ID: 1169088488

View in Genome Browser
Species Human (GRCh38)
Location 20:2841625-2841647
Sequence GATTCTATTGGGGGAGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 129}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169088488_1169088498 6 Left 1169088488 20:2841625-2841647 CCTGATTCTCCCCCAATAGAATC 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1169088498 20:2841654-2841676 GCCTCACTGGGCCCAGTGCTAGG 0: 1
1: 0
2: 5
3: 33
4: 295
1169088488_1169088495 -7 Left 1169088488 20:2841625-2841647 CCTGATTCTCCCCCAATAGAATC 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1169088495 20:2841641-2841663 TAGAATCCTGTGGGCCTCACTGG 0: 1
1: 0
2: 0
3: 8
4: 115
1169088488_1169088504 21 Left 1169088488 20:2841625-2841647 CCTGATTCTCCCCCAATAGAATC 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1169088504 20:2841669-2841691 GTGCTAGGGTCTTTTAGGTATGG 0: 1
1: 0
2: 0
3: 6
4: 155
1169088488_1169088496 -6 Left 1169088488 20:2841625-2841647 CCTGATTCTCCCCCAATAGAATC 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1169088496 20:2841642-2841664 AGAATCCTGTGGGCCTCACTGGG 0: 1
1: 0
2: 0
3: 16
4: 172
1169088488_1169088501 16 Left 1169088488 20:2841625-2841647 CCTGATTCTCCCCCAATAGAATC 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1169088501 20:2841664-2841686 GCCCAGTGCTAGGGTCTTTTAGG 0: 1
1: 0
2: 2
3: 19
4: 120
1169088488_1169088500 7 Left 1169088488 20:2841625-2841647 CCTGATTCTCCCCCAATAGAATC 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1169088500 20:2841655-2841677 CCTCACTGGGCCCAGTGCTAGGG 0: 1
1: 0
2: 1
3: 19
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169088488 Original CRISPR GATTCTATTGGGGGAGAATC AGG (reversed) Intronic
900856381 1:5188393-5188415 GAGTCTTTTGGGAGAGATTCTGG - Intergenic
903365990 1:22805668-22805690 GATTCTTTTGGGTGGGAATGGGG + Intronic
905901560 1:41584817-41584839 GATGCTATTCAGGGAGAGTCAGG + Exonic
908184536 1:61640072-61640094 TATTCTATTAGGGGAGAAAGAGG + Intergenic
909653258 1:77999525-77999547 GACTCCTTTGGGGGTGAATCTGG + Intronic
910842409 1:91573025-91573047 GGGTCTATTGGGAGAGGATCAGG - Intergenic
912829847 1:112943098-112943120 GATTTTATTTAGGGAGAATGAGG + Intronic
914965300 1:152252247-152252269 GATTCTATGGGTTAAGAATCTGG + Intergenic
918157165 1:181859608-181859630 AATTCTTTTGGAGGAGAATTTGG + Intergenic
920115792 1:203620361-203620383 GGTTCTAATGGGGAAGAAACTGG - Intergenic
922208823 1:223471573-223471595 AATTCTCTTGTGGGGGAATCTGG - Intergenic
922829022 1:228541521-228541543 CATTCTAATGGGAGAGACTCCGG - Intergenic
922829201 1:228542702-228542724 AATTCTAATGGGAGAAAATCTGG - Intergenic
922830536 1:228551207-228551229 CATTCTAATGGGAGAGACTCCGG - Intergenic
1063478235 10:6347379-6347401 GCTTCTGTTGGGGAAGAATTTGG + Intergenic
1063731426 10:8701240-8701262 GATTCTATTGAGTGGGATTCAGG + Intergenic
1070308681 10:75257049-75257071 AATTCTTTTGGGGGAGCATGGGG - Intergenic
1076071442 10:127493194-127493216 GATTCAAATATGGGAGAATCAGG - Intergenic
1078829501 11:14966049-14966071 CATTCTAGTGGGGGAGATTGAGG - Intronic
1086849742 11:91795329-91795351 GATTCTCTTAGGAGAGAATCTGG + Intergenic
1089357121 11:117861323-117861345 GAGTCTGTTGGGGGAGAAGTCGG + Intronic
1089382695 11:118047476-118047498 GATTCTGTTGAGGAAGAGTCAGG - Intergenic
1093768491 12:22993048-22993070 TATTTAATTGGGGGAAAATCTGG - Intergenic
1095378905 12:41565537-41565559 TATTTTATTCGGGGAGAATGTGG + Intronic
1095814020 12:46401540-46401562 CATTATATTTGGGGAGAAGCAGG + Intergenic
1097012776 12:55965262-55965284 GATTCTGCTGGGGGAGGATCTGG + Intronic
1097207374 12:57334189-57334211 GATTTGATTGGGGGAGGATATGG - Intronic
1098197941 12:68022054-68022076 GATTCTATTTGGTGAGCATATGG + Intergenic
1098905241 12:76155135-76155157 GTTTATAATGGGGGAGAATCTGG + Intergenic
1102551270 12:113693849-113693871 GATTGTATTGGGAGGGAATGGGG + Intergenic
1104566620 12:129890715-129890737 GAGTCTAGTGGGGGAAAATGAGG - Intronic
1107496414 13:40929845-40929867 TATTCTAATGGGGGAAAAACAGG + Intergenic
1111762339 13:92481755-92481777 AATTCTATTGGGAGAGAAGAAGG + Intronic
1115127119 14:30009081-30009103 CATTTTATTTGGGGAGAGTCTGG + Intronic
1120543614 14:85782174-85782196 GATTCTATTGGAGATGAAGCTGG - Intergenic
1124719659 15:32100237-32100259 GATTCTATTGCGGGAGCTTGAGG + Intronic
1127515706 15:59690981-59691003 GATTCCATTGGGGTACGATCAGG + Intergenic
1128079365 15:64847108-64847130 CATTCTAGTGGTGGGGAATCTGG - Intronic
1128683961 15:69670272-69670294 GATTCTAGAGGAGGAGAATGTGG - Intergenic
1131876126 15:96807997-96808019 GAATATACTGGAGGAGAATCGGG + Intergenic
1133774451 16:8886184-8886206 GATTCTTGTGGGTGAGGATCTGG + Intergenic
1141283659 16:82651501-82651523 GATTTTATTGGGAGAGTATATGG + Intronic
1142327111 16:89422784-89422806 GATTCTCTTAGGGGAGAAAAGGG - Intronic
1142807755 17:2380359-2380381 GACTCTGTCGGGGAAGAATCCGG + Exonic
1145778564 17:27546468-27546490 GTGTCTATTGGGGGAGACTGAGG + Intronic
1149078397 17:52624574-52624596 TATTGTAATGGGGGAGGATCAGG + Intergenic
1155038241 18:22043267-22043289 GACTGGATTGGGGAAGAATCTGG + Intergenic
1159068142 18:63592276-63592298 CATCCTCTTAGGGGAGAATCTGG + Intronic
1163398659 19:17078610-17078632 GATATTATGGGGGGAGAATTAGG + Intronic
1164384089 19:27758803-27758825 CATTCTAATGGGAGAGAGTCTGG - Intergenic
1164385900 19:27770532-27770554 CATTCTAATGGGAGAGACTCTGG - Intergenic
1165173385 19:33908992-33909014 GATTCAAATAGGGGAGAATTAGG + Intergenic
1165483970 19:36084204-36084226 GATTTCATTTGGGGAGAATCAGG + Intronic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
926109550 2:10173325-10173347 GATGCCATTGGGGGAGAAAGGGG - Intronic
926594815 2:14778598-14778620 GATTTTGTTGGGGGAGAGTGTGG + Intergenic
929176902 2:38987486-38987508 GATTCTGCTGGGGCAGATTCTGG + Exonic
929278668 2:40053890-40053912 GATAATATTTGGGGAGAATCAGG + Intergenic
932336384 2:70933603-70933625 GCTTCTATTGAGTGGGAATCAGG - Intergenic
934122805 2:88856393-88856415 CATTCTATTGTTGGACAATCGGG + Intergenic
934676424 2:96252887-96252909 CATTCTACTGGGAGAGACTCGGG + Exonic
937022926 2:118674989-118675011 GATTCTGCTGGGGGAGTTTCTGG - Intergenic
939276669 2:140006734-140006756 AATTCTTTTGAGGGAGAATTTGG - Intergenic
939923102 2:148141346-148141368 GAGTTTATTGGGGGTTAATCAGG - Intronic
940801553 2:158138257-158138279 GATTCTACTGGGGAAGAAGGAGG - Intergenic
941000858 2:160202522-160202544 GATTACATTGAGGAAGAATCAGG + Intronic
946758767 2:222972669-222972691 GATTCTAATGGGGGAAAAGCCGG + Intergenic
947946325 2:234106062-234106084 CATTCTCTTGGGGGAGAAGCTGG - Intergenic
948297558 2:236873728-236873750 GATTCTCTTGGGCTAGAATTGGG + Intergenic
1169088488 20:2841625-2841647 GATTCTATTGGGGGAGAATCAGG - Intronic
1170424157 20:16221928-16221950 AACTCTATTTGGGGTGAATCAGG - Intergenic
1171094317 20:22316789-22316811 GATTCTCTTGAGGGAAACTCAGG - Intergenic
1172744011 20:37192762-37192784 GATTTTATAGGGGTAGAATAGGG + Intronic
1174545589 20:51322713-51322735 AATGCTATGGGGGGAGAAACAGG - Intergenic
1178356491 21:31913776-31913798 GAGGCTACTGGGGGAGAAGCAGG + Intronic
1180236132 21:46459811-46459833 GATCCCATTGGGGGAGCAGCTGG - Intronic
1185292394 22:50033653-50033675 GGTTCTGTTGGGGGAGAGCCTGG - Intronic
952533215 3:34283629-34283651 GATGCTATTGAGAAAGAATCTGG - Intergenic
953517834 3:43613601-43613623 AAATCTATTGGGCGAGAATATGG + Intronic
957512448 3:81206904-81206926 GCTTCTTTTGGGGGTGAAACTGG - Intergenic
961904082 3:130244419-130244441 GATTCTATTAAGGGAGAAGATGG + Intergenic
962131524 3:132683088-132683110 GATTATGATGGGTGAGAATCAGG - Intronic
966830948 3:184008134-184008156 GCTTCTATTGGTGGACAAGCAGG + Intronic
967069729 3:185952372-185952394 GTTTCTATTGGGGCAGGATAGGG - Intergenic
967146588 3:186611845-186611867 GATTTTCTGGGGTGAGAATCGGG - Intergenic
970052127 4:11926253-11926275 CCTTCTCTTGAGGGAGAATCTGG + Intergenic
971128754 4:23782525-23782547 TATTTTATTCCGGGAGAATCTGG - Intronic
971483871 4:27139976-27139998 TAGTCTTTTGGGGCAGAATCTGG + Intergenic
977590886 4:98825420-98825442 GATTCTCTTGGTAGAAAATCTGG + Intergenic
983568080 4:169175581-169175603 GAGGCTATTGTGGGATAATCAGG - Intronic
984921177 4:184765848-184765870 CATCCTAGTGTGGGAGAATCAGG + Intronic
990691146 5:58365474-58365496 ATTTCTATTTGGAGAGAATCTGG - Intergenic
994835087 5:104841251-104841273 GATGCTCTTGAGGGAGAAACTGG - Intergenic
1003967061 6:11262898-11262920 AATTGTATTGGGTGAGAATTTGG - Intronic
1004962308 6:20803710-20803732 GGCTCTAGTTGGGGAGAATCAGG + Intronic
1006497627 6:34435201-34435223 GCTTCTATGGGGGGAGAGTGCGG - Intergenic
1007244131 6:40447885-40447907 GATTCTAATGGAGGAGAACAGGG - Intronic
1007583051 6:42970791-42970813 AGATCTATTGGGGCAGAATCAGG - Intronic
1009964232 6:70561860-70561882 GAATTTATTGGAGGAGGATCAGG + Intergenic
1009971005 6:70625718-70625740 GCTTCTGTTGAGTGAGAATCTGG - Intergenic
1011704938 6:89991345-89991367 GATTCAGCTGGGGGTGAATCTGG + Intronic
1012139123 6:95599530-95599552 TATTCTAATGGAGGACAATCTGG + Intronic
1016420810 6:143881047-143881069 GATTCTATGGGGTTAGAATGAGG - Intronic
1016708112 6:147137636-147137658 GAATGAATTGGGGGAGAATGAGG - Intergenic
1017213110 6:151879036-151879058 GATTGTCTTGTGGGAGAATATGG + Intronic
1018832790 6:167457820-167457842 GATGATTTTGAGGGAGAATCTGG + Intergenic
1020629231 7:10620577-10620599 GAATTTGTTGGAGGAGAATCTGG - Intergenic
1021850902 7:24807564-24807586 GATTCTCTAGAGTGAGAATCAGG - Intronic
1022581445 7:31559207-31559229 GATTCTATTGGAGTAGTAGCAGG - Intronic
1023202197 7:37710920-37710942 GGTTCTTTTGGGTGAGAATAGGG + Intronic
1024795658 7:53016666-53016688 CATGCTATTGGGAGAGAATTAGG + Intergenic
1026332539 7:69365095-69365117 GAATATATTGGGGGAGAGACAGG - Intergenic
1027384265 7:77644832-77644854 AATTCTAGTGCAGGAGAATCTGG - Intergenic
1028180637 7:87718321-87718343 GTTTCTATTAGGGGATAGTCAGG + Intronic
1029227183 7:99036726-99036748 GATGCTCTTGTGGGAGAACCTGG + Intronic
1031754729 7:125624477-125624499 GATTCTATTGAGAGAGAAAAAGG - Intergenic
1033712020 7:143957272-143957294 AATTCGATTGGAGGAAAATCAGG + Intergenic
1036612913 8:10365571-10365593 GGCTATTTTGGGGGAGAATCAGG - Intronic
1038885461 8:31658237-31658259 GAGTCTAGTGGGGAAAAATCTGG + Intronic
1040567347 8:48579579-48579601 TACTCCATTGGGGGAGAATTTGG + Intergenic
1040755295 8:50766062-50766084 GATTCTATTGAAGGAGAGACTGG + Intronic
1040790303 8:51221040-51221062 GAGGCTTTTGGAGGAGAATCTGG - Intergenic
1041627745 8:60049960-60049982 GATTCTGTTCGGGGAAAATGTGG - Intergenic
1044270834 8:90241325-90241347 GGTTCTATTGGGTTAGAGTCAGG + Intergenic
1047173518 8:122517949-122517971 AATTCAATTGGTTGAGAATCAGG + Intergenic
1047664361 8:127074512-127074534 GATGCTGTTTGGGGATAATCAGG + Intergenic
1053108376 9:35434331-35434353 AATTCTTTTGGGGGGCAATCTGG - Intergenic
1059114060 9:111584962-111584984 GATTTTATTGGCTGAGATTCAGG - Intronic
1060013854 9:120069027-120069049 GTTTGTTTTGGGAGAGAATCTGG + Intergenic
1062695536 9:137874030-137874052 GATTCATTTGGGGGAGGATGAGG - Intergenic
1186962164 X:14748324-14748346 GGTTCAATTGGTGGAGAATATGG - Intergenic
1191245892 X:58228067-58228089 CATTCTAATGGGAGAGAATCCGG + Intergenic
1191772853 X:64781633-64781655 GAAGCTATAGGGAGAGAATCAGG - Intergenic
1193855912 X:86601251-86601273 GTTTCTATTGGGGCAGATACTGG + Intronic
1196108143 X:111918028-111918050 GATTAGATTGGGGGAGGACCCGG + Intronic
1197155683 X:123267432-123267454 GATTCTACTGGCTGAGACTCAGG - Intronic
1199551108 X:149062299-149062321 GCTTCTATTGGTGAAAAATCAGG - Intergenic
1200326671 X:155247742-155247764 GATTCTATTGGGGGAGGGGGTGG - Intergenic