ID: 1169083026 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:2809069-2809091 |
Sequence | GGGTAACCGCTAGGCGTTAT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1169083026_1169083033 | -2 | Left | 1169083026 | 20:2809069-2809091 | CCCATAACGCCTAGCGGTTACCC | No data | ||
Right | 1169083033 | 20:2809090-2809112 | CCCGAGTCCGGCGGAGACAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1169083026 | Original CRISPR | GGGTAACCGCTAGGCGTTAT GGG (reversed) | Intergenic | ||