ID: 1169102606

View in Genome Browser
Species Human (GRCh38)
Location 20:2964285-2964307
Sequence GAGCAGAACAAGAATGAACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169102606_1169102609 21 Left 1169102606 20:2964285-2964307 CCTGGTTCATTCTTGTTCTGCTC 0: 1
1: 0
2: 1
3: 21
4: 234
Right 1169102609 20:2964329-2964351 AGTGCCAACAATGCTACCACAGG 0: 1
1: 0
2: 1
3: 9
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169102606 Original CRISPR GAGCAGAACAAGAATGAACC AGG (reversed) Exonic
900238827 1:1605253-1605275 GAGCAGAAACAGACAGAACCGGG - Intergenic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900773833 1:4566699-4566721 AAGCCCAACAAGAATGAACTTGG - Intergenic
902089343 1:13891075-13891097 GAGCAGCACAAGAATTTCCCTGG - Intergenic
902529501 1:17081520-17081542 GGGCAGAACAGGTGTGAACCTGG + Intronic
902632786 1:17715568-17715590 GATCAGGACAAGAATGAACGTGG - Intergenic
902967297 1:20015641-20015663 GAACAGACCAATAATGAACAAGG - Intergenic
904574305 1:31493246-31493268 GATCAGAAGAAAAATAAACCAGG - Intergenic
904587051 1:31586449-31586471 GAGCAGAAGAGGAGGGAACCTGG - Intronic
906895767 1:49769516-49769538 AAGCAGAAAAAGAAAGAGCCAGG + Intronic
908670876 1:66546191-66546213 GAGCAGAGGAAGCATGATCCAGG - Intronic
909771368 1:79426228-79426250 GAGCAAATAAAGAATGAACTAGG + Intergenic
910080419 1:83334910-83334932 TAGCAGAACTAGAATGGGCCAGG + Intergenic
910269221 1:85375303-85375325 GAGCAAACCCAGAATGCACCTGG + Intronic
911251994 1:95586941-95586963 GAGGAGAAGAATAAGGAACCTGG + Intergenic
911812629 1:102303002-102303024 GAGCAAAACCAGCATGAACCAGG + Intergenic
918162161 1:181911438-181911460 GGGCAGCGCAAGAATGTACCAGG + Intergenic
919338608 1:196272745-196272767 GAGAACAACATGGATGAACCTGG - Intronic
920369432 1:205468743-205468765 GAAAAGAAAAAGAAAGAACCAGG + Intergenic
920780974 1:208990920-208990942 GAGCAACACAAGAAAGAGCCTGG + Intergenic
921762551 1:218932822-218932844 GAGCAGAATAAAAATGTACTGGG + Intergenic
921816865 1:219574217-219574239 GCGCAGAACAGAAATGAAACAGG + Intergenic
922236420 1:223726035-223726057 GGGCCCAACAAGAATGAACGTGG - Intronic
922722778 1:227906992-227907014 GAGCAGCACAAGACATAACCAGG + Intergenic
924908766 1:248486144-248486166 GTACAGAAGAAGAATGAACAGGG + Intergenic
924915341 1:248561918-248561940 GTACAGAAGAAGAATGAACAGGG - Intergenic
924954674 1:248914838-248914860 GAGCAGAGCCAGAGAGAACCAGG - Intronic
1063862749 10:10329519-10329541 GGTCAGAAAAAGAATGAACCTGG - Intergenic
1064294452 10:14065830-14065852 GAACAAACCAAGAATAAACCAGG + Intronic
1065423790 10:25577600-25577622 GAGCAAAAATAGAATGAGCCCGG - Intronic
1066007595 10:31160227-31160249 GAGAAAAAAAAGAATGAAGCTGG - Intergenic
1066338858 10:34509220-34509242 GAGCAGAACATGCATCTACCTGG + Intronic
1066693587 10:38057948-38057970 GAGCAGAACCAGAATCAAGCTGG + Exonic
1069520161 10:69112675-69112697 GTGCAGAACGAGAAGGAAACAGG - Intergenic
1069725422 10:70574481-70574503 GTGCAGAGGCAGAATGAACCTGG + Intergenic
1073055462 10:100697844-100697866 GAGCAGAACAAGGAGGAAAGAGG + Intergenic
1074856113 10:117474794-117474816 GACAAGAAAAAGAATGAAACTGG - Intergenic
1075403430 10:122177635-122177657 GAGCAGCAGGAGAATGAAGCTGG + Intronic
1075551807 10:123398229-123398251 GAGCAGAACCAGGATCAACAGGG - Intergenic
1075708179 10:124515241-124515263 GAGGAAAAGATGAATGAACCTGG - Intronic
1077954877 11:7006218-7006240 AAATGGAACAAGAATGAACCTGG - Intronic
1080506600 11:32920319-32920341 GAGTAGCAAAAGAATGAAACTGG + Intronic
1081842375 11:46211959-46211981 CAGCAGCACAAGCATGAGCCAGG + Intergenic
1081938336 11:46919541-46919563 GAACAAAACAAGATTCAACCTGG - Intergenic
1082760729 11:57124561-57124583 GAGAAGAACAGGAAAGAAACAGG + Intergenic
1085008954 11:73122471-73122493 GAGCAGATCAAGAAAGAAGATGG - Intronic
1085305284 11:75482262-75482284 GAACAGGACAAAAATGCACCAGG - Intronic
1085554042 11:77403280-77403302 GTTCAGAAGAAGATTGAACCTGG - Intronic
1085803184 11:79610848-79610870 GAGAGGAACAAGAATGAGCATGG + Intergenic
1090861383 11:130655762-130655784 GATCAGAACAGGAAAGAGCCTGG - Intergenic
1093410933 12:18865754-18865776 GAACAGAACAAGAAAGAAGGAGG - Intergenic
1093780357 12:23128436-23128458 GAGCAGCAAATGAAAGAACCAGG + Intergenic
1096126412 12:49123066-49123088 GAGTAGAACAATAAAGAATCTGG + Intergenic
1100641787 12:96489477-96489499 GGGCAGAGCGAGAAAGAACCAGG - Intergenic
1101971174 12:109313659-109313681 GAACAGAACAGTGATGAACCTGG - Intergenic
1102796152 12:115690532-115690554 TAGAAGAACAAGAAGGCACCTGG + Intergenic
1104831506 12:131755361-131755383 GAGCAGAAAAAGAAAGAAAATGG - Intronic
1108691807 13:52865843-52865865 GAGCAAAAGAAAAATGAACAAGG - Intergenic
1111423913 13:88054205-88054227 AACCAGAAGAAGAATGAAACTGG - Intergenic
1112172895 13:96992808-96992830 GAGCAGAACCAGAAAAACCCAGG - Intronic
1112935706 13:104795368-104795390 TAGCAGAAAGAGAATGAACGTGG + Intergenic
1112946087 13:104928803-104928825 GAGCAGAAAAAGAAAGTTCCAGG + Intergenic
1115171849 14:30517265-30517287 AAGCAGAAAAAGAATGCAACAGG + Intergenic
1116849917 14:49898212-49898234 AGGCAGAACAAGAATGGAGCGGG + Intergenic
1117213473 14:53526087-53526109 CTGCAGAACCAGCATGAACCAGG + Intergenic
1117893281 14:60450201-60450223 GAGTAGAACAAGCATGATCTTGG + Intronic
1118566538 14:67147114-67147136 TAGCAGAACAAGAATGATGTAGG - Intronic
1118689883 14:68328152-68328174 GATCAGAACATTACTGAACCAGG + Intronic
1119433085 14:74581065-74581087 GAGCAGAAGCAGGATGAACACGG + Intronic
1123451585 15:20367238-20367260 GAGAAAAACAAGAATGATACTGG - Intergenic
1124371100 15:29105225-29105247 TAGAAGAACAAGAAAGAAACTGG - Intronic
1124615617 15:31239730-31239752 GAGCAGAACCTGCATGACCCAGG + Intergenic
1125632391 15:41157896-41157918 AAGCAAAACAAAAAAGAACCTGG + Intergenic
1129648181 15:77457688-77457710 GAGCAGAAATAGCATGCACCTGG - Intronic
1130740141 15:86590399-86590421 GAGAAGAACAAGAGTGAAGTGGG - Intronic
1135074941 16:19384979-19385001 CAGGAGCAGAAGAATGAACCAGG + Intergenic
1135706239 16:24677463-24677485 GAGCAAAAGAAAAATGAACATGG - Intergenic
1137610346 16:49813505-49813527 GGGCAGATCAAGCATGAGCCTGG - Intronic
1138011700 16:53386739-53386761 GAGCTGAAGAAGAATCAACCTGG - Intergenic
1139686588 16:68608762-68608784 CTGCAGAATAAGAATGGACCAGG + Intergenic
1142467803 17:146104-146126 GAGCTGAGCAAGAATCACCCTGG - Intergenic
1143930282 17:10415482-10415504 GAGAAGAAGAAGGATGAATCTGG - Exonic
1146713351 17:35062102-35062124 GAGCATAAAAAGAATGAACAAGG + Intronic
1147240660 17:39088397-39088419 GAGCAGAACTAGAACGAACTTGG - Intronic
1147468849 17:40637891-40637913 GAGCAGAATAAGAGGGTACCAGG - Intronic
1148063634 17:44853232-44853254 GAGCAGAACAAGAGTCACCTCGG - Intronic
1148103865 17:45108950-45108972 GAGCAGAACAACAATGCATTTGG - Exonic
1148516865 17:48227253-48227275 GCACAGAACAAGAATAAACAGGG - Intronic
1148519694 17:48260922-48260944 GAACAGAAGAAGAATGTTCCAGG - Intronic
1149200085 17:54175380-54175402 GAACAGAACAAGAATGGAAGTGG + Intergenic
1150127964 17:62650803-62650825 CAGCACCACAAGCATGAACCAGG - Intronic
1150131657 17:62672441-62672463 GAGGAGACCAAGAATGCGCCAGG - Intronic
1152065162 17:78108360-78108382 GACCAGAAAAAGAAGGAAGCTGG + Exonic
1152120454 17:78415144-78415166 GAGCAGAGCAAGAAAGACTCTGG + Intronic
1153616673 18:6941277-6941299 GAGCAGAACTAAAATGAATGTGG + Intergenic
1154072672 18:11167172-11167194 CAGTAAAACAACAATGAACCTGG + Intergenic
1154956831 18:21266769-21266791 AAGCAGAACATTAATGACCCTGG + Intronic
1155012890 18:21799274-21799296 GACAAAAACAACAATGAACCAGG - Intronic
1155370026 18:25089126-25089148 GAACAGAACATGAATAAAACAGG + Intronic
1156691265 18:39709605-39709627 GAGAAGATCAAGAGTGAACTGGG - Intergenic
1158246886 18:55442382-55442404 GATCAGAAAAAGAATGAAAAGGG + Intronic
1158832701 18:61297580-61297602 GAGGAGAAGATGAATGAACTTGG + Intergenic
1162231120 19:9267900-9267922 GAGCTGAACAATAATGAAGAAGG - Intergenic
1164541610 19:29125753-29125775 GAGCAGGGCAGGGATGAACCAGG - Intergenic
1164594858 19:29526160-29526182 GAGCAGAACCAGAAGGAGACAGG + Intergenic
1164741298 19:30577577-30577599 CAGAAGAACTAGAATGACCCAGG - Intronic
1166091853 19:40514436-40514458 GAGCGGAACAAGATTAGACCAGG + Intronic
1166546492 19:43637170-43637192 GCTCAGAAGATGAATGAACCAGG + Intronic
1166778634 19:45327973-45327995 TAGCAGAACAAGACTGGACTAGG + Intergenic
1166832066 19:45645010-45645032 GGGCAGAACCCGAAGGAACCTGG - Intronic
1166869241 19:45861276-45861298 AAGCAGAAGAAGAATGAAACAGG - Intronic
1166974931 19:46600527-46600549 GAGCGGATCAAGAATGAAGCGGG + Intronic
1167055474 19:47108789-47108811 GAGCAGAGCAAAATTGTACCTGG + Intronic
1168611260 19:57802482-57802504 GCGCTGAACAAGAATGGAGCAGG - Intronic
925841351 2:7995106-7995128 GTGCAGAACATGATTGAGCCAGG + Intergenic
926485398 2:13449070-13449092 GAGAAAAACAAGAATGATACTGG + Intergenic
927197228 2:20556800-20556822 AGGCAGAACAAGAAGGAGCCAGG - Intergenic
927498309 2:23565087-23565109 GCTCAGAACAAGACAGAACCTGG + Intronic
927627038 2:24732740-24732762 GAGCAAAAAGAGAAAGAACCTGG - Intronic
928032790 2:27795986-27796008 GAGAAGAACATGATAGAACCAGG - Intronic
933581357 2:84130387-84130409 GAGCAAACCCTGAATGAACCTGG + Intergenic
934902374 2:98170901-98170923 GACCAGAACAATATTAAACCTGG + Intronic
935019201 2:99214095-99214117 TACCAGAAGAAGAATGAACTGGG - Intronic
936021468 2:108998234-108998256 CAGGAGACCAAGAATAAACCAGG - Intergenic
936652841 2:114449367-114449389 TAGCAGAACAAGATTTAAGCTGG + Intronic
939368698 2:141268869-141268891 GAACAGATCAAGAATGTACTGGG + Intronic
941999398 2:171631043-171631065 GTGCAGGACAAGAGTGAAGCAGG + Intergenic
943569643 2:189558447-189558469 AAGGAGAACAAGAAAGAACTGGG - Intergenic
945450528 2:209989682-209989704 GTGCAATACTAGAATGAACCAGG - Intronic
946454140 2:219808898-219808920 GAACAGAACAATAATGAGCAAGG - Intergenic
947467496 2:230365324-230365346 GAGCAGACCAATAATGAATAAGG - Intronic
1168809249 20:693272-693294 GCGAACAACAAGAATGAACTTGG - Intergenic
1169102606 20:2964285-2964307 GAGCAGAACAAGAATGAACCAGG - Exonic
1170742992 20:19074084-19074106 TAGCAGCATAAGAATGCACCAGG + Intergenic
1172223312 20:33288259-33288281 GAGCAGAGGAAGAAGGAGCCAGG - Intronic
1173765312 20:45602316-45602338 TGACACAACAAGAATGAACCTGG - Intergenic
1174278586 20:49421715-49421737 GTGCAGAGCAGAAATGAACCAGG + Intronic
1174283280 20:49454598-49454620 GTGGAGAAAAAGAATGAAGCAGG + Intronic
1175388252 20:58610834-58610856 GAGCAACACAAAAATGAAACAGG - Intergenic
1178385693 21:32148033-32148055 GAGCAGAATGAGAATGATACAGG + Intergenic
1178808225 21:35857300-35857322 GAGCAGCCCAAGAATGATGCAGG + Intronic
1179083553 21:38196043-38196065 GAGCAGGCAAAGAATGAATCTGG - Intronic
1180641318 22:17301727-17301749 TGGCAGAACAGGAATGAGCCAGG - Intergenic
1184713924 22:46269486-46269508 AGGCAGAACCAGGATGAACCTGG + Intronic
949381208 3:3447633-3447655 GAGCAGATCATGAATGATCATGG - Intergenic
950306262 3:11917245-11917267 GAGCAGAAGAAGAATGCAATCGG + Intergenic
950335077 3:12187119-12187141 CAGCAGGACAAGGAGGAACCAGG - Intronic
951098006 3:18654170-18654192 TTGCAGCACATGAATGAACCTGG - Intergenic
951152399 3:19306920-19306942 GAGCAAAAAAAGAAGAAACCTGG + Intronic
951832488 3:26946001-26946023 GAGCAGAACAGAAATGAAGGAGG + Intergenic
952853453 3:37748447-37748469 GATCAGAAAAAGAAGGAAGCTGG + Intronic
953116890 3:40001752-40001774 CAGCAAAACTAGAATGGACCAGG + Intronic
954325980 3:49864291-49864313 GAGCAAAACAAGCCTGATCCTGG + Intronic
955267918 3:57465162-57465184 GAGCAGAACAAGACTGCAACTGG + Intronic
957917889 3:86709256-86709278 AAGCTGAACCAGAATGTACCTGG - Intergenic
958664415 3:97116635-97116657 CTGCACAACATGAATGAACCTGG - Intronic
958813305 3:98888256-98888278 GAGCTTAAAAAGAATGAAGCTGG - Intronic
959368710 3:105495390-105495412 GAGCACTAGAAGAATGAACAGGG + Intronic
959563162 3:107805677-107805699 GAGCAGAAACAGAATGATCCTGG + Exonic
959852280 3:111102493-111102515 GCACAGAACAAGATTTAACCTGG - Intronic
960132069 3:114067992-114068014 GAGCAGTACAAGAGTGATTCTGG - Exonic
962730867 3:138282263-138282285 GAGCAGAACTAGAAGGAATGTGG + Intronic
964449140 3:156793406-156793428 GGGCAGAACAAGAATGAAAATGG + Intergenic
964698355 3:159535466-159535488 GAGCAGAACCAGGAGGAAGCAGG - Intronic
967576565 3:191101822-191101844 GACCAGAACAAAAATGTACAGGG + Intergenic
967713504 3:192736937-192736959 GAAAAGAGCAAGAATGAAGCAGG - Intronic
969208347 4:5665729-5665751 GAGCAGACCAAGCAGGGACCAGG + Intronic
971193360 4:24448410-24448432 AACAAGAACAAGAATGAATCAGG - Intergenic
975124382 4:70765617-70765639 GAGTAGAACTGGAATGAACAAGG - Intronic
976072963 4:81262722-81262744 GAGCTGGACAGGAATGGACCTGG - Intergenic
976739187 4:88341267-88341289 GAGGAGAACACAAATGAAGCAGG - Intergenic
977285303 4:95098649-95098671 AAGCAGCAGCAGAATGAACCTGG - Intronic
977857668 4:101913537-101913559 GAGCAAAACAAGGTTGAAGCAGG - Intronic
979789449 4:124760226-124760248 GAGTAGAAGAAGCATGACCCTGG - Intergenic
980229205 4:130026346-130026368 GAGCAGAGCAAGAAAGCACCTGG - Intergenic
981227529 4:142314177-142314199 GAGAAGAACAAGAAGGTACTGGG - Intronic
982636775 4:157906837-157906859 CAGCAAGAGAAGAATGAACCAGG + Intergenic
984762084 4:183371110-183371132 GATCACAAAAAGAAAGAACCCGG + Intergenic
987340559 5:16935947-16935969 GAGAAGGACAAGAAGGGACCGGG - Exonic
987849261 5:23328069-23328091 GACAAGAAAAAGAATGAAACTGG - Intergenic
988962551 5:36384481-36384503 GAGGAGACCAAGACTGAAGCAGG + Intergenic
990371306 5:55121410-55121432 TAGCAGAACAAAAATTAATCAGG - Intronic
991592591 5:68269063-68269085 GACCAGAACACCAATGAACTAGG - Intronic
992689030 5:79225465-79225487 GAACAGAGCAAGGATGATCCAGG - Intronic
993047975 5:82890005-82890027 GACCAGAAGAAGAATGAACTGGG + Intergenic
993776501 5:92005368-92005390 AAGCAGAACAAAAATGAGCCAGG + Intergenic
997702227 5:135910872-135910894 AGGCAGGAGAAGAATGAACCAGG + Intergenic
998737404 5:145158377-145158399 GAGCAGAATGAGAAGAAACCTGG - Intergenic
1000251008 5:159495548-159495570 GAAAAGAAAAAGAATGAAACTGG + Intergenic
1000518686 5:162273106-162273128 GAGCAGAAACAGAATTAACCTGG + Intergenic
1003221319 6:4163446-4163468 CAGCAGGAAAAGAATGAACTTGG - Intergenic
1003733159 6:8848966-8848988 CAGCAGAACTTGAATGCACCTGG - Intergenic
1007717863 6:43867654-43867676 GAGGAAAACAAGAAAGCACCAGG - Intergenic
1008062476 6:47013204-47013226 GAGAAGAACAAGAAGGAAAATGG - Intronic
1008584797 6:52938734-52938756 GAGAAGAAGAAGAATGAATGGGG + Intergenic
1008901741 6:56627014-56627036 GAGAAGAAGACGAATGAACTGGG + Intronic
1009306155 6:62091747-62091769 GAGCAGATCGAGGATGGACCAGG - Intronic
1009767126 6:68093381-68093403 GATCAGAAAAAGAAAGAAACTGG - Intergenic
1010326594 6:74570642-74570664 GAGGAGGACAGGAATGAAGCAGG + Intergenic
1010545451 6:77149798-77149820 CAGGAGAACATGAATGAAACTGG + Intergenic
1011019580 6:82797278-82797300 GAATTGAACAAGAATGAACTTGG - Intergenic
1011140868 6:84154782-84154804 GAACAGACCAAGTATGAAACAGG - Intronic
1011485571 6:87837636-87837658 GATTAAAACAAGAATGAAGCTGG + Intergenic
1011986573 6:93454754-93454776 GGGCAGAAAGAGAATGAACTTGG + Intergenic
1013035365 6:106377233-106377255 GAGCAACACAAGAATGAAGAAGG - Intergenic
1013568677 6:111396846-111396868 CAGCATACCAAGATTGAACCAGG - Intronic
1013588176 6:111597780-111597802 GGTCAGAACAAGCAAGAACCAGG - Intronic
1017450102 6:154547347-154547369 GGGTAGAAAAAGAATGAACTGGG + Intergenic
1017635743 6:156441534-156441556 GAGAAGAAGAGGAATGAAGCAGG + Intergenic
1019162498 6:170078301-170078323 GATCAGAACAAAAATAAAACAGG - Intergenic
1020146382 7:5647159-5647181 CACCAGAGCAAGAATTAACCTGG - Intronic
1022789005 7:33668080-33668102 GAGCAGAAAAAAAATGAACTTGG + Intergenic
1023097155 7:36672976-36672998 AAGCAGAAGAAGGATGAACACGG + Intronic
1024585623 7:50839403-50839425 GAGAAGAACAAGGATGAAGCAGG + Intergenic
1026419356 7:70217487-70217509 AAGCACAACTAGAATGAACTAGG - Intronic
1027298196 7:76800175-76800197 TAGCAGAACTAGAATGGGCCAGG + Intergenic
1029044309 7:97611964-97611986 GAGAAGAAAAAGAAAGCACCTGG - Intergenic
1029168000 7:98609149-98609171 GAGCAAAAGAAGAAAGAATCTGG + Intergenic
1030893841 7:115031888-115031910 GAGGAGATGAAGAATGAACTTGG + Intergenic
1034620396 7:152452222-152452244 GAGAAGATCAAGAATGGACTTGG + Intergenic
1035568266 8:656196-656218 AAACAGAAAAAGAAGGAACCGGG - Intronic
1037266854 8:17072842-17072864 AAGGAGAACAAGAAGGAACCAGG + Intronic
1037812174 8:22093453-22093475 GAGCAGAACCAGAATTTTCCAGG + Intronic
1038732754 8:30141898-30141920 GAGAAGCACAAGAATGGTCCAGG - Intronic
1039805491 8:40994224-40994246 AAGAAGAAGAAGAAGGAACCGGG - Intergenic
1042561937 8:70078553-70078575 GAGCAGATCATCTATGAACCTGG + Intergenic
1042798754 8:72693752-72693774 AAGCAGAAAGAGAAAGAACCAGG + Intronic
1044891339 8:96839299-96839321 GAGAATAACAATAATGAACCTGG - Intronic
1045295010 8:100864845-100864867 AGGCAGAACAAGTTTGAACCAGG + Intergenic
1045319191 8:101068898-101068920 GAGGAGAATTAGAATGCACCTGG - Intergenic
1046616455 8:116482862-116482884 GTCCACAACATGAATGAACCTGG + Intergenic
1046616872 8:116487488-116487510 TAGATGAACAAGAATGAATCAGG + Intergenic
1047975405 8:130125117-130125139 GAGCAGAACCTGAATGAACCTGG - Intronic
1048635411 8:136290240-136290262 GATTAGAACAGGAATGAATCAGG + Intergenic
1050093117 9:2035404-2035426 GAGCAGAAAAAGTAAGCACCTGG - Intronic
1052677564 9:31646520-31646542 GAGCAGAACAAGAAGGACAGAGG - Intergenic
1053287106 9:36856811-36856833 GAGCAGTACCAGACTGAAGCCGG + Intronic
1055181374 9:73391466-73391488 GAGCAGAAAAATAAAGAATCAGG - Intergenic
1055321835 9:75089449-75089471 GAACAGAGCAAAAATGAACAAGG - Intronic
1055958641 9:81798339-81798361 AAGCAGAATATAAATGAACCTGG - Intergenic
1056687665 9:88779622-88779644 CAGCAGATCAAGCATGACCCTGG - Intergenic
1058643078 9:107105876-107105898 GAGCAGAGCATGAAGGAGCCTGG + Intergenic
1059137400 9:111820306-111820328 TAGCAGAGCTAGAAGGAACCTGG + Intergenic
1062723951 9:138060723-138060745 GGGCAGAACAGGAAGGAGCCTGG - Intronic
1190796459 X:53748325-53748347 TACCAGAACATGAATGAACCTGG + Intergenic
1191067705 X:56367645-56367667 GAGCAGAAGAAGAATCAAAAAGG - Intergenic
1191179262 X:57541587-57541609 GAAAAGAATAAGAATGCACCTGG + Intergenic
1192272890 X:69600082-69600104 GAGCAGAACAAGGAAGAAAGTGG + Intergenic
1192799178 X:74449653-74449675 GAGCTGAACAAGAGAGGACCAGG - Intronic
1195250466 X:103039495-103039517 GAGCAGAACAATAATGAGTAAGG - Intergenic
1195508936 X:105691938-105691960 GAGCAGATCTAGAATTAAACAGG + Intronic
1195965019 X:110422175-110422197 GAACAGAACCAGAAGAAACCTGG - Intronic
1196866664 X:120077024-120077046 GACCAGAGCGAGAAGGAACCTGG - Exonic
1196876435 X:120159257-120159279 GACCAGAGCGAGAAGGAACCTGG + Exonic
1198713562 X:139532099-139532121 GATAAGAATAAGGATGAACCAGG + Intronic
1200523331 Y:4239795-4239817 GAACCTATCAAGAATGAACCAGG - Intergenic
1202095074 Y:21241451-21241473 GATGAGAATAAAAATGAACCAGG - Intergenic