ID: 1169083024 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:2809063-2809085 |
Sequence | AACAGCCCCATAACGCCTAG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1169083020_1169083024 | 3 | Left | 1169083020 | 20:2809037-2809059 | CCTGCTCTGTTGCCTATGTTGGG | No data | ||
Right | 1169083024 | 20:2809063-2809085 | AACAGCCCCATAACGCCTAGCGG | No data | ||||
1169083023_1169083024 | -9 | Left | 1169083023 | 20:2809049-2809071 | CCTATGTTGGGGAAAACAGCCCC | No data | ||
Right | 1169083024 | 20:2809063-2809085 | AACAGCCCCATAACGCCTAGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1169083024 | Original CRISPR | AACAGCCCCATAACGCCTAG CGG | Intergenic | ||