ID: 1169083027

View in Genome Browser
Species Human (GRCh38)
Location 20:2809070-2809092
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169083027_1169083033 -3 Left 1169083027 20:2809070-2809092 CCATAACGCCTAGCGGTTACCCC No data
Right 1169083033 20:2809090-2809112 CCCGAGTCCGGCGGAGACAAAGG No data
1169083027_1169083036 30 Left 1169083027 20:2809070-2809092 CCATAACGCCTAGCGGTTACCCC No data
Right 1169083036 20:2809123-2809145 AGACAGAATAAGCGTTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169083027 Original CRISPR GGGGTAACCGCTAGGCGTTA TGG (reversed) Intergenic