ID: 1169096857

View in Genome Browser
Species Human (GRCh38)
Location 20:2908449-2908471
Sequence TGCACACTCAAGTCCCACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 5, 2: 5, 3: 19, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169096857_1169096859 -4 Left 1169096857 20:2908449-2908471 CCACTGTGGGACTTGAGTGTGCA 0: 1
1: 5
2: 5
3: 19
4: 178
Right 1169096859 20:2908468-2908490 TGCATAGATTTTGGTATCCACGG 0: 1
1: 9
2: 63
3: 209
4: 612
1169096857_1169096862 17 Left 1169096857 20:2908449-2908471 CCACTGTGGGACTTGAGTGTGCA 0: 1
1: 5
2: 5
3: 19
4: 178
Right 1169096862 20:2908489-2908511 GGTTGATCCACAGATACCAAGGG 0: 1
1: 0
2: 0
3: 9
4: 74
1169096857_1169096861 16 Left 1169096857 20:2908449-2908471 CCACTGTGGGACTTGAGTGTGCA 0: 1
1: 5
2: 5
3: 19
4: 178
Right 1169096861 20:2908488-2908510 CGGTTGATCCACAGATACCAAGG 0: 1
1: 0
2: 1
3: 4
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169096857 Original CRISPR TGCACACTCAAGTCCCACAG TGG (reversed) Intronic
900177611 1:1297767-1297789 TGCACACACACGTGCCACCGGGG - Intronic
900400260 1:2470145-2470167 AGACCACTCAAGTCCCTCAGAGG - Intronic
900486606 1:2925561-2925583 TGCACCCTGGAATCCCACAGGGG + Intergenic
903967063 1:27097483-27097505 TCCACACTCAGGTCCCAGACTGG + Intergenic
904009435 1:27381394-27381416 TGCACCCTCCAGGCCCAGAGAGG - Intronic
905933573 1:41806687-41806709 TGCCCACTGGAGTGCCACAGAGG - Intronic
907096589 1:51787008-51787030 GGGACACTCAAGCCCTACAGAGG + Intronic
909027150 1:70495117-70495139 TGCATACTCAAGCCCCACAGTGG + Intergenic
910634406 1:89391037-89391059 TGCATGCTCAAGTCCAGCAGTGG - Intergenic
911617561 1:100031549-100031571 GGCACACTCAAGTCCTTAAGGGG + Intergenic
912860404 1:113209122-113209144 TTCAGCCTCTAGTCCCACAGTGG + Intergenic
918239728 1:182610991-182611013 TTCACACTAAAGGCCTACAGAGG - Intergenic
919212900 1:194510909-194510931 TGTACACTGCAGACCCACAGTGG + Intergenic
920671172 1:208004638-208004660 TGCGCCCTCAGGGCCCACAGCGG - Intergenic
920671180 1:208004665-208004687 TGCACCCTCAGGGCCCACAGCGG - Intergenic
921358448 1:214308070-214308092 TGCTCACTCAATTCCCAGACAGG + Intronic
922133243 1:222799575-222799597 TCCAGAGTCATGTCCCACAGTGG + Intergenic
922789905 1:228305827-228305849 TAGACCCTCAAGTGCCACAGGGG - Intronic
1064169590 10:13018481-13018503 AGCACACTGAAGACACACAGTGG - Intronic
1065778469 10:29144295-29144317 TGCAGGCTCCAGTCCCACACAGG - Intergenic
1067153380 10:43754055-43754077 GGCACACTCGAGTTGCACAGTGG - Intergenic
1068051930 10:51961231-51961253 TGCATGCTCAAGTCCCACAGTGG + Intronic
1068227831 10:54129730-54129752 CACATACTGAAGTCCCACAGTGG + Intronic
1069249059 10:66245562-66245584 AGCTCACAGAAGTCCCACAGAGG + Intronic
1073067784 10:100773963-100773985 TGCACCCTGAAGTCCCACCGTGG - Intronic
1073997506 10:109332719-109332741 TTAACACTCCAGTACCACAGTGG - Intergenic
1075799417 10:125143813-125143835 TGCTAACTCAAGTCCAAAAGCGG + Intronic
1076102574 10:127794714-127794736 TGCACACTCAAATCCCTTACAGG - Intergenic
1076859180 10:133132431-133132453 TGTGCACACAACTCCCACAGAGG - Intergenic
1077200087 11:1302381-1302403 TGCACACTCACGGCCAAGAGGGG + Intronic
1079334423 11:19558835-19558857 CACACATTCAAGTCCCACACAGG + Intronic
1082633306 11:55566222-55566244 TGCACAATCAGGGCCCACTGAGG + Intergenic
1083330449 11:61895865-61895887 GGCACACAGAAGTGCCACAGAGG - Intergenic
1085504758 11:77051636-77051658 TGCATGCTCCATTCCCACAGAGG - Intergenic
1087928587 11:103949390-103949412 AGGACACTGAATTCCCACAGCGG + Intronic
1089616046 11:119695359-119695381 TCAACACTCAGGTCCCACACTGG + Intronic
1090398985 11:126436315-126436337 CTCAGACACAAGTCCCACAGAGG - Intronic
1091074435 11:132601880-132601902 TGCACACTACAGTTACACAGGGG + Intronic
1095057859 12:37637875-37637897 TGCACATTCAACTCACACTGTGG - Intergenic
1095315837 12:40759801-40759823 TTCACTCCCCAGTCCCACAGTGG - Intronic
1097009692 12:55943592-55943614 TGCACACTCAAATACCTGAGTGG - Intronic
1102721968 12:115024165-115024187 TGTTCTCTCAAGTCCCAGAGTGG - Intergenic
1106503313 13:30349798-30349820 TTCCCCCTCAATTCCCACAGAGG + Intergenic
1106587378 13:31069034-31069056 TGCACACACAAGTCACCCACAGG - Intergenic
1108480487 13:50865364-50865386 AGCATACTCAAGTCCTGCAGGGG + Intergenic
1108979451 13:56492126-56492148 TGCACCCTGAAGAGCCACAGGGG - Intergenic
1109640100 13:65180376-65180398 AGCACACTCAGGTCCCACTCTGG - Intergenic
1119646336 14:76351116-76351138 TTCTCACTCCAGCCCCACAGTGG - Intronic
1120998644 14:90435760-90435782 TTGACACTCAAGGCCCGCAGTGG - Intergenic
1121093094 14:91196552-91196574 TGCACACCCAAGCCCTTCAGAGG + Intronic
1121985460 14:98501235-98501257 TGTACTCTTAAGTCACACAGAGG + Intergenic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1122798464 14:104218061-104218083 TGCTCACCCCAGCCCCACAGAGG - Intergenic
1124100349 15:26687074-26687096 TGCACCCTCACTTCCCAGAGTGG - Intronic
1125471372 15:40007560-40007582 TGTACATTCAAATACCACAGGGG + Intronic
1127841819 15:62838384-62838406 AGCACACTCCAGGCACACAGAGG + Intronic
1128308958 15:66618594-66618616 TGCACACTGAAGGGCCATAGAGG - Intronic
1129653657 15:77508626-77508648 TCCACACTGAAGTCCCTAAGAGG + Intergenic
1132227085 15:100151006-100151028 TTAACACTCAAGCCACACAGTGG + Intronic
1133049716 16:3110551-3110573 TGCAAACTCAAATGCTACAGGGG + Intergenic
1133264611 16:4575696-4575718 AGGACACCTAAGTCCCACAGAGG - Exonic
1134665715 16:16017080-16017102 CTCACACTCAAATCCCTCAGGGG - Intronic
1136000493 16:27288811-27288833 TGCACACCCAATGCTCACAGAGG + Exonic
1136059886 16:27719149-27719171 TGCAGACTCAATGCCTACAGGGG + Intronic
1136273072 16:29159786-29159808 TGCCTACTCAACTCTCACAGCGG - Intergenic
1137887844 16:52126050-52126072 TGCACACTTAACTCCCACAGTGG - Intergenic
1138124019 16:54424029-54424051 TGCACACCAAATCCCCACAGTGG - Intergenic
1139195142 16:64909901-64909923 TTTACCCTCAAGTCCCACTGAGG + Intergenic
1140405852 16:74710948-74710970 TGCACTCTCAAGTCCCTGTGAGG + Intergenic
1140979589 16:80094033-80094055 TGCACATTCATGTTCCACAGAGG - Intergenic
1142076621 16:88121588-88121610 TGCCTACTCAACTCTCACAGTGG - Intergenic
1142283662 16:89161999-89162021 TGCACACCCATGTGTCACAGAGG + Intergenic
1143892775 17:10115299-10115321 TGCACCCGCCAGTCCCACGGGGG - Intronic
1144735002 17:17550405-17550427 TTGACACCCAAGTGCCACAGGGG - Intronic
1145061686 17:19738061-19738083 TGCACACCCCACTCCCACATGGG - Exonic
1148241239 17:46000631-46000653 TGCACACTAGAGTCACCCAGGGG - Intronic
1149983631 17:61330969-61330991 TGCACACTCACCGCCCAGAGAGG - Intronic
1150139348 17:62715391-62715413 TACACACTCAAATACCACAGAGG - Intronic
1151724565 17:75876729-75876751 TGCACAGTCCAGGCGCACAGTGG - Exonic
1152545352 17:80997646-80997668 TGCTGACTCACGTCCCACATAGG + Intronic
1153524115 18:5978885-5978907 TGCTCTCTCAACTCCCACAACGG + Intronic
1154340439 18:13498269-13498291 TCCACACACACGTCCCACTGTGG + Intronic
1160483340 18:79263283-79263305 TGTGTACCCAAGTCCCACAGTGG + Intronic
1161684661 19:5696819-5696841 TGCACCCTCCAGGGCCACAGGGG + Intronic
1161744123 19:6044629-6044651 TGCAGACTACAGACCCACAGAGG - Intronic
1165783732 19:38448568-38448590 TGCACTCTGCAGTCCCTCAGGGG + Intronic
1166497585 19:43315498-43315520 TTCCCACTCAAGACCCACAGTGG - Intergenic
1168235747 19:55062237-55062259 ACCACACCCATGTCCCACAGAGG + Intronic
924988510 2:291095-291117 GGCACATTCACGTCTCACAGTGG + Intergenic
928123781 2:28602437-28602459 CGCAGACTCAACCCCCACAGGGG - Intronic
929496508 2:42449051-42449073 AACATACTCAAGTCCCTCAGTGG - Intronic
930289139 2:49471480-49471502 TGCATACTCAGGTCCTACAGTGG - Intergenic
930291662 2:49501455-49501477 TGCACACACAATTTCAACAGGGG - Intergenic
932672702 2:73752183-73752205 TGTCCATTCAAGTCCCACAGTGG - Intergenic
934685101 2:96315422-96315444 TGCTCTCTCAAGTCCCACAGGGG - Intergenic
935662959 2:105485685-105485707 TGCACACTCATGCCTGACAGTGG - Intergenic
936948406 2:117952157-117952179 TGCACATTCTAGTCCCTTAGTGG - Intronic
938182163 2:129193001-129193023 TGCAGACTCCAGCCCCACAAAGG + Intergenic
939350364 2:141029365-141029387 GGGACACTCAAGGCCCACAGGGG - Intronic
939574764 2:143882880-143882902 TGCATACTCAAGTCCTGCTGTGG + Intergenic
939817615 2:146915598-146915620 TGCACCCTCAGGTCCCATAGTGG + Intergenic
940854070 2:158716210-158716232 TCCTCTCTCAAGTCACACAGTGG - Intergenic
941978105 2:171427499-171427521 TGCACACTAAAGAGCCACACTGG + Intronic
946511727 2:220365367-220365389 TGCACAGACAATTCCCAGAGAGG + Intergenic
947450272 2:230201636-230201658 TGCATCCTGAAGTACCACAGTGG + Intronic
948034482 2:234847137-234847159 AGCATAGTCAAATCCCACAGGGG + Intergenic
948161435 2:235827992-235828014 TGCACCGTCAGGACCCACAGTGG - Intronic
948654386 2:239467412-239467434 TGCACACACATGTGCCACATAGG - Intergenic
1169096857 20:2908449-2908471 TGCACACTCAAGTCCCACAGTGG - Intronic
1170392393 20:15889793-15889815 TGCACAGTTGAGTCCCTCAGGGG + Intronic
1170967366 20:21085955-21085977 TTAACCCTCAAGACCCACAGGGG + Intergenic
1173027538 20:39323004-39323026 TGCACACTCAATTGTCTCAGAGG + Intergenic
1175489428 20:59369522-59369544 TGCATCTTCAGGTCCCACAGAGG + Intergenic
1176080723 20:63272120-63272142 TGCAGACTCAGGTCCCACCAGGG + Intronic
1178822003 21:35983863-35983885 TTGCCCCTCAAGTCCCACAGGGG - Intronic
1182268167 22:29135546-29135568 TGCACACTCATGCCACTCAGGGG + Intronic
1184453540 22:44596818-44596840 TGCCCACTGCAGGCCCACAGCGG + Intergenic
951836069 3:26984695-26984717 TTAAGACTCATGTCCCACAGTGG + Intergenic
951956554 3:28261777-28261799 TGCATTCTCAAGTCCCACCATGG + Intronic
952584478 3:34874250-34874272 TTCACACTGAAAGCCCACAGAGG - Intergenic
954304094 3:49716499-49716521 GACACACCCAACTCCCACAGGGG - Intronic
955373671 3:58375587-58375609 TGCAAACTCCATTCACACAGTGG - Intronic
955918350 3:63928963-63928985 TGCACACTCAAGCCTCGCAAAGG - Intronic
960481096 3:118191022-118191044 TGGATTCTCAATTCCCACAGTGG + Intergenic
961368554 3:126416060-126416082 TGAGCACTCCAGACCCACAGAGG - Intronic
961448797 3:126993179-126993201 TCCTCACCCCAGTCCCACAGAGG + Intronic
961931295 3:130536337-130536359 TGTTCATTCAAGTACCACAGTGG + Intergenic
962413687 3:135163399-135163421 TGCAAACTCCAGTCCTACAGGGG - Intronic
965430774 3:168585479-168585501 TGTACACTCAAGTAACACAATGG - Intergenic
970619113 4:17798754-17798776 TGCAAACTTAAGTCTCACTGCGG + Intergenic
971146357 4:23980807-23980829 TCCAAACTGAAGTCCCACATGGG + Intergenic
973626244 4:52775424-52775446 TGCATACTCAGGTCCAGCAGTGG - Intergenic
973693446 4:53466103-53466125 TGCAAACCCAAGCTCCACAGAGG + Intronic
973792390 4:54390683-54390705 TGCCCATTGAAGTCCCTCAGTGG + Intergenic
973816680 4:54625907-54625929 TGAACACTCAAGTACAACAGGGG - Intergenic
975797405 4:78022628-78022650 TGGACACTCAAGTGGCAAAGTGG - Intergenic
976393342 4:84528773-84528795 AGCACACTCAAGTCGCAAAATGG + Intergenic
978781328 4:112558067-112558089 TGGACACTCAGGGCCCATAGTGG + Intronic
983592480 4:169429135-169429157 CATATACTCAAGTCCCACAGTGG - Intronic
983747756 4:171222961-171222983 GGCACACCCAAGTCCCTTAGTGG + Intergenic
985685914 5:1281398-1281420 TGCACACTCGAGTCCCTGGGGGG - Intronic
987228478 5:15868224-15868246 TGCAAAGCCAAGTCCTACAGTGG + Intronic
989788593 5:45363406-45363428 TGGAGACTCAAGTCCCTCATTGG - Intronic
991551846 5:67845628-67845650 TGCACACTCAAGAACCAAAATGG - Intergenic
999374888 5:151080131-151080153 TGCACACAAATGTCCTACAGTGG + Intronic
999916172 5:156264230-156264252 TGAACCTTCAAGTCCCAAAGAGG + Intronic
1000838284 5:166183227-166183249 TGCATACTAACGTCCCACAGTGG - Intergenic
1000859167 5:166435720-166435742 TTAACCCCCAAGTCCCACAGGGG + Intergenic
1002639076 5:180622080-180622102 TGAGGACTCAAGTCCCACTGAGG - Intronic
1002915887 6:1527372-1527394 TGCAGACTCAAGTCCCAAGGTGG + Intergenic
1003721443 6:8707552-8707574 TGCACATGCAAGGCCCGCAGTGG + Intergenic
1003917556 6:10801445-10801467 TGCACACTCCAGTCCCAGCAAGG + Intronic
1004146927 6:13076622-13076644 GCCACACTCAAGTCTCTCAGAGG - Intronic
1005695471 6:28348009-28348031 TGCACAGGCAATTCCCAGAGAGG - Intronic
1006012799 6:31056565-31056587 TGCAGACCCAAGGACCACAGAGG + Intergenic
1006817371 6:36861454-36861476 TGCTCGCTCAAGTCCCGCTGTGG + Intronic
1007795734 6:44345550-44345572 TGAACTCTCAAGTCCTATAGTGG + Intronic
1009065247 6:58452723-58452745 TGTGCACTCAAGTCACAGAGTGG + Intergenic
1010884421 6:81218455-81218477 TGCACTCTGCAGTGCCACAGGGG + Intergenic
1011839018 6:91473190-91473212 TGCACACTCAAGTACTGCAGTGG + Intergenic
1012465212 6:99509893-99509915 TGCATACTCAAGTCCCGCAGTGG + Intronic
1012619777 6:101328615-101328637 TGCACATTCTAGTCCCACCCTGG - Intergenic
1014054265 6:116995477-116995499 TTGCCTCTCAAGTCCCACAGGGG + Intergenic
1015304708 6:131694988-131695010 TGCACTCTCAGGCCCAACAGGGG - Intronic
1016873389 6:148840563-148840585 AGCAAACTTAAGTCCCACAGTGG + Intronic
1017414296 6:154203594-154203616 TGCATACTCAAGTCCCACAGTGG - Intronic
1019712329 7:2523430-2523452 TGTACACACAGGTCCCGCAGAGG - Intronic
1021836940 7:24686327-24686349 TTTTCACTCAAGGCCCACAGAGG + Intronic
1023991207 7:45129951-45129973 TGACGTCTCAAGTCCCACAGAGG + Intergenic
1024083931 7:45878159-45878181 TGAACCCTGCAGTCCCACAGGGG - Intergenic
1026603566 7:71796909-71796931 TGCACACCCAGGTCTCACTGAGG - Intronic
1026775507 7:73228692-73228714 TGCACACTCAGGTCCCACAGTGG + Intergenic
1027016363 7:74782066-74782088 TGCACACTCAGGTCCCACAGTGG + Intronic
1027071665 7:75163875-75163897 TGCACACTCAGGTCCCACAGTGG - Intergenic
1030235831 7:107261050-107261072 CGCATATTCAAGTCCCACGGTGG + Intronic
1031074963 7:117202930-117202952 CACATACTCAAGTCCCCCAGTGG + Intronic
1034301097 7:150016081-150016103 AGCACACTCATCCCCCACAGTGG + Intergenic
1034804958 7:154081225-154081247 AGCACACTCATCCCCCACAGAGG - Intronic
1035375861 7:158406355-158406377 TGCACACTGAGATCCCGCAGTGG + Intronic
1035375876 7:158406485-158406507 TGCACACTGAGATCCCGCAGTGG + Intronic
1035584984 8:765753-765775 TGTACACACATGTGCCACAGTGG - Intergenic
1036480661 8:9136496-9136518 TGCACTCTCAAAGCCCTCAGAGG + Exonic
1038426568 8:27467868-27467890 TGCACTCTCAAGTGCCCCACAGG + Intronic
1038739245 8:30202393-30202415 TGCACGCACAAGACCCACCGTGG + Intergenic
1040741910 8:50586073-50586095 TGCACACTCAGGTGCCAAATGGG - Intronic
1041299663 8:56397830-56397852 TGCACTTTCAACTCCCAAAGTGG + Intergenic
1041766942 8:61428738-61428760 TGCATACTTAAATCCCACAGTGG + Intronic
1043876581 8:85492809-85492831 TTCTCCCACAAGTCCCACAGAGG - Intergenic
1045666630 8:104494223-104494245 TGCACACAAAATTCCAACAGTGG + Intronic
1049104176 8:140601107-140601129 TCCACTCTCAAGTTCCCCAGTGG + Intronic
1056600322 9:88042061-88042083 TTCCCACCCAAGACCCACAGTGG - Intergenic
1057730191 9:97601882-97601904 TGCATACTCAAGTCCCACAGTGG - Exonic
1060917871 9:127402068-127402090 TCAACACTCAAGTGCCAGAGTGG + Intronic
1061235592 9:129341146-129341168 TGGGCTCTCCAGTCCCACAGGGG + Intergenic
1062553250 9:137100092-137100114 TCCACACTCAACTCCTGCAGAGG - Intronic
1185966893 X:4615577-4615599 TGCAAACTCAGCTCCCAAAGGGG + Intergenic
1187680942 X:21767442-21767464 TGCGATCTCAAGTCCCACAGAGG + Intergenic
1187846009 X:23538602-23538624 TGCATACTCAAGTCCTGCAGTGG + Intergenic
1188938554 X:36208390-36208412 CTCATACTCAAGTCCCACAATGG + Intergenic
1190936777 X:55004906-55004928 TGCACAATAAAGTCACACTGGGG - Intronic
1192171728 X:68859865-68859887 GGCACCCTCCAGTCCCAAAGGGG - Intergenic
1193256525 X:79355304-79355326 TGCACCCTGAAGAGCCACAGGGG + Intergenic
1193401484 X:81049471-81049493 TGGACACTCAAGTCCTATAATGG + Intergenic
1193716098 X:84936033-84936055 TGCTCCCTCAAGTCCCAAGGAGG + Intergenic
1194519709 X:94902936-94902958 TCCATACTCAAGTCTCATAGTGG + Intergenic
1195377552 X:104242749-104242771 TGCACACTTCAGGCCCACAGGGG + Intergenic
1197731716 X:129816291-129816313 TGCATTCTCAAGTCCTGCAGTGG - Intronic
1197777604 X:130129544-130129566 TGAAGACTGAAGCCCCACAGTGG - Exonic