ID: 1169083033

View in Genome Browser
Species Human (GRCh38)
Location 20:2809090-2809112
Sequence CCCGAGTCCGGCGGAGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169083020_1169083033 30 Left 1169083020 20:2809037-2809059 CCTGCTCTGTTGCCTATGTTGGG No data
Right 1169083033 20:2809090-2809112 CCCGAGTCCGGCGGAGACAAAGG No data
1169083027_1169083033 -3 Left 1169083027 20:2809070-2809092 CCATAACGCCTAGCGGTTACCCC No data
Right 1169083033 20:2809090-2809112 CCCGAGTCCGGCGGAGACAAAGG No data
1169083023_1169083033 18 Left 1169083023 20:2809049-2809071 CCTATGTTGGGGAAAACAGCCCC No data
Right 1169083033 20:2809090-2809112 CCCGAGTCCGGCGGAGACAAAGG No data
1169083026_1169083033 -2 Left 1169083026 20:2809069-2809091 CCCATAACGCCTAGCGGTTACCC No data
Right 1169083033 20:2809090-2809112 CCCGAGTCCGGCGGAGACAAAGG No data
1169083025_1169083033 -1 Left 1169083025 20:2809068-2809090 CCCCATAACGCCTAGCGGTTACC 0: 1
1: 0
2: 0
3: 0
4: 6
Right 1169083033 20:2809090-2809112 CCCGAGTCCGGCGGAGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169083033 Original CRISPR CCCGAGTCCGGCGGAGACAA AGG Intergenic