ID: 1169083025

View in Genome Browser
Species Human (GRCh38)
Location 20:2809068-2809090
Sequence GGTAACCGCTAGGCGTTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169083025_1169083030 -10 Left 1169083025 20:2809068-2809090 CCCCATAACGCCTAGCGGTTACC No data
Right 1169083030 20:2809081-2809103 AGCGGTTACCCCGAGTCCGGCGG No data
1169083025_1169083033 -1 Left 1169083025 20:2809068-2809090 CCCCATAACGCCTAGCGGTTACC No data
Right 1169083033 20:2809090-2809112 CCCGAGTCCGGCGGAGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169083025 Original CRISPR GGTAACCGCTAGGCGTTATG GGG (reversed) Intergenic