ID: 1169083029

View in Genome Browser
Species Human (GRCh38)
Location 20:2809078-2809100
Sequence CCTAGCGGTTACCCCGAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169083020_1169083029 18 Left 1169083020 20:2809037-2809059 CCTGCTCTGTTGCCTATGTTGGG No data
Right 1169083029 20:2809078-2809100 CCTAGCGGTTACCCCGAGTCCGG No data
1169083023_1169083029 6 Left 1169083023 20:2809049-2809071 CCTATGTTGGGGAAAACAGCCCC No data
Right 1169083029 20:2809078-2809100 CCTAGCGGTTACCCCGAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169083029 Original CRISPR CCTAGCGGTTACCCCGAGTC CGG Intergenic
No off target data available for this crispr