ID: 1169085009

View in Genome Browser
Species Human (GRCh38)
Location 20:2821059-2821081
Sequence CAGACGCGCCGGGAGGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169084995_1169085009 20 Left 1169084995 20:2821016-2821038 CCAAGGCCCGGGGGCAGGGACAA No data
Right 1169085009 20:2821059-2821081 CAGACGCGCCGGGAGGGAGGGGG No data
1169085000_1169085009 -5 Left 1169085000 20:2821041-2821063 CCATCGAAGCCGTGGTCACAGAC No data
Right 1169085009 20:2821059-2821081 CAGACGCGCCGGGAGGGAGGGGG No data
1169084998_1169085009 13 Left 1169084998 20:2821023-2821045 CCGGGGGCAGGGACAAGGCCATC No data
Right 1169085009 20:2821059-2821081 CAGACGCGCCGGGAGGGAGGGGG No data
1169084997_1169085009 14 Left 1169084997 20:2821022-2821044 CCCGGGGGCAGGGACAAGGCCAT No data
Right 1169085009 20:2821059-2821081 CAGACGCGCCGGGAGGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169085009 Original CRISPR CAGACGCGCCGGGAGGGAGG GGG Intergenic