ID: 1169079972

View in Genome Browser
Species Human (GRCh38)
Location 20:2792032-2792054
Sequence CAGTGTCAACAAAGGCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169079972_1169079975 -7 Left 1169079972 20:2792032-2792054 CCCTCTTGCCTTTGTTGACACTG No data
Right 1169079975 20:2792048-2792070 GACACTGACTGTAACGTTTCTGG No data
1169079972_1169079976 -1 Left 1169079972 20:2792032-2792054 CCCTCTTGCCTTTGTTGACACTG No data
Right 1169079976 20:2792054-2792076 GACTGTAACGTTTCTGGTTATGG No data
1169079972_1169079978 30 Left 1169079972 20:2792032-2792054 CCCTCTTGCCTTTGTTGACACTG No data
Right 1169079978 20:2792085-2792107 AGTCCAGTTTCCAGCCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169079972 Original CRISPR CAGTGTCAACAAAGGCAAGA GGG (reversed) Intergenic
No off target data available for this crispr