140936987 16:79681248-79681270 CACTCCAGCCTCCATCTCCCAGG - Intergenic
1141669831 16:85485908-85485930 GAGCACAGGCCCCTTCACCCCGG + Intergenic
1141806856 16:86347649-86347671 GACCCCAAGCTCCCTCTCTCTGG - Intergenic
1142145587 16:88491625-88491647 GGCGCCAGGCTCCATCCCCCAGG - Intronic
1142360713 16:89625279-89625301 GACCCTATTCTCCTGCTCCCAGG + Intronic
1142367300 16:89657175-89657197 GACCCGGGACCCCTTCTCCCGGG - Intronic
1142452398 16:90185574-90185596 CACCGCAAGCTCCGTCTCCCGGG - Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1142685576 17:1575345-1575367 GACCCCAGGCCCCGGGTCCCCGG + Exonic
1143019096 17:3907459-3907481 GACTCCCTGCTCCTTCCCCCAGG + Intronic
1143216277 17:5227572-5227594 GCCCCCAAGCCCCTTCTCTCTGG - Intronic
1143620169 17:8076038-8076060 GACCCCAGGCCCCTTCCCCAAGG + Intronic
1144767532 17:17740706-17740728 TCCCCCAGGCTCCTGCTGCCTGG - Intronic
1145751661 17:27359550-27359572 GACCACATGCTCCTTCCCCCTGG + Intergenic
1146314798 17:31798384-31798406 GACTTCTGGCTCCTTCTCCCAGG - Intergenic
1146535600 17:33647913-33647935 GAATCCAGGACCCTTCTCCCAGG - Intronic
1147211502 17:38874913-38874935 CACCCCACCCTCCTTCTCCAAGG + Intronic
1147239498 17:39081235-39081257 GACCCCAGGTTGGTTCTTCCTGG - Intronic
1147641822 17:42007024-42007046 CACCGCAAGCTCCATCTCCCGGG - Intronic
1147850785 17:43441009-43441031 GACCACAGGCGCCTGCTACCAGG - Intergenic
1148001818 17:44392656-44392678 GACCGCAACCTCCGTCTCCCAGG - Intergenic
1148099328 17:45078735-45078757 CACTGCAGGCTCCTCCTCCCAGG + Intronic
1148205479 17:45777021-45777043 GGCCCCAGGCTCCTGCCTCCAGG - Intergenic
1148321528 17:46758323-46758345 GGCCTCAGGGTCCTCCTCCCAGG - Intergenic
1148368806 17:47078134-47078156 GACTGCAGCCTCCATCTCCCGGG + Intergenic
1148790819 17:50171683-50171705 GGCCTCAGGCTCCTTCACCCTGG - Intronic
1148909376 17:50932543-50932565 GAACCCAGGCTTCTAGTCCCTGG + Intergenic
1149322240 17:55493363-55493385 AACCCCAGGCTGCTGCTCCAAGG + Intergenic
1150244312 17:63662731-63662753 CACCGCAGCCTCCATCTCCCGGG + Intronic
1150426020 17:65077682-65077704 GAGCCCAGCCTCGATCTCCCTGG - Intergenic
1150630130 17:66874632-66874654 GACCCCAGACACCTTCTGCTAGG + Intronic
1150734281 17:67723086-67723108 CACCGCAGCCTCCTCCTCCCGGG + Intronic
1151229552 17:72673990-72674012 CACTGCAGCCTCCTTCTCCCAGG - Intronic
1151365363 17:73613284-73613306 GACTCCAAGCCCCGTCTCCCTGG + Intronic
1151646069 17:75432640-75432662 CACCGCAAGCTCCTCCTCCCGGG - Intergenic
1151785418 17:76272677-76272699 GGCCCCAGCCCCTTTCTCCCCGG - Intergenic
1151868579 17:76821169-76821191 GTCCACATGCTCCTTCTCTCAGG - Intergenic
1152352585 17:79791807-79791829 GACCTCAGGCGCATCCTCCCGGG + Intergenic
1152757309 17:82092409-82092431 TCCCTCAGGCTCCTGCTCCCTGG - Intronic
1152799631 17:82324720-82324742 GGCTCCAGGCTACTTCTCCCGGG - Exonic
1153249460 18:3106745-3106767 CACCACAGCCTCCATCTCCCAGG - Intronic
1153626574 18:7026916-7026938 GACTACAAGCTCCATCTCCCAGG - Intronic
1154111063 18:11568757-11568779 GTCCCCTGCCTTCTTCTCCCAGG + Intergenic
1154451058 18:14475031-14475053 GACCCCTGCCCCCTGCTCCCCGG + Intergenic
1155473475 18:26214645-26214667 GACACCATGCTCCTCCTGCCAGG - Intergenic
1157966885 18:52218419-52218441 GACCTCAGGGCCCTTATCCCAGG + Intergenic
1158154094 18:54406045-54406067 CACTGCAGCCTCCTTCTCCCAGG + Intergenic
1158708814 18:59818745-59818767 GACTGCAGTCTCCTCCTCCCGGG - Intergenic
1159383790 18:67696272-67696294 CACCACAGCCTCCATCTCCCGGG + Intergenic
1159687177 18:71437099-71437121 GACCCAGTGCTCCTTCTGCCAGG + Intergenic
1159796580 18:72851333-72851355 CACCACAACCTCCTTCTCCCGGG - Intronic
1159895713 18:73994158-73994180 CACTCCAAGCTCCTCCTCCCGGG + Intergenic
1160299585 18:77668188-77668210 GGACCCGGCCTCCTTCTCCCTGG + Intergenic
1160645089 19:183494-183516 CACCGCAAGCTCCGTCTCCCGGG + Intergenic
1160878401 19:1308503-1308525 GTCCCCAGCCTCATTCTCCCTGG - Intergenic
1160976346 19:1794552-1794574 CACCCCAGGCTGCCTCCCCCTGG - Intronic
1161089396 19:2352563-2352585 GGCCCCAGGAGACTTCTCCCTGG - Intronic
1161271119 19:3389906-3389928 CACCGCAACCTCCTTCTCCCGGG - Intronic
1161497673 19:4596468-4596490 CCCCCCAGGCCCCTCCTCCCTGG - Intergenic
1161656937 19:5522198-5522220 AACCCCAGGATCCCTCTCCAGGG + Intergenic
1162129952 19:8520367-8520389 CACTGCAAGCTCCTTCTCCCAGG + Intergenic
1162742804 19:12783015-12783037 GACCCCAGCCCCCTTCTCCCGGG - Intronic
1162756915 19:12866146-12866168 TACCCCAGGGTCCCTCTTCCCGG - Intronic
1162819315 19:13212959-13212981 CACTGCAGGCACCTTCTCCCAGG + Intronic
1162997073 19:14342980-14343002 GACCACGGGCTCCATCTCCTGGG + Intergenic
1163473093 19:17509082-17509104 CACTGCAAGCTCCTTCTCCCAGG + Intergenic
1163553905 19:17982157-17982179 GCCCCCAGCCCCCGTCTCCCTGG + Intronic
1163628694 19:18405286-18405308 CACCCCAGCCTCCTCCTTCCTGG + Intergenic
1163833648 19:19560279-19560301 GACTCCAGGCTTCTAGTCCCTGG + Intergenic
1165105184 19:33464958-33464980 GAGCCCAGGGCCTTTCTCCCAGG - Intronic
1165159195 19:33805872-33805894 GAGGCCTGGCTCCTTCTCCCCGG + Intronic
1165220962 19:34316474-34316496 GACCCCACTCTCCTTGACCCAGG - Intronic
1165360248 19:35332053-35332075 GGCCCCTGGCTCCTGCTCCTGGG + Exonic
1165583979 19:36896233-36896255 CACTTCAGGCTCCGTCTCCCAGG - Intronic
1165937533 19:39398334-39398356 GACCCCAGGGTCCTTGGCCTAGG + Exonic
1166298774 19:41902686-41902708 GTCTCCAGGCCCCTCCTCCCTGG - Intronic
1166546164 19:43635891-43635913 GACCCCAGCCCCCTCCTCCCTGG + Intronic
1166635753 19:44450573-44450595 CACTGCAAGCTCCTTCTCCCGGG - Intergenic
1166676266 19:44742850-44742872 GATTCTAGGCCCCTTCTCCCTGG - Intergenic
1166764611 19:45245382-45245404 GTCCCCAGGCTACTTCAGCCAGG + Intronic
1167633571 19:50640124-50640146 GACCCCAGGCCCCTCTTCCCAGG + Intronic
1167741116 19:51325547-51325569 TTCCCCAGCCCCCTTCTCCCTGG + Intronic
1167744680 19:51343578-51343600 CACTGCAGGCTCCATCTCCCGGG + Intergenic
1167757313 19:51421072-51421094 GACACCAGCCTCCTTCCCGCAGG + Intergenic
1168101449 19:54143588-54143610 GGCCCACAGCTCCTTCTCCCTGG - Intronic
1168145247 19:54416598-54416620 AATCCCAGCCCCCTTCTCCCAGG - Intronic
1168292902 19:55365772-55365794 GACCCCAGTCCCCTCCTCCTCGG + Exonic
1168403239 19:56098075-56098097 GGCCCCAGGCTCCTTCACCCAGG - Intronic
1168612769 19:57814468-57814490 GACCCCAGGTTCCATCCTCCCGG + Intronic
1168628112 19:57934924-57934946 GACCCCAGGTTCCATCCTCCCGG + Intronic
925009130 2:468562-468584 GACCCCCAGCGCCTTCTCCAGGG + Intergenic
925331883 2:3064715-3064737 TGCCCCAGGCTCCTTGCCCCAGG + Intergenic
925640629 2:5983026-5983048 GAGCCCTGGCTCCCTTTCCCCGG + Intergenic
925725379 2:6865985-6866007 GTCCCCAGGCGCCGGCTCCCGGG + Intronic
926197161 2:10771038-10771060 GCCCTTAGGTTCCTTCTCCCTGG - Intronic
927207145 2:20617943-20617965 GGCGCACGGCTCCTTCTCCCTGG + Exonic
927490322 2:23516982-23517004 GGACCCAGGCTCTTGCTCCCAGG - Intronic
927770367 2:25855967-25855989 CACCACAGCCTCCGTCTCCCGGG + Intronic
927851808 2:26504228-26504250 GTCCCCACGCTCATCCTCCCCGG + Intronic
927855272 2:26523808-26523830 GACCCCAGGCTCCTTCTCATGGG - Intronic
928103676 2:28453804-28453826 CACCCCAGGCTCCTTTCCCTGGG - Intergenic
928234345 2:29526983-29527005 CACCCCAGACTCCTGCTCCCTGG - Intronic
929889534 2:45907648-45907670 GGGCTCATGCTCCTTCTCCCTGG - Intronic
930489686 2:52052382-52052404 GACCGCAAGCTCCACCTCCCGGG - Intergenic
931329676 2:61267687-61267709 CACCCCAAGCTCCACCTCCCGGG + Intronic
931363943 2:61602693-61602715 CACTGCAAGCTCCTTCTCCCGGG + Intergenic
932469594 2:71945183-71945205 GACCCCAGGCTCCTGGCCCTGGG - Intergenic
933447110 2:82395576-82395598 TACCCGAGGCTCGTTTTCCCGGG + Intergenic
934149704 2:89134680-89134702 CACTGCAGGCTCCATCTCCCGGG + Intergenic
934217592 2:90047351-90047373 CACTGCAGGCTCCATCTCCCGGG - Intergenic
934870297 2:97858704-97858726 GCCTCCAGGTTCCTTCTCACGGG - Intronic
935045898 2:99482122-99482144 GTCCCCAGTCCCCTTCTCCCTGG - Intronic
935753148 2:106256563-106256585 CACCACAGCCTCCATCTCCCAGG - Intergenic
936547407 2:113404479-113404501 CACTGCAGGCTCCGTCTCCCGGG - Intergenic
936733051 2:115407113-115407135 GAGGCCAGGCTCCTTCGCCCTGG + Intronic
938082995 2:128380245-128380267 GTCCCCAGGCTCCCGCCCCCTGG + Intergenic
938654521 2:133417419-133417441 GACCCCAGGCCCACTTTCCCAGG + Intronic
938681770 2:133699451-133699473 GACCCCTGGCTCTTTCTCCGTGG - Intergenic
938861687 2:135375778-135375800 GACCACAACCTCCGTCTCCCGGG - Intronic
939699862 2:145376904-145376926 CACCCCAAACTCCTCCTCCCGGG - Intergenic
940532448 2:154895908-154895930 CACTCCAAGCTCCGTCTCCCAGG + Intergenic
941464161 2:165806088-165806110 CACTGCAGGCTCCTCCTCCCGGG + Intergenic
943135632 2:183908315-183908337 GACTGCAAGCTCCTCCTCCCGGG + Intergenic
944341494 2:198606077-198606099 CACCGCAAGCTCCTCCTCCCGGG + Intergenic
944910532 2:204306398-204306420 CACCGCAGCCTCCTTCTCCCAGG + Intergenic
945157696 2:206856857-206856879 GAGACCTGGCTCCTTCTCTCAGG + Intergenic
945260999 2:207843361-207843383 TACTCAAGTCTCCTTCTCCCAGG - Intronic
945396886 2:209329142-209329164 CACTGCAAGCTCCTTCTCCCGGG - Intergenic
945401750 2:209390406-209390428 CACTGCAAGCTCCTTCTCCCGGG - Intergenic
946471095 2:219961898-219961920 GTCCACAGGTTCCTTCTCTCTGG + Intergenic
947084007 2:226430345-226430367 TACCCCATGATCCTTCTCCCAGG + Intergenic
947748026 2:232519494-232519516 GACCCGGGGCTCTTTCCCCCTGG - Intergenic
948288324 2:236804381-236804403 GACCCCAGGCTTCTACTCCTTGG - Intergenic
948502968 2:238408377-238408399 CAGCCCAGGCTCCATCTGCCTGG - Intergenic
948588638 2:239036086-239036108 GACCCCTGGCTGCCTCCCCCTGG - Intergenic
948883922 2:240873704-240873726 CACCCCAGGCACCGTGTCCCTGG - Intronic
949083840 2:242130223-242130245 CACCGCAAGCTCCGTCTCCCGGG - Intergenic
1169075667 20:2758654-2758676 GACCCCAGGCTCCTTCTCCCAGG - Intronic
1169244161 20:4012339-4012361 GACTGCAGCCTCCGTCTCCCAGG - Intronic
1169361486 20:4953228-4953250 GACTGCAGTCTCCATCTCCCGGG - Intronic
1170004614 20:11652220-11652242 GATGCGAGGCTGCTTCTCCCAGG + Intergenic
1170768226 20:19310061-19310083 GACACCAGGCACCATCTCCCAGG - Intronic
1171182876 20:23103832-23103854 GACCCCCGGGTCATTCCCCCAGG + Intergenic
1171304550 20:24094142-24094164 CACTGCAAGCTCCTTCTCCCAGG + Intergenic
1171477746 20:25426477-25426499 CACCGCAACCTCCTTCTCCCCGG - Intronic
1171485461 20:25482412-25482434 CACTTCAGCCTCCTTCTCCCAGG + Intronic
1171487884 20:25497050-25497072 GACTCCAGGCTCAGTCTTCCTGG - Intronic
1171511050 20:25685374-25685396 GTCCCTGGACTCCTTCTCCCAGG - Intronic
1171518214 20:25756288-25756310 CACCACAAGCTCCTTCTCCTGGG - Intergenic
1171521025 20:25774397-25774419 CAGCCCAGGCTCCTGCACCCTGG + Exonic
1171933763 20:31253895-31253917 GACTCCAACCTCCATCTCCCGGG - Intergenic
1172123670 20:32612821-32612843 GTGCCCAGGCCCCTTCTCGCAGG - Intergenic
1172355436 20:34276641-34276663 GACTAGAGGCTGCTTCTCCCTGG - Intergenic
1172544253 20:35747180-35747202 TACTTCAGTCTCCTTCTCCCAGG + Intergenic
1172778274 20:37420563-37420585 CACCCCAGTCTCCTTCTCAGTGG + Intergenic
1172950230 20:38718774-38718796 GAGCCCAGGATCCCTGTCCCAGG + Intergenic
1173167762 20:40697970-40697992 GACTCCAAGCTCCTTCTGCAAGG + Intergenic
1173228660 20:41177198-41177220 GAACCCAGTCTACTTGTCCCTGG - Intronic
1173446221 20:43121012-43121034 ATCTCCCGGCTCCTTCTCCCAGG + Intronic
1173553482 20:43949319-43949341 GACCGCAGGAGCCTCCTCCCAGG + Intronic
1174001064 20:47375034-47375056 CACTGCAGCCTCCTTCTCCCGGG - Intergenic
1174358378 20:50013055-50013077 GACCCCAGGATCCTCTTCCTGGG + Intergenic
1174550824 20:51360281-51360303 GACCCCAGGCTGCTACTACCTGG - Intergenic
1174596790 20:51690342-51690364 CACTGCAGGCTCCGTCTCCCGGG - Intronic
1174621797 20:51880735-51880757 GAGCCCAGGCTCTGACTCCCGGG - Intergenic
1174996295 20:55572485-55572507 GACCCCAGGTTCCTTCCACCTGG - Intergenic
1175404292 20:58716783-58716805 GAGCTCCGGCTCCGTCTCCCCGG - Intronic
1176234667 20:64048794-64048816 GAGCCCGGCCTCCTGCTCCCGGG - Exonic
1176445176 21:6815542-6815564 GACCCCTGCCCCCTGCTCCCCGG - Intergenic
1176823343 21:13680575-13680597 GACCCCTGCCCCCTGCTCCCCGG - Intergenic
1178540214 21:33443158-33443180 GACCTCAGGGTCCTCCTACCTGG - Intronic
1178929255 21:36803296-36803318 GTCCCCAGCTTCCTTCTCCATGG + Intronic
1179403142 21:41102661-41102683 GACCCACAGCTCCTTCTCCCAGG - Intergenic
1179447352 21:41441471-41441493 CTCCCCAAGCTCCTTCACCCGGG - Intronic
1179532431 21:42028984-42029006 CAACCCAGGCTCCTTACCCCAGG - Intergenic
1179816463 21:43909369-43909391 CACCGCAAGCTCCGTCTCCCGGG + Intronic
1180071035 21:45435916-45435938 GACCCCAGGGTGCATCTCACAGG - Intronic
1180172286 21:46065787-46065809 CAGCCCCGGTTCCTTCTCCCCGG - Intergenic
1180481513 22:15760243-15760265 GACCCCTGCCCCCTGCTCCCCGG - Intergenic
1180790365 22:18572449-18572471 GACCTCTGTCTTCTTCTCCCTGG - Intergenic
1180877220 22:19180120-19180142 GACCCCACGCTCCTTGCCTCTGG - Intronic
1180952810 22:19728375-19728397 GGCCCCAGACCCCTTCTGCCAGG + Intergenic
1181231373 22:21422866-21422888 GACCTCTGTCTTCTTCTCCCTGG + Intronic
1181247278 22:21512002-21512024 GACCTCTGTCTTCTTCTCCCTGG - Intergenic
1181599637 22:23941877-23941899 GACCCCAGGTCCCTCCTCTCGGG - Intergenic
1181608870 22:23999429-23999451 GACCCCAGGTCCCTCCTCTCGGG + Intergenic
1181639556 22:24189498-24189520 GCGCCCAGGCTCCTTAGCCCAGG + Intergenic
1181787334 22:25236603-25236625 AACCCAAGCCTCCTCCTCCCGGG - Intergenic
1183214278 22:36468964-36468986 GACTCCAGCCTCCACCTCCCAGG - Intronic
1183394642 22:37564453-37564475 GACCACAGGATCCTTATTCCAGG + Intronic
1183507259 22:38215962-38215984 GAGCCCGAGCTCCTGCTCCCTGG + Exonic
1183589144 22:38769842-38769864 GAACACAGGCCCCTTCTTCCAGG - Intronic
1184036761 22:41921813-41921835 CACCGTAGGCTCCTCCTCCCAGG - Intergenic
1184198444 22:42947855-42947877 GGCCCCAGTCACCTTCTCCCTGG - Intronic
1184240615 22:43209663-43209685 GACCTCAGGCTCCAGCTCCATGG - Intronic
1184431066 22:44441808-44441830 GGCCCCAGGCTCATTCTCCTGGG - Intergenic
1184470295 22:44692242-44692264 CACCCAGGGCTCCTCCTCCCGGG + Intronic
1184470422 22:44692563-44692585 CACCCAGGGCTCCTCCTCCCGGG + Intronic
1184659689 22:45960149-45960171 CAGCCCAGGCTGCTTCTCCTTGG + Intronic
1184764508 22:46564485-46564507 GCCCCCAGGCTCCTCCTCTGTGG - Intergenic
1185008436 22:48299511-48299533 CCCCCCAGGCTCCGTGTCCCAGG + Intergenic
1185150114 22:49159442-49159464 GACCCCAGGCTCCTCGTCTGTGG - Intergenic
1185281749 22:49972637-49972659 CACCCCCGCCTCCTCCTCCCTGG + Intergenic
1185362698 22:50418459-50418481 CACTGCAAGCTCCTTCTCCCAGG + Intronic
949177920 3:1089247-1089269 TACCACAGCCTCCATCTCCCGGG + Intergenic
951049540 3:18078554-18078576 CACTGCAGCCTCCTTCTCCCGGG - Intronic
951114758 3:18846485-18846507 CACCGCAAGCTCCATCTCCCGGG - Intergenic
951537543 3:23753436-23753458 GACTGCAGGCTCCGCCTCCCAGG + Intergenic
952117026 3:30195097-30195119 GGCTCCAGGCTCCTTTTGCCTGG - Intergenic
952451715 3:33439891-33439913 GAGCTCCGGCTCCTTCGCCCTGG - Exonic
952912343 3:38201632-38201654 CACCACAAGCTCCGTCTCCCAGG - Intronic
952936721 3:38404404-38404426 GCCAGCAGGCTCCTTCTCTCTGG + Intronic
953237325 3:41118087-41118109 GACCCCAGGGTCACTCTCCTTGG + Intergenic
953371008 3:42388443-42388465 CAACCCAAGCTCCTTCTACCAGG + Intergenic
953583404 3:44177550-44177572 TTCCCCAGGCTCCTTCCCCTTGG - Intergenic
953606056 3:44414023-44414045 CACCACAGCCTCCGTCTCCCAGG - Intergenic
953981025 3:47413023-47413045 GACCCCAGAGGCCTTCTCCCTGG + Exonic
954037275 3:47858087-47858109 CACCCCAGCCTCCATCTCCCGGG + Intronic
954338270 3:49933339-49933361 CACCACAACCTCCTTCTCCCGGG + Intergenic
954343414 3:49974445-49974467 CACTGCAAGCTCCTTCTCCCGGG + Intronic
954911463 3:54114267-54114289 TGCCCCAGCCTCCTTCTCCTTGG - Intergenic
955771026 3:62384693-62384715 AGCCCCAGGCTCCTGCTCACTGG - Intergenic
957736188 3:84206379-84206401 CACCACAGCCTCCTGCTCCCAGG - Intergenic
959252423 3:103965665-103965687 GACTCCTGCCTTCTTCTCCCTGG - Intergenic
959486675 3:106934720-106934742 GACCCCAGACACATTTTCCCTGG + Intergenic
961518354 3:127452523-127452545 CTCCCCAGGCCCCTTGTCCCAGG - Intergenic
962394295 3:135001389-135001411 GTCCCCTGCCTCCATCTCCCAGG + Intronic
962800198 3:138883927-138883949 CACCGCAGCCTCCGTCTCCCGGG + Intergenic
963353458 3:144180669-144180691 CACCGCAGGCTCCAACTCCCAGG - Intergenic
964037282 3:152214880-152214902 CACCACAAGCTCCATCTCCCGGG - Intergenic
965452765 3:168858685-168858707 CAGCTCAGGCTCCTTCTCACTGG + Intergenic
966818477 3:183907657-183907679 CACTGCAGCCTCCTTCTCCCAGG + Intergenic
966863096 3:184241504-184241526 GGCACCAGGCTCCTTCCGCCTGG + Exonic
966911456 3:184562377-184562399 GACCCCAGGCACCTTGTTCCCGG - Intronic
967726284 3:192865330-192865352 GCCCTCAGTCTCCTGCTCCCAGG + Intronic
968133436 3:196206426-196206448 GACTGCAGCCTCCATCTCCCGGG + Intronic
968270827 3:197402456-197402478 CACCACAGACTCCTTCCCCCAGG + Intergenic
968473332 4:791768-791790 CACCCCAGGCCCCTTCTACGTGG + Intronic
968486547 4:865805-865827 GAACCCAGGCTCCTTCCCCTAGG + Intronic
968943736 4:3652902-3652924 GAGCCCAGACTCCCCCTCCCAGG - Intergenic
969035449 4:4249713-4249735 CACTGCAGCCTCCTTCTCCCAGG - Intergenic
969160481 4:5253448-5253470 CACCGCAACCTCCTTCTCCCAGG + Intronic
969259852 4:6026450-6026472 GACCCCAGGATGCGTTTCCCAGG - Intronic
971151373 4:24035463-24035485 CAACCCAACCTCCTTCTCCCAGG - Intergenic
972630377 4:40836766-40836788 GGCCCCAAACTCCTTCTCCCAGG - Intronic
973061360 4:45729832-45729854 CACTGCAGGCTCCGTCTCCCAGG - Intergenic
973530702 4:51834542-51834564 GTCTTCAGGCTCCTTCTCCACGG + Intergenic
974118119 4:57605969-57605991 GACCGCAACCTCCGTCTCCCAGG + Intergenic
974300647 4:60061875-60061897 CACTGCAAGCTCCTTCTCCCGGG - Intergenic
974590545 4:63942919-63942941 GAGCCCCGGCCCCTGCTCCCCGG - Intergenic
974607140 4:64167826-64167848 CACCCCAGCCTCAATCTCCCGGG - Intergenic
975656186 4:76643136-76643158 CACCACAAGCTCCATCTCCCAGG - Intronic
977673590 4:99723445-99723467 AAAGCCAGTCTCCTTCTCCCTGG + Intergenic
978318061 4:107462266-107462288 TTCCCTTGGCTCCTTCTCCCTGG - Intergenic
979261278 4:118648504-118648526 CACCGCAAGCTCCATCTCCCGGG - Intergenic
980897490 4:138874168-138874190 GTCCCAGGCCTCCTTCTCCCTGG + Intergenic
981523381 4:145688123-145688145 CACCTCAGCCTCCATCTCCCAGG - Intronic
982219365 4:153111678-153111700 AACCCCTGGCCCCTTCTACCAGG + Intergenic
983381811 4:167005139-167005161 GAACGCAGGCACCATCTCCCAGG + Intronic
983866753 4:172776095-172776117 GACCCCAGGCTCCTGGCCCACGG + Intronic
984410947 4:179397202-179397224 CACCGCAAGCTCCGTCTCCCAGG - Intergenic
984548331 4:181132615-181132637 GACCACAGGTCCCCTCTCCCAGG - Intergenic
984890784 4:184490910-184490932 CACCGCAAGCTCCATCTCCCGGG + Intergenic
985099481 4:186443747-186443769 TGCCCCAGGCTCCTTCTACTAGG + Intronic
985679074 5:1246538-1246560 GACCCCAGGCCCCCGCTCCCAGG - Intergenic
985726428 5:1518300-1518322 TACCCCAGGTTGCTTGTCCCGGG + Intronic
985861281 5:2472476-2472498 CACTTCAGGCTCCTCCTCCCAGG - Intergenic
985899057 5:2773205-2773227 GCCCCCTGGCTTCCTCTCCCTGG + Intergenic
986399962 5:7370908-7370930 CACCACAGCCTCCATCTCCCGGG - Intergenic
987298402 5:16574687-16574709 GGCCCCAGGCTCCTCCTCCCAGG + Intronic
987362703 5:17121469-17121491 CACCGCAAGCTCCGTCTCCCGGG - Intronic
987846794 5:23296884-23296906 GAATCCAGGATCCTTCTCCCAGG - Intergenic
988791545 5:34613087-34613109 CACCGCAAGCTCCGTCTCCCGGG + Intergenic
989441087 5:41473516-41473538 GAGCGCAGGCTCCGCCTCCCAGG + Intronic
990237229 5:53781343-53781365 GACCCCAGGCCCCTGCCTCCAGG + Intergenic
990984007 5:61625807-61625829 GTCCCCTGGCTCCCTCTCCAAGG + Intergenic
991195682 5:63929615-63929637 TACCCCAGCCTCCGCCTCCCAGG - Intergenic
992060049 5:73035341-73035363 CACCACAGACTCCTCCTCCCAGG - Intronic
992591738 5:78302578-78302600 CACCGCAGCCTCCGTCTCCCAGG - Intergenic
992844262 5:80729338-80729360 GACTGCAGGCTCCACCTCCCTGG - Intronic
993237547 5:85333101-85333123 CACCCCAGCCTCAGTCTCCCAGG + Intergenic
993307187 5:86288062-86288084 GTCACCTGGCTCCTTCTCACAGG + Intergenic
993669342 5:90741186-90741208 GTCCCCAGCCACCTTCTACCTGG + Intronic
995745042 5:115394092-115394114 GACCCCAGCCTCCCACTCCATGG - Intergenic
997474474 5:134134599-134134621 GGCCCTTGGCTCCTTCTCCCTGG + Intronic
998182341 5:139954265-139954287 GGCCCCAGGCTGCTCCTCTCTGG - Intronic
998237193 5:140408099-140408121 GACTGCAGCCTCCGTCTCCCGGG - Intronic
1000579093 5:163012911-163012933 CACCGCAAGCTCCATCTCCCAGG - Intergenic
1001303026 5:170551463-170551485 GACCAGAGCCCCCTTCTCCCAGG + Intronic
1001401072 5:171446700-171446722 GACCCTACTCTCCTTCTCCTTGG - Intronic
1001648640 5:173299941-173299963 GCTCCCAGCCTCCTTCTCACGGG - Intergenic
1001711861 5:173785487-173785509 GAAACCAGGCTCCTCCTTCCTGG - Intergenic
1001997946 5:176177005-176177027 GAGCCAAGGCTCTGTCTCCCAGG - Intergenic
1001998776 5:176183479-176183501 GACCCGAGGCTGTGTCTCCCAGG - Intergenic
1002020779 5:176363181-176363203 GACTGCAGCCTCCGTCTCCCAGG - Intergenic
1002195865 5:177501028-177501050 GACCCCAGGCTCCCATTCCTTGG + Intergenic
1002316962 5:178349756-178349778 GGCCCCAGGCTCCTCCTTGCAGG + Intronic
1002541500 5:179908887-179908909 GGCCCCAGGCCCGTTGTCCCAGG - Intergenic
1002568685 5:180128218-180128240 CGCCCCAGCCTCCCTCTCCCTGG + Intronic
1002603336 5:180367877-180367899 GAAACCACGCTGCTTCTCCCAGG - Intergenic
1002628884 5:180555080-180555102 CACTGCAGCCTCCTTCTCCCTGG + Intronic
1002635949 5:180608896-180608918 GACCCCAGCCTCCCTCCTCCAGG + Intronic
1002650346 5:180687103-180687125 GACCCGAGGCTGTGTCTCCCAGG - Intergenic
1002688932 5:181037189-181037211 GACCTCAGCCTCCTGCTCCACGG + Intergenic
1002731834 5:181341576-181341598 CACCGCAAGCTCCGTCTCCCGGG - Intergenic
1002752695 6:132501-132523 CACCGCAAGCTCCGTCTCCCGGG + Intergenic
1002824550 6:761213-761235 GACCACAGGCACATTCTCTCAGG - Intergenic
1003407116 6:5834614-5834636 GAACCCAGGCTGCTCCTCCCGGG - Intergenic
1004485798 6:16065434-16065456 GACTGCAAGCTCCGTCTCCCGGG + Intergenic
1004578788 6:16926922-16926944 CACCACAAGCTCCATCTCCCGGG + Intergenic
1004638416 6:17490702-17490724 GCCTCCAGGATCCTTCTCCAAGG - Intronic
1005462727 6:26084454-26084476 GGCCACTGGCTCCTCCTCCCAGG - Intergenic
1005720870 6:28600975-28600997 CACCGCAAGCTCCATCTCCCAGG + Intronic
1006396429 6:33790329-33790351 TCCCCCAGGCCCCTCCTCCCTGG + Intergenic
1006466272 6:34196631-34196653 GTCCCCAGGCTCCTTCCACAAGG - Intergenic
1006986390 6:38178514-38178536 GCCCTGGGGCTCCTTCTCCCTGG - Intronic
1007468250 6:42070414-42070436 CACGCCAAGCTCCATCTCCCAGG - Intronic
1007580365 6:42955509-42955531 CACCGCAGGCTCCGTCCCCCAGG + Intergenic
1009645071 6:66391063-66391085 GACCCCAGGCTGCTTATGCCTGG + Intergenic
1010173411 6:72998659-72998681 TACTGCAAGCTCCTTCTCCCGGG - Intronic
1010204260 6:73308905-73308927 CACTCCAACCTCCTTCTCCCAGG + Intronic
1010405162 6:75496622-75496644 CACCGCAGGCTCCGCCTCCCGGG + Intergenic
1010943902 6:81952373-81952395 CACCACAAGCTCCTCCTCCCGGG - Intergenic
1011272367 6:85592936-85592958 CACCGCAAGCTCCTCCTCCCGGG - Intronic
1012069004 6:94587568-94587590 CACTGCAAGCTCCTTCTCCCGGG - Intergenic
1013619251 6:111872803-111872825 GACCCCAAGCACCGACTCCCCGG + Intronic
1015488095 6:133794651-133794673 CACCCCAACCTCCTCCTCCCAGG + Intergenic
1016229950 6:141790394-141790416 GACTGCAGCCTCCATCTCCCAGG + Intergenic
1016361687 6:143274134-143274156 GATTTCAGGTTCCTTCTCCCAGG + Intronic
1017117586 6:150993394-150993416 CACCACAGCCTCCTCCTCCCAGG + Intronic
1017331020 6:153198414-153198436 CACTCCAGCCTCCGTCTCCCAGG + Intergenic
1018403081 6:163445688-163445710 CACTCCAGGCTCCGCCTCCCGGG + Intronic
1019236086 6:170613889-170613911 CACCGCAAGCTCCGTCTCCCGGG - Intergenic
1019434799 7:1017168-1017190 GGCCCCAGGCTCAGGCTCCCTGG + Intronic
1019614072 7:1950983-1951005 GTCCCCCGCCTCCTCCTCCCAGG - Intronic
1019689143 7:2400255-2400277 GGCTCCAGGCTCCTTCTGGCTGG - Intergenic
1019695457 7:2443520-2443542 GACCCCACACTCCTACTCCTAGG - Intergenic
1019910389 7:4096907-4096929 GAGCCCAGGCTGCCTCTTCCTGG - Intronic
1020074389 7:5248302-5248324 GGCCCCCGGCTCCTCCTCCCGGG - Intergenic
1020165831 7:5807213-5807235 CACTGCAAGCTCCTTCTCCCAGG + Intergenic
1021459697 7:20872256-20872278 CACCACAGCCTCCATCTCCCAGG - Intergenic
1021631594 7:22652657-22652679 CACCACAACCTCCTTCTCCCGGG + Intergenic
1022836411 7:34120472-34120494 CACCGCAAGCTCCTCCTCCCGGG + Intronic
1023312064 7:38897567-38897589 CACTGCAGGCTCCGTCTCCCAGG - Intronic
1023657090 7:42434619-42434641 CACCACAAGCTCCATCTCCCGGG + Intergenic
1024318434 7:48042890-48042912 GAGCACAGGCTCCTTCTCAGAGG - Intronic
1024627102 7:51217415-51217437 CACCACAGTCTCCATCTCCCGGG + Intronic
1026213714 7:68329507-68329529 CACCGCAACCTCCTTCTCCCAGG - Intergenic
1026576285 7:71574307-71574329 GCCCCCAGGCAATTTCTCCCTGG + Intronic
1026616873 7:71912955-71912977 CACCCCAGGCTTCTCCTCCAAGG - Intronic
1027453914 7:78363415-78363437 CACCACAGGCTCCGCCTCCCGGG - Intronic
1027694221 7:81388756-81388778 GACTCCAAGCTCCGCCTCCCGGG + Intergenic
1027937815 7:84632163-84632185 GACCCCAGGCACCAAGTCCCTGG - Intergenic
1028640700 7:93039496-93039518 CCCCACAGGCTCCTGCTCCCTGG + Intergenic
1029067082 7:97861095-97861117 TACCGCAAGCTCCGTCTCCCGGG + Intronic
1029431993 7:100537303-100537325 CACCTCAGCCTCCATCTCCCAGG - Intergenic
1029661972 7:101968496-101968518 CACCGCAGCCTCCGTCTCCCAGG + Intronic
1029700089 7:102240894-102240916 CACTGCAGCCTCCTTCTCCCAGG + Intronic
1032753542 7:134866147-134866169 CATCCCAGGGCCCTTCTCCCTGG - Intronic
1033460312 7:141541604-141541626 GCCTCCTGCCTCCTTCTCCCTGG + Intergenic
1034262802 7:149767065-149767087 GACCCCGGGCTCCTTCCTCTAGG - Intronic
1034483476 7:151341516-151341538 CACCCCAGGCTCAGTCTTCCAGG - Intergenic
1034903447 7:154922556-154922578 CACCACAGCCTCCTCCTCCCGGG - Intergenic
1035056902 7:156041734-156041756 GTCCCCAGGTTCATTCCCCCAGG - Intergenic
1035511683 8:192683-192705 CACCGCAAGCTCCGTCTCCCTGG + Intronic
1035681723 8:1493411-1493433 GACCGCTGCCTCCATCTCCCTGG + Intergenic
1035777973 8:2203938-2203960 GGCCCAAGTCTCCTTCTCACAGG - Intergenic
1035796078 8:2357784-2357806 CACTGCAGCCTCCTTCTCCCGGG - Intergenic
1036173093 8:6509374-6509396 AGCACCAGGCTCCTCCTCCCAGG + Intronic
1037358741 8:18051334-18051356 CACCGCAGCCTCCATCTCCCAGG + Intergenic
1037497570 8:19454593-19454615 CACCACAGCCTCCATCTCCCAGG - Intronic
1038086256 8:24199831-24199853 GACCCACGGATCCTTCTCCAAGG + Intergenic
1038228644 8:25680300-25680322 AACCCAAAGCTCCTACTCCCAGG - Intergenic
1040900321 8:52411143-52411165 GTCTCCCGGCTCCTGCTCCCAGG - Intronic
1043053379 8:75408026-75408048 GAACCGAGGCTCCTCCTGCCCGG - Intronic
1043950748 8:86306889-86306911 CACCGCAAGCTCCGTCTCCCGGG + Intronic
1044273991 8:90279018-90279040 GACCCCATTCTCCTTATGCCTGG + Intergenic
1044671040 8:94681248-94681270 CACTGCAAGCTCCTTCTCCCGGG - Intronic
1046161119 8:110366469-110366491 GACTGCAGCCTCCATCTCCCAGG + Intergenic
1046316636 8:112511463-112511485 GACTGCAAGCTCCGTCTCCCGGG + Intronic
1046566461 8:115907204-115907226 GACCTCAAGCTCCACCTCCCAGG - Intergenic
1046969042 8:120200549-120200571 ATTCCCAGGCCCCTTCTCCCTGG - Intronic
1047207692 8:122816943-122816965 GGACCCAGGCTCCTTCCCTCTGG + Intronic
1047651999 8:126932809-126932831 GACTGCAAGCTCCGTCTCCCAGG - Intergenic
1047835115 8:128681144-128681166 GACTGCAGGCTCCGCCTCCCGGG + Intergenic
1048979507 8:139695616-139695638 GACTCCAGGCTCCTTCAGGCTGG + Intronic
1048985547 8:139732866-139732888 GAATCCATGCTCCTTCGCCCAGG - Intronic
1049285829 8:141774734-141774756 GAACCCAGCCTCCCTCTCCAAGG - Intergenic
1049324676 8:142015799-142015821 GGCCTCAGGCGGCTTCTCCCAGG - Intergenic
1049561762 8:143315692-143315714 GCCCTCAGACGCCTTCTCCCGGG - Intronic
1049678458 8:143904099-143904121 GTCAACAGGCTCCTCCTCCCTGG - Intergenic
1049831373 8:144703511-144703533 CACCGCAAGCTCCTTCTCCTGGG + Intergenic
1049870543 8:144971865-144971887 GACTACAGCCTCCATCTCCCAGG + Intergenic
1050600657 9:7246831-7246853 GGCCCCTGGCTCCTTGCCCCAGG - Intergenic
1050917036 9:11149228-11149250 CACTACAAGCTCCTTCTCCCCGG - Intergenic
1051504443 9:17812154-17812176 CACCCCTGGCTCCAGCTCCCGGG - Intergenic
1053278695 9:36802379-36802401 AGCCCCAGGCTGGTTCTCCCCGG - Intergenic
1053338895 9:37304579-37304601 TACCGCAAGCTCCATCTCCCGGG - Intronic
1053818723 9:41942533-41942555 GACTGCAAGCTCCGTCTCCCGGG - Intronic
1054450911 9:65403245-65403267 GACCACAGGCCCCTCCTCTCCGG - Intergenic
1054787567 9:69223381-69223403 CACTGCAGGCTCCATCTCCCGGG + Intronic
1055955916 9:81773436-81773458 CACCCCATCCTCCTCCTCCCGGG + Intergenic
1056714655 9:89018981-89019003 CACCGCAGCCTCCATCTCCCAGG - Intronic
1057032856 9:91790432-91790454 CACTGCAGTCTCCTTCTCCCAGG - Intronic
1057039174 9:91835017-91835039 GGCCTCAGGCTCCTCATCCCTGG - Intronic
1057464350 9:95298628-95298650 GAACTCATGCTACTTCTCCCTGG - Intronic
1058455344 9:105133242-105133264 CACCCCAGCCTCCGCCTCCCAGG + Intergenic
1059512777 9:114864831-114864853 GACCCCAAGCCCTTACTCCCAGG - Intergenic
1060051604 9:120382388-120382410 TACCCAAGCCTCCTCCTCCCTGG - Intergenic
1060113336 9:120922044-120922066 GACATCAGGCTCCTGATCCCTGG + Intronic
1060707589 9:125818909-125818931 GACTGCAGCCTCCGTCTCCCAGG + Intronic
1061191761 9:129086352-129086374 GACCCCAGCCCCTGTCTCCCTGG + Intronic
1061367212 9:130178312-130178334 GAGCCCAGCCTCCTCCTCACAGG + Intronic
1061419008 9:130463316-130463338 GACCCCGGCCTCCTCCTCCTCGG + Intronic
1061625635 9:131839182-131839204 GACTCCTGGCTCCCTCACCCAGG - Intergenic
1062000795 9:134214734-134214756 GGCCCCAGCCTCCTTATCACAGG + Intergenic
1062756239 9:138294088-138294110 CACCGCAAGCTCCGTCTCCCGGG - Intergenic
1203524019 Un_GL000213v1:68983-69005 GACCCCTGCCCCCTGCTCCCCGG + Intergenic
1203487590 Un_GL000224v1:71859-71881 CACCGCAACCTCCTTCTCCCGGG + Intergenic
1203500211 Un_KI270741v1:13754-13776 CACCGCAACCTCCTTCTCCCGGG + Intergenic
1185578043 X:1189467-1189489 CACCGCAAGCTCCGTCTCCCGGG - Intronic
1185889379 X:3810771-3810793 GAGACCAGGGTCCTTCTCCTTGG + Intergenic
1186468673 X:9804358-9804380 CTCCCCAGGCTCCTTGTCTCTGG + Intronic
1187285603 X:17900311-17900333 GGCCCCAGGCTCCTTGTACTTGG - Intergenic
1193082656 X:77421346-77421368 GACCCCGGGCTTCCTCTCTCAGG + Intergenic
1193952444 X:87817187-87817209 CACCCCATCCTCCTCCTCCCAGG + Intergenic
1194656592 X:96581172-96581194 GACTGCAAGCTCCGTCTCCCGGG + Intergenic
1194710616 X:97232308-97232330 CACTGCAGCCTCCTTCTCCCGGG + Intronic
1196292662 X:113961172-113961194 GACTGCAGGCTCCACCTCCCGGG - Intergenic
1196457070 X:115898399-115898421 GAGCCCAGGCTCCTTGGCCAAGG + Intergenic
1199244766 X:145590628-145590650 CACTGCAAGCTCCTTCTCCCGGG + Intergenic
1200214887 X:154363635-154363657 CACTGCAGGCTCTTTCTCCCAGG - Intronic
1200488169 Y:3791150-3791172 GAGACTAGGCTCCTTTTCCCCGG - Intergenic
1200929938 Y:8688039-8688061 GACTGCAAGCTCCATCTCCCAGG + Intergenic
1201271457 Y:12259567-12259589 GACTGCAAGCTCCATCTCCCAGG + Intergenic
1201295052 Y:12455312-12455334 CACTGCAAGCTCCTTCTCCCAGG + Intergenic
1201338772 Y:12908756-12908778 CACCCCAAGCTCCCCCTCCCAGG + Intronic
1202382746 Y:24290945-24290967 CACCGCAAGCTCCGTCTCCCGGG - Intergenic
1202488038 Y:25379179-25379201 CACCGCAAGCTCCGTCTCCCGGG + Intergenic