ID: 1169083025 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:2809068-2809090 |
| Sequence | GGTAACCGCTAGGCGTTATG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 7 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 0, 4: 6} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1169083025_1169083030 | -10 | Left | 1169083025 | 20:2809068-2809090 | CCCCATAACGCCTAGCGGTTACC | 0: 1 1: 0 2: 0 3: 0 4: 6 |
||
| Right | 1169083030 | 20:2809081-2809103 | AGCGGTTACCCCGAGTCCGGCGG | No data | ||||
| 1169083025_1169083033 | -1 | Left | 1169083025 | 20:2809068-2809090 | CCCCATAACGCCTAGCGGTTACC | 0: 1 1: 0 2: 0 3: 0 4: 6 |
||
| Right | 1169083033 | 20:2809090-2809112 | CCCGAGTCCGGCGGAGACAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1169083025 | Original CRISPR | GGTAACCGCTAGGCGTTATG GGG (reversed) | Intergenic | ||