ID: 1169083026

View in Genome Browser
Species Human (GRCh38)
Location 20:2809069-2809091
Sequence GGGTAACCGCTAGGCGTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169083026_1169083033 -2 Left 1169083026 20:2809069-2809091 CCCATAACGCCTAGCGGTTACCC No data
Right 1169083033 20:2809090-2809112 CCCGAGTCCGGCGGAGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169083026 Original CRISPR GGGTAACCGCTAGGCGTTAT GGG (reversed) Intergenic