ID: 1169083023

View in Genome Browser
Species Human (GRCh38)
Location 20:2809049-2809071
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169083023_1169083033 18 Left 1169083023 20:2809049-2809071 CCTATGTTGGGGAAAACAGCCCC No data
Right 1169083033 20:2809090-2809112 CCCGAGTCCGGCGGAGACAAAGG No data
1169083023_1169083024 -9 Left 1169083023 20:2809049-2809071 CCTATGTTGGGGAAAACAGCCCC No data
Right 1169083024 20:2809063-2809085 AACAGCCCCATAACGCCTAGCGG No data
1169083023_1169083029 6 Left 1169083023 20:2809049-2809071 CCTATGTTGGGGAAAACAGCCCC No data
Right 1169083029 20:2809078-2809100 CCTAGCGGTTACCCCGAGTCCGG No data
1169083023_1169083030 9 Left 1169083023 20:2809049-2809071 CCTATGTTGGGGAAAACAGCCCC No data
Right 1169083030 20:2809081-2809103 AGCGGTTACCCCGAGTCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169083023 Original CRISPR GGGGCTGTTTTCCCCAACAT AGG (reversed) Intergenic