ID: 1169083027 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:2809070-2809092 |
| Sequence | GGGGTAACCGCTAGGCGTTA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1169083027_1169083033 | -3 | Left | 1169083027 | 20:2809070-2809092 | CCATAACGCCTAGCGGTTACCCC | No data | ||
| Right | 1169083033 | 20:2809090-2809112 | CCCGAGTCCGGCGGAGACAAAGG | No data | ||||
| 1169083027_1169083036 | 30 | Left | 1169083027 | 20:2809070-2809092 | CCATAACGCCTAGCGGTTACCCC | No data | ||
| Right | 1169083036 | 20:2809123-2809145 | AGACAGAATAAGCGTTTAAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1169083027 | Original CRISPR | GGGGTAACCGCTAGGCGTTA TGG (reversed) | Intergenic | ||