ID: 1169103565

View in Genome Browser
Species Human (GRCh38)
Location 20:2974247-2974269
Sequence CAAAAATCAAACAGACGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 616
Summary {0: 1, 1: 0, 2: 2, 3: 66, 4: 547}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169103565_1169103576 28 Left 1169103565 20:2974247-2974269 CCCGGCCGTCTGTTTGATTTTTG 0: 1
1: 0
2: 2
3: 66
4: 547
Right 1169103576 20:2974298-2974320 GGAGTACAGTGGTGTGATCTTGG 0: 900
1: 16513
2: 57059
3: 118780
4: 135162
1169103565_1169103569 7 Left 1169103565 20:2974247-2974269 CCCGGCCGTCTGTTTGATTTTTG 0: 1
1: 0
2: 2
3: 66
4: 547
Right 1169103569 20:2974277-2974299 ATCTCACTCTGCCCCCCTTCTGG 0: 1
1: 0
2: 2
3: 17
4: 282
1169103565_1169103570 17 Left 1169103565 20:2974247-2974269 CCCGGCCGTCTGTTTGATTTTTG 0: 1
1: 0
2: 2
3: 66
4: 547
Right 1169103570 20:2974287-2974309 GCCCCCCTTCTGGAGTACAGTGG 0: 1
1: 0
2: 0
3: 38
4: 1420
1169103565_1169103577 29 Left 1169103565 20:2974247-2974269 CCCGGCCGTCTGTTTGATTTTTG 0: 1
1: 0
2: 2
3: 66
4: 547
Right 1169103577 20:2974299-2974321 GAGTACAGTGGTGTGATCTTGGG 0: 9
1: 77
2: 455
3: 1268
4: 2310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169103565 Original CRISPR CAAAAATCAAACAGACGGCC GGG (reversed) Intronic
901014943 1:6223400-6223422 TGAAAACCAGACAGACGGCCGGG - Exonic
901050229 1:6422415-6422437 CAAAAAACAAACAAACAGGCCGG + Intronic
901393896 1:8966403-8966425 CAAAAAATAAACATACGGCCAGG - Intronic
901543096 1:9933929-9933951 CAAAAAACAAACAAAAGGCTAGG + Intronic
901704572 1:11063658-11063680 TAAAAAACAAACAGAAGGCCAGG + Intergenic
903021323 1:20397292-20397314 ATAAAATCAGACAGGCGGCCAGG + Intergenic
903176200 1:21582817-21582839 CAATAAAAAAACAAACGGCCAGG - Intergenic
903598299 1:24513697-24513719 AGAAAATCAAAAAGAGGGCCAGG - Intronic
903688614 1:25152746-25152768 CAAAAACCTAACTGAAGGCCGGG + Intergenic
903785354 1:25857565-25857587 AAAAAATAAAACAATCGGCCAGG + Intronic
903955178 1:27020624-27020646 AAAAAAAAAAACAGAAGGCCAGG - Intergenic
904048309 1:27622799-27622821 TAAAAATGAAATAGACGGCCGGG - Intronic
904118204 1:28177547-28177569 AAAAAAACAAACACAGGGCCAGG - Intronic
904118568 1:28180011-28180033 ACAAAAACAAACAGAGGGCCAGG + Intronic
904242360 1:29156199-29156221 CAAAAATCAACCAGACGTGGTGG + Intronic
904522286 1:31105004-31105026 AAAAAAGCAAACAGAGGGGCTGG - Intergenic
904648187 1:31984241-31984263 AAAAAATCAGACAGTAGGCCGGG + Intergenic
905889088 1:41508537-41508559 CAAAAATGAGACAGAAGGCAGGG - Exonic
906726093 1:48045251-48045273 AAAAAAACAAACAGAAGGCCAGG - Intergenic
906794004 1:48682262-48682284 CCAAAGTCATACAGAGGGCCAGG + Intronic
910406512 1:86897008-86897030 AAAAAATCAAAGAGCAGGCCGGG + Intronic
910888088 1:91987639-91987661 CAAAAAACAAAAACAAGGCCGGG - Intronic
912663489 1:111557251-111557273 TAAAAATCTTACAGAAGGCCAGG + Intronic
912832244 1:112963724-112963746 CAGAAATAAAAAAGACAGCCAGG - Intergenic
915327793 1:155089900-155089922 CAAAAACAAAACAAATGGCCAGG + Intergenic
915450308 1:156000671-156000693 AAAAAACCAAACATATGGCCGGG - Intronic
915750669 1:158206864-158206886 AAAAAATGAAACAGGAGGCCGGG - Intergenic
916232036 1:162550071-162550093 CAAAAATCTTAGAGTCGGCCGGG - Intergenic
916354267 1:163886753-163886775 CAAAGTTCAAACAGCCAGCCTGG + Intergenic
918673396 1:187250002-187250024 CAAAAATGAATCAGAAAGCCAGG + Intergenic
919689592 1:200517246-200517268 CAAAAATCCAAAAGGCAGCCAGG - Intergenic
919725802 1:200882626-200882648 CAGAAATGAAAAAGACGGCCGGG + Intergenic
920147189 1:203872291-203872313 CAAAAAACAAAAAAACTGCCAGG - Intergenic
921236066 1:213131737-213131759 AAAAAACCCAACAGATGGCCTGG - Intronic
921943677 1:220871110-220871132 AAAAAATCAAACTGCTGGCCGGG + Intergenic
922165470 1:223112251-223112273 CAAGAATCAAAGAGAAGGCCTGG + Exonic
922344777 1:224687391-224687413 AAAAAATAAAAAAGTCGGCCAGG - Intronic
922486506 1:225977252-225977274 AAAAAATAAAACTGTCGGCCAGG + Intergenic
923104888 1:230846806-230846828 TAAAAATCAGCCAGGCGGCCGGG + Intronic
923136170 1:231121668-231121690 CAAAAATAAATCAGCAGGCCTGG + Intergenic
923141908 1:231167615-231167637 TAAAAAAAAAAAAGACGGCCGGG - Intronic
923977089 1:239275893-239275915 GAAATATCAAACAGAGGACCTGG + Intergenic
924162332 1:241245806-241245828 CAAAAAACAAACAAACAGGCAGG + Intronic
924312961 1:242764618-242764640 TAAAAATCAAACAGAAATCCTGG + Intergenic
924478631 1:244405475-244405497 CAAAAAGAAAAAAGAAGGCCGGG - Intergenic
924749143 1:246869136-246869158 AAAAAACAAAACACACGGCCGGG - Intronic
1062837120 10:642906-642928 TAAGAATCAAACACAGGGCCGGG + Intronic
1063612433 10:7574496-7574518 CAAAAAACAAAAAACCGGCCGGG + Intronic
1063693899 10:8314241-8314263 CAACAACCAAACAAAGGGCCAGG + Intergenic
1063919798 10:10921248-10921270 CAAAAAACAAACACCTGGCCGGG - Intergenic
1064253731 10:13726887-13726909 AAAAAAGCAAACTAACGGCCAGG - Intronic
1064269195 10:13849772-13849794 CAAAAATGCAAGAGATGGCCAGG - Intronic
1064302098 10:14131997-14132019 TAAAATTCAAACATAAGGCCAGG + Intronic
1065388351 10:25156478-25156500 AAAAAATTAAACAAATGGCCGGG - Intergenic
1066683870 10:37961939-37961961 AAAAAACCTAACAGATGGCCAGG + Intronic
1067347678 10:45448415-45448437 CAAAAATTAGCCAGGCGGCCGGG + Intergenic
1067405281 10:46017249-46017271 CAAAAATATAACATAGGGCCGGG + Intronic
1069459074 10:68577340-68577362 CAAGAATGAAATAGAAGGCCAGG - Intronic
1070022071 10:72596573-72596595 CAAAAATCCAACACAGGGCCAGG + Intronic
1070962405 10:80508411-80508433 GAAAAAGCATACACACGGCCGGG - Intronic
1071247120 10:83776936-83776958 CAAAAAACAAACAAACAGGCCGG + Intergenic
1071664136 10:87537230-87537252 AAAAAGTGAAAAAGACGGCCGGG - Intronic
1071830917 10:89371165-89371187 CAGAACTCATACAGACAGCCTGG + Intronic
1072592063 10:96835195-96835217 TAAAAACCAAAAACACGGCCGGG - Intronic
1072647084 10:97265204-97265226 TAACAAACAAACAGAAGGCCAGG + Intronic
1073133266 10:101204572-101204594 AAAAAAAGAAAAAGACGGCCAGG - Intergenic
1073634947 10:105188114-105188136 CAAAAATCAAACTGAAGCCAGGG - Intronic
1074066144 10:110015667-110015689 AAAAAATCAAACATTCTGCCAGG - Intronic
1075342282 10:121656787-121656809 TAAAAAACAAACAAATGGCCAGG - Intergenic
1076914098 10:133411773-133411795 AAAAAATCAAACAGAAATCCTGG - Intronic
1077039034 11:509829-509851 CAAAAATAAAAATGAAGGCCAGG - Intergenic
1077587429 11:3464366-3464388 CAAAAATAAAAGTGACGGCCAGG - Intergenic
1078384226 11:10873546-10873568 TAAAAAACAAACAGGTGGCCGGG - Intergenic
1079055039 11:17198403-17198425 TAAAAATCACACAGTTGGCCTGG - Intronic
1081463825 11:43297988-43298010 CAAAAACAAAAAAGAAGGCCAGG + Intergenic
1082893156 11:58161825-58161847 CAAAAATCAACCAGAGGGCCGGG - Intronic
1082929228 11:58581654-58581676 CAAAAATTAAACAGCAGGCTGGG - Intronic
1083359433 11:62095765-62095787 TAAAAACCAACCAGAGGGCCGGG - Intergenic
1083360011 11:62100252-62100274 TAAAAACCAACCAGAAGGCCGGG + Intergenic
1083466386 11:62849420-62849442 CAAAAATTAAAAACAGGGCCTGG + Intergenic
1083469890 11:62876893-62876915 CCAAAATAAAACAAACTGCCAGG - Intronic
1084829563 11:71758577-71758599 CAAAAATAAAAGTGACGGCCAGG + Intergenic
1084964148 11:72735313-72735335 CAAAACACAAACTGAGGGCCGGG + Intronic
1085012170 11:73148644-73148666 CAAGCATCAGACAGAAGGCCGGG - Intergenic
1085033127 11:73284536-73284558 CAAATCTCACACACACGGCCAGG + Intronic
1085615992 11:77999227-77999249 CCAAAATCAAACAAAAGGTCTGG - Intergenic
1086250511 11:84807148-84807170 TAGAAATAAAACAGAAGGCCAGG + Intronic
1087578174 11:100016609-100016631 CAAAAATCAAGCAAACAGCCTGG - Intronic
1088659588 11:112032186-112032208 AAAAAATAAAACAGGAGGCCAGG - Intronic
1088662296 11:112059686-112059708 TAAAAATCAAAGAGAGGTCCGGG - Intronic
1089192732 11:116665644-116665666 AAAAAATCAAACAAAAGTCCTGG + Intergenic
1089545922 11:119225390-119225412 CAAAAACAAAACATAAGGCCAGG - Intronic
1090798193 11:130153492-130153514 CAAAAAACAAACAAACAGCCGGG + Intergenic
1090862236 11:130664423-130664445 CAGAAATCAATCAGACGTCAGGG + Intergenic
1091052989 11:132391252-132391274 CAAAAGTCAAAGATATGGCCAGG - Intergenic
1091497762 12:987263-987285 CAAAAATCAAACTGGCGGGCTGG - Intronic
1091500350 12:1010793-1010815 CAAAAATCATATAGCCAGCCGGG - Intronic
1091563799 12:1633308-1633330 CAAAAATCCAACAGACATTCAGG - Intronic
1092135478 12:6143968-6143990 CAAAAAGCAAACAAACGGGCTGG + Intergenic
1092221286 12:6715694-6715716 CAAAAAACAAACAAACGGCCGGG - Intergenic
1092267981 12:6997879-6997901 CAAAAATCAGCCATGCGGCCAGG - Intronic
1092413676 12:8273118-8273140 CAAAAATAAAAGTGACGGCCAGG - Intergenic
1092619033 12:10243316-10243338 AAAGAATAAAACAGAAGGCCAGG + Intergenic
1092643433 12:10542452-10542474 AAAAAATCAAAGAAGCGGCCAGG + Intergenic
1093567639 12:20627405-20627427 CAAAAAGCAAAAAGAGGGGCAGG - Intronic
1094279318 12:28718000-28718022 AGAAAATCATACAGAAGGCCGGG + Intergenic
1094550512 12:31446599-31446621 TAAAAATGAAACATAAGGCCGGG + Intronic
1094711543 12:32968109-32968131 TAAAAATCTAACAGTAGGCCAGG - Intergenic
1095448898 12:42308938-42308960 AAAAAAACAAAAAAACGGCCTGG + Intronic
1096136844 12:49209713-49209735 CAAAAATCAAATCTAGGGCCGGG - Intronic
1096283569 12:50278122-50278144 CAAAAATTAGCCAGACGGGCTGG + Intronic
1096642174 12:53003394-53003416 CAAAAAAAAAAAAGCCGGCCGGG + Intergenic
1096986190 12:55759734-55759756 CAAAAAAGAAAAAGGCGGCCGGG - Intronic
1097311819 12:58127352-58127374 CAATAATCAAATTGAGGGCCGGG + Intergenic
1097698000 12:62793427-62793449 GAGAAAGCAAACAGAGGGCCGGG + Intronic
1097867151 12:64568326-64568348 AAAAAACCAAACAAGCGGCCAGG - Intergenic
1098974917 12:76892501-76892523 CTTAACTCAAAGAGACGGCCAGG - Intergenic
1099361310 12:81705152-81705174 CAAAAATGAAAGATACGGCCGGG + Intronic
1099625856 12:85072727-85072749 TAAAAATAAAAAAGATGGCCAGG - Intronic
1099688251 12:85917137-85917159 CAAAAATTAAAAAGACTGACAGG - Intergenic
1099977314 12:89559338-89559360 CAAAAATCACAAAGCAGGCCAGG - Intergenic
1100333523 12:93608147-93608169 CAAAAAACAAAAAAAGGGCCAGG - Intergenic
1100399033 12:94211977-94211999 TAAAAATAGAAAAGACGGCCGGG + Intronic
1100470076 12:94883479-94883501 AAAAAAAAAAACAGATGGCCAGG + Intergenic
1100481561 12:94984325-94984347 TAAAAAACAAGCAAACGGCCGGG + Intronic
1101379110 12:104198684-104198706 GAAAAATCAAAAAGAAGGCCAGG + Intergenic
1102306261 12:111806968-111806990 CAAAAAACAAACAAACAGACCGG + Intronic
1102400898 12:112628755-112628777 CAAAAAACAAACAGAAGCCATGG + Intronic
1103134753 12:118497950-118497972 CAAAGATCAAACAGGGGCCCTGG - Intergenic
1103599389 12:122044525-122044547 TAAAAATCAAACAATTGGCCAGG + Intronic
1103664865 12:122555551-122555573 CAAAAATAAAAAAGAAGGGCCGG + Intronic
1103995229 12:124825373-124825395 CAAAAAAAGAACAGAGGGCCAGG + Intronic
1104434738 12:128747090-128747112 CCAAAATCACACAGCAGGCCTGG + Intergenic
1104681609 12:130755795-130755817 TAAAAATCAGACAGCAGGCCAGG + Intergenic
1104988202 12:132609398-132609420 TAAAAATCATTAAGACGGCCCGG + Intronic
1105025592 12:132846583-132846605 CAAAAAACAACCTGAAGGCCGGG + Intronic
1105736687 13:23278771-23278793 CAAAAGTGAAACAGAAGGCATGG + Intronic
1105938290 13:25121876-25121898 TAAAAATCAAACAGAAGCCCTGG + Intergenic
1107444139 13:40455445-40455467 TAAAAACAAAACAGACAGCCAGG + Intergenic
1107522502 13:41197316-41197338 CAAAAAGAAAACATAGGGCCGGG + Intergenic
1107786047 13:43958872-43958894 CAAACATCAAAAAGGGGGCCAGG + Intergenic
1107931716 13:45312560-45312582 CAAAAATGAAAAAGAAGGCCGGG - Intergenic
1108014928 13:46064751-46064773 CAAAATACAAACAGACAACCTGG + Intronic
1108747950 13:53414470-53414492 TAAAAAACAAACAAATGGCCAGG + Intergenic
1108969046 13:56349081-56349103 TAAAAATTAAACAGAAGGGCTGG - Intergenic
1109993086 13:70084768-70084790 AAAATATGAAATAGACGGCCCGG - Intronic
1111796076 13:92921720-92921742 AAAAAATCAAACTTAGGGCCGGG - Intergenic
1112518448 13:100076426-100076448 TAAAGAACAAACAAACGGCCGGG + Intergenic
1112967056 13:105210322-105210344 AAAAAATCAGCCAGACAGCCGGG + Intergenic
1113810457 13:113139128-113139150 CAAAAATCAAAAAGCTGGGCCGG + Intronic
1114299840 14:21365805-21365827 CCCAAAACAAACAAACGGCCAGG + Intronic
1114898471 14:27025464-27025486 AAAAAATCAAAAAGTAGGCCAGG - Intergenic
1116391554 14:44397307-44397329 CAAAAATCAGACATTTGGCCAGG - Intergenic
1116612192 14:47089834-47089856 CAGAAGTAAAACAGAAGGCCGGG - Intronic
1116881248 14:50171388-50171410 AAAAAATCCAACAGTCAGCCAGG + Intronic
1117164055 14:53016418-53016440 TAAGAATTAAACTGACGGCCGGG - Intergenic
1118247049 14:64121223-64121245 CAAAAACCAAAAAAAAGGCCAGG + Intronic
1118367535 14:65108558-65108580 GAAAAAACAAAAAGAAGGCCGGG + Intergenic
1118398637 14:65359127-65359149 CAAAAGTAAAACAGATGCCCTGG - Intergenic
1118549138 14:66930004-66930026 AAAAACACACACAGACGGCCGGG - Intronic
1118783759 14:69028371-69028393 TAAAAATGAAACTGAAGGCCAGG + Intergenic
1118940680 14:70333394-70333416 TAAAAATCAAACAGAAATCCTGG + Intronic
1119361405 14:74053404-74053426 AAAAAATAAAAAAGTCGGCCGGG - Intronic
1119693267 14:76693148-76693170 AAAAAATCAAAAATAGGGCCGGG - Intergenic
1120960445 14:90119893-90119915 TAAAAAATAAACAGAAGGCCAGG - Intronic
1121750863 14:96354775-96354797 CAAAAACAAAACACACGGGCTGG - Intronic
1122006378 14:98707339-98707361 AAAAAATTAAACATAGGGCCGGG - Intergenic
1123005234 14:105318276-105318298 TAAAAACCAAACAGATGGCCAGG - Intronic
1123478499 15:20610359-20610381 TAAAACACAAACACACGGCCGGG - Intergenic
1123639514 15:22390026-22390048 TAAAACACAAACACACGGCCGGG + Intergenic
1124906740 15:33875707-33875729 CATAATTCACACAGATGGCCAGG + Intronic
1125829468 15:42703865-42703887 TAAAAATCAAACAGAAATCCTGG - Intronic
1126623598 15:50664798-50664820 AAAAAATTAAACAGTCAGCCGGG + Intronic
1126719043 15:51556475-51556497 AAAAAATTAAAAAGATGGCCGGG + Intronic
1126750696 15:51873914-51873936 AAAAAATTAAGCAGTCGGCCAGG - Intronic
1127479416 15:59364742-59364764 TAAAAATAAAACAGTTGGCCGGG + Intronic
1127788455 15:62377179-62377201 CTAAAAACAAACAAAAGGCCGGG + Intergenic
1128079746 15:64849439-64849461 CAAAAAAAAAAAAGAGGGCCAGG - Intronic
1128102771 15:65017524-65017546 TAAAAAACAAAAAGAAGGCCAGG + Intronic
1128444815 15:67749738-67749760 CAAATATCAGACAGACCTCCTGG + Intronic
1128906797 15:71474514-71474536 CAAAAATAAAGTAGAAGGCCAGG - Intronic
1129963825 15:79715313-79715335 CAAGAAAAAAACAAACGGCCGGG + Intergenic
1130173014 15:81536262-81536284 AAAAAATCAAACAGAAGTCATGG + Intergenic
1130218179 15:81992638-81992660 AAAAAATCAAACAGAAATCCTGG + Intergenic
1130843921 15:87726555-87726577 CAACAATCAAACAGCAGACCAGG + Intergenic
1131629283 15:94158853-94158875 CAAAAATCAAAGGTACGGCTGGG - Intergenic
1133092032 16:3412160-3412182 CAAAAAGCAAAAAAACCGCCGGG + Intronic
1133186465 16:4102718-4102740 CAAAAAACAAACACATGGCTGGG - Intronic
1133274621 16:4629748-4629770 AAAAAATCATACAGGCGGCTGGG + Intronic
1133281726 16:4670539-4670561 TAAAAAGCTAACAGATGGCCGGG - Intronic
1134037315 16:11040805-11040827 AAAAAATGAAACAGCAGGCCAGG - Intronic
1134598499 16:15514783-15514805 CAAAAAACAAAAACAAGGCCGGG + Intronic
1134677334 16:16099786-16099808 CAAAAAGCCAACAGGGGGCCAGG + Intronic
1134846475 16:17445154-17445176 CAAAAATCAAACAATTAGCCTGG - Intronic
1135736555 16:24936408-24936430 TAAAAAACAAACAGCAGGCCAGG + Intronic
1135819295 16:25666640-25666662 GAAAAATCAAACAGAAATCCTGG + Intergenic
1135875445 16:26195818-26195840 CCAAAATCAAAGAGAAGGGCAGG - Intergenic
1135976515 16:27111969-27111991 CAAGATTTAAACAGACAGCCTGG + Intergenic
1136218483 16:28811846-28811868 AAAAAAAAAAACAAACGGCCAGG - Intergenic
1136516404 16:30771320-30771342 CAAAAACCAGACAGCAGGCCAGG + Intronic
1137388360 16:48060532-48060554 TTAAAATAAAACAGAAGGCCGGG - Intergenic
1137596404 16:49727023-49727045 GAAAAATCAAACAGACATCAGGG + Intronic
1137700782 16:50496268-50496290 CAAAAAACAAACAAACAGGCCGG + Intergenic
1137848873 16:51718733-51718755 TAAAAAGGAAACAGAAGGCCGGG + Intergenic
1139407814 16:66733405-66733427 CAAAAATTATCCAGATGGCCAGG + Intronic
1139620584 16:68137913-68137935 AGAAAATGAAACATACGGCCGGG - Intronic
1139716868 16:68820643-68820665 TAAAAATTAAACAGCAGGCCAGG - Intronic
1139903304 16:70345016-70345038 TAAAAATCAAAAAAAGGGCCGGG - Intronic
1140085664 16:71793868-71793890 CAAAAATCAGCCAGTCAGCCTGG - Intronic
1140166719 16:72560000-72560022 TAAAAATCAAATATGCGGCCGGG + Intergenic
1140512852 16:75520603-75520625 CAAAAAACAAAAAAAAGGCCAGG + Intergenic
1140804731 16:78522774-78522796 TAAAAATCTAACAGTGGGCCAGG + Intronic
1140886958 16:79252783-79252805 CAAAAATCAAAACCACGGCCGGG - Intergenic
1141084811 16:81085859-81085881 CAAAAACAAAAAAAACGGCCGGG + Intronic
1141218045 16:82043387-82043409 TAAAAATCATATAGATGGCCGGG + Intronic
1141563945 16:84888657-84888679 CAAGAAACAGACAGACAGCCAGG - Intronic
1143152806 17:4817661-4817683 CAAAAATAAAATAAAAGGCCAGG + Intronic
1143242942 17:5459588-5459610 TAAAAATCAAACAATCAGCCAGG - Intronic
1143334343 17:6161076-6161098 AAAGACTCAAACAGGCGGCCGGG + Intergenic
1144563313 17:16339661-16339683 CAAAAAAAATACAGATGGCCAGG - Intronic
1144677308 17:17169951-17169973 CAAAAATCTAACAGAAGCACTGG - Intronic
1144887626 17:18474368-18474390 CAAAACTCAAACAGAAAACCAGG - Intergenic
1145144590 17:20469927-20469949 CAAAACTCAAACAGAAAACCAGG + Intergenic
1145176043 17:20701324-20701346 CAAAACTCAAACAGAAAACCAGG + Intergenic
1145232856 17:21187328-21187350 AAAAAACAAAACAGAAGGCCGGG + Intronic
1146052476 17:29564957-29564979 CAAAAAACAAACAAACAGCTGGG + Intronic
1146199798 17:30847012-30847034 CAAAACTCAAACTGTGGGCCAGG - Intronic
1146338116 17:31992703-31992725 CAAAAAACAAAAACAGGGCCGGG - Intronic
1146854121 17:36249569-36249591 CAAACATCTCACAGACTGCCTGG - Intronic
1147058856 17:37857832-37857854 TAAAAATCATAAAGAAGGCCAGG + Intergenic
1147117270 17:38310622-38310644 CAAAAACCAAAAACAAGGCCAGG - Intronic
1147227233 17:38988812-38988834 AAAAAATTAAACATAGGGCCAGG - Intergenic
1147275522 17:39313210-39313232 AAAAAAACAAAAAGATGGCCGGG - Intronic
1147647827 17:42044319-42044341 AAAAAAAAAAAAAGACGGCCGGG + Intronic
1147809228 17:43155373-43155395 TAAAAATTAAAAAGATGGCCGGG - Intergenic
1147929506 17:43969218-43969240 CAAAAATCAATCACTTGGCCAGG + Intronic
1148041555 17:44711490-44711512 CAAGAATCAAACAGGAAGCCAGG - Intronic
1148059245 17:44824005-44824027 CAAAAAACGAAAAGAGGGCCAGG - Intronic
1148398191 17:47327456-47327478 CAAAAATAAAAAAAAAGGCCAGG - Intronic
1148412414 17:47478969-47478991 CAAAAACCAAAAACAAGGCCAGG + Intergenic
1148489848 17:48015898-48015920 CAAAAATAAAACAAAAGGCCAGG - Intergenic
1148606735 17:48935216-48935238 CAAAAATTAGCCAGGCGGCCAGG + Intronic
1148681723 17:49477943-49477965 CAAACATCAAAAGCACGGCCTGG + Intergenic
1149474100 17:56944720-56944742 CTAAAAATAAACAGAAGGCCAGG + Intronic
1149767477 17:59291394-59291416 CAAAAATAATACAGGAGGCCAGG + Intergenic
1150074519 17:62181102-62181124 CAAAAATCAAACTGCCAGCAGGG - Intergenic
1150083317 17:62260636-62260658 CAAACATCTCACAGACTGCCTGG - Intergenic
1150681158 17:67285664-67285686 CAAAAATCAGAAGGAAGGCCAGG + Intergenic
1150839925 17:68598298-68598320 TAAAAATGAAACACAAGGCCGGG - Intronic
1151311302 17:73294053-73294075 CAAAAACCAAACACAAGGCCGGG + Intronic
1151624575 17:75268700-75268722 AAGAAATCATACAGAGGGCCTGG + Intronic
1151704713 17:75760906-75760928 AAAAAATAAAAAAGATGGCCAGG + Intronic
1152050558 17:77972215-77972237 CAAGAATGAAAGAGAGGGCCAGG + Intergenic
1152274193 17:79344849-79344871 TGAAAAGCAAACAGATGGCCGGG - Intronic
1152440734 17:80307843-80307865 AAAAAAAAAAACAGACGGCCAGG - Intronic
1153751998 18:8241874-8241896 CTCAAATCAAACAGAGGTCCAGG - Intronic
1154013134 18:10592602-10592624 CAAAAAGCAAACAAGTGGCCAGG + Intergenic
1154221437 18:12458314-12458336 CAAAACTCAAAGTGAAGGCCAGG + Intronic
1154369167 18:13743027-13743049 CATAAATCAAAGATCCGGCCGGG + Intronic
1155803771 18:30141306-30141328 TAAAAATCAAACTGTCAGCCGGG - Intergenic
1156133373 18:34005759-34005781 AAAAAATCAAATAGCCTGCCAGG + Intronic
1157245544 18:46051178-46051200 CAAAAATTGAACATAAGGCCGGG + Intronic
1157973389 18:52297611-52297633 CAAAAATCAAATAGTCTGCCAGG + Intergenic
1160513269 18:79464388-79464410 TAAAAATGAAACAGCAGGCCGGG - Intronic
1160695911 19:484434-484456 CAAAAATAAAACAAGAGGCCAGG - Intergenic
1161133706 19:2607220-2607242 CAAAAAAAAAAAAGAAGGCCAGG + Intronic
1161485696 19:4534664-4534686 CAAAAATCACACAGCTGGCCAGG - Intronic
1161731439 19:5963388-5963410 CAAAAAACAAACAAATAGCCAGG + Intronic
1161833706 19:6629982-6630004 TAAAAATCAAACTGCCGGGCCGG - Intergenic
1161879212 19:6936139-6936161 CAAAAGTCAAAAAGGAGGCCTGG + Intronic
1161995490 19:7708846-7708868 CAAAAATAAAACAGAAAGGCAGG - Intergenic
1162292141 19:9788150-9788172 CAAAAAACAAACTGATGGTCAGG - Intronic
1162517959 19:11161129-11161151 CAAAAAACAAAAAAAAGGCCAGG - Intergenic
1162852973 19:13445832-13445854 CAAAGAACAAACAGATGTCCGGG + Intronic
1163289407 19:16369765-16369787 CAAAAATAATACAGACTGGCAGG + Intronic
1163318895 19:16560564-16560586 AAAAAACCTAACAGACAGCCGGG + Intronic
1163432722 19:17277879-17277901 CAAAAAATAAAAATACGGCCAGG + Intronic
1163490322 19:17614003-17614025 CAAAAACAAAAAAGAAGGCCAGG - Intronic
1163592292 19:18200934-18200956 CAAAAAACAAACAGGGGGTCGGG + Intronic
1163719680 19:18893206-18893228 CAAAAAAGAAAAAGAGGGCCAGG - Intronic
1164175717 19:22772387-22772409 CAAAAAACAAAAAGAAGGTCGGG + Intronic
1165106357 19:33471864-33471886 TAAAAATCAGCCAGATGGCCAGG + Intronic
1165164489 19:33841985-33842007 CAAGAAGGAAACAGACGCCCAGG + Intergenic
1165498906 19:36171893-36171915 CAAAAATAAAAAATAAGGCCGGG + Intergenic
1165928032 19:39339391-39339413 TAAAAACCAAACAGCAGGCCAGG + Intronic
1166125471 19:40713207-40713229 CAAAAATTAGCCAGGCGGCCAGG + Intronic
1166577015 19:43851419-43851441 AAAAAAAAAAAAAGACGGCCGGG + Exonic
1166582678 19:43916111-43916133 AAAAAAACAAAAAGAAGGCCAGG - Intronic
1167168605 19:47816361-47816383 AAAAAATTAAAAAGAAGGCCAGG - Intronic
1167489588 19:49784130-49784152 CAGAAATAAAACAGAAGGCCGGG + Intronic
1167519166 19:49942219-49942241 CAAAAAACAAACAAACAGCCTGG + Intronic
1168321964 19:55516200-55516222 CAAAAATGTAACTGAAGGCCGGG + Intronic
1168660937 19:58165693-58165715 CAAAAAACAAAAACAAGGCCAGG - Intergenic
925414335 2:3658705-3658727 CAAAAATCAAAAAAATAGCCAGG + Intronic
926110190 2:10177772-10177794 CAAAAATTAAACAGACGTGATGG - Intronic
926117020 2:10219845-10219867 CAAGATTCAAAGAGAAGGCCAGG - Intergenic
926338978 2:11887908-11887930 TAAAAATACAACAGATGGCCAGG - Intergenic
927896769 2:26787508-26787530 AAAAAACCAAAAAGCCGGCCGGG - Intronic
928314595 2:30235700-30235722 AAAAAATCAAATAGAAAGCCAGG + Intronic
928431296 2:31220527-31220549 CATAAAACTAACTGACGGCCAGG + Intronic
928831683 2:35493432-35493454 CAAAAATCAGACAGCAGGACTGG + Intergenic
929475277 2:42240843-42240865 TAAATAGCAAACAGATGGCCGGG + Intronic
930368998 2:50480365-50480387 CCAGAATGAAACAGAAGGCCAGG - Intronic
931837472 2:66113974-66113996 CAGAAATCAAAAATATGGCCAGG - Intergenic
932822415 2:74912598-74912620 TAAAAATCCAAAAGTCGGCCAGG - Intergenic
932828353 2:74962153-74962175 CAAAAATCAGAAAGACAGCAGGG - Intronic
934489483 2:94750647-94750669 CTAAAATCAAACACATGGACAGG + Intergenic
935037456 2:99392333-99392355 CAAAAATCAAAAACTGGGCCGGG - Intronic
936474352 2:112826791-112826813 CAAAAATCAAACTGTAGGCCAGG + Intergenic
936590657 2:113800676-113800698 AAAAAATTAAAAAGACGGCCGGG - Intergenic
937121840 2:119445726-119445748 ACAAAATCAAACTAACGGCCGGG - Intronic
937169024 2:119846578-119846600 CAAAAATCAATCAAAAGGCAGGG - Intronic
937887311 2:126908800-126908822 CAAGAATAAAACCGACGACCAGG + Intergenic
938318793 2:130348220-130348242 AAAAAAGCATACAGAAGGCCTGG + Intergenic
940671182 2:156669985-156670007 TAAAAATTAAAAAGAGGGCCAGG - Intergenic
940924001 2:159343729-159343751 CAAAAAGAAAAAAAACGGCCGGG + Intronic
940943845 2:159594106-159594128 TAAAAAACAAAAAGTCGGCCGGG + Intronic
941799773 2:169645854-169645876 CAAAAGTCAAAGAGAAGGCTAGG - Exonic
942177367 2:173346834-173346856 CAAAAGTTAAACACAGGGCCAGG - Intergenic
943120817 2:183733456-183733478 CAAAACTCAACCATAAGGCCGGG + Intergenic
943272261 2:185821626-185821648 CAAAAATCAATCAATAGGCCAGG + Intronic
943645122 2:190401559-190401581 CAGAAATCAAACACAAGGCCAGG + Intergenic
944709165 2:202320250-202320272 CAAAAAACAAACATACAGGCCGG - Intergenic
944769213 2:202896690-202896712 CAAAAAACAAACAAACAGGCTGG + Intronic
945122786 2:206474868-206474890 CAATAATGCAACTGACGGCCAGG - Intronic
945776991 2:214117170-214117192 AAAAAATCAAACAGAAATCCTGG + Intronic
946001683 2:216487472-216487494 CAAAATTAAAACAGACAGCTAGG - Intergenic
946881849 2:224184409-224184431 AAAAATTCAAACTGAAGGCCAGG - Intergenic
947487070 2:230561163-230561185 CAAAAATCAATCAGTGGGCCAGG + Intergenic
948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG + Intronic
948529213 2:238593363-238593385 CGAAAATGAAACAAAGGGCCGGG - Intergenic
948690513 2:239699686-239699708 CAAAAATTAAAAATAGGGCCTGG - Intergenic
948820566 2:240541912-240541934 TAAAAATCAAACTGCTGGCCAGG + Intronic
948972217 2:241437958-241437980 CAAAAATCAGCCAGGCGGCTGGG - Intronic
1168781160 20:491670-491692 CAGAAAACAAACAAAAGGCCGGG + Intronic
1169103565 20:2974247-2974269 CAAAAATCAAACAGACGGCCGGG - Intronic
1171879427 20:30606590-30606612 CTAAAATCAAACACATGGACAGG + Intergenic
1172142596 20:32733881-32733903 CAAAAAAAAAAAAGAAGGCCGGG + Intronic
1174368347 20:50069848-50069870 TAAAAATAAAAAAGGCGGCCAGG + Intergenic
1174471443 20:50764066-50764088 TAAAAATTAACCAGGCGGCCGGG - Intergenic
1175185102 20:57174611-57174633 CTACATTCAAACACACGGCCCGG + Intronic
1175783345 20:61697302-61697324 CAGAAATAAGACAGAAGGCCGGG + Intronic
1177020756 21:15854437-15854459 AAAAAAACAAAAACACGGCCGGG - Intronic
1177394750 21:20518556-20518578 AAAAAATAAAACTGACAGCCGGG - Intergenic
1177462400 21:21430187-21430209 CAAAAATAAAAAAAACAGCCGGG - Intronic
1177533759 21:22397607-22397629 TAAAAATCAAACTGTCAGCCAGG + Intergenic
1179014730 21:37586804-37586826 TAAAAATAAAAAATACGGCCAGG - Intergenic
1180232524 21:46435835-46435857 CAAAAACAAAACTGCCGGCCGGG - Intronic
1180627364 22:17203067-17203089 GAAAAATGAAATAGACGGCCGGG - Intronic
1180685030 22:17659363-17659385 CAAAAAACAAACAAACTGGCTGG + Intronic
1181289948 22:21784052-21784074 CAAAAAACAAAATGAAGGCCGGG + Intronic
1181305436 22:21914272-21914294 CAAAAAACAAACAAAAGACCAGG + Intergenic
1181526421 22:23491585-23491607 AAAAAAACAAAAAGAAGGCCAGG - Intergenic
1181923568 22:26339937-26339959 CAAAAACCCAACTGACGGCCGGG + Intronic
1182147851 22:28007975-28007997 CAGAAATCAATTAGACAGCCTGG + Intronic
1182638018 22:31744426-31744448 CAAAAATAAAAAAGTAGGCCGGG - Intronic
1183473118 22:38020036-38020058 CAAAAATAAAACAGAAGTCCAGG + Intronic
1183983055 22:41553691-41553713 CAAAAATAAAACAGGGGGCCAGG - Intergenic
1184107345 22:42375861-42375883 CAAAAATTATCCAGACAGCCGGG - Intergenic
1184228828 22:43146928-43146950 AAAAAAAAAAAAAGACGGCCGGG + Intergenic
950052236 3:10001264-10001286 CAAAAATCAATTTGTCGGCCGGG + Intronic
950933137 3:16811228-16811250 CAAAATCCAAACAGACCTCCTGG - Intronic
952233785 3:31458294-31458316 CAAAAATTAAAAATAAGGCCAGG + Intergenic
952480964 3:33761260-33761282 AAAAAATAAAACAAAAGGCCGGG - Intergenic
952481657 3:33768303-33768325 CAAAAATCAAGCAAGGGGCCAGG + Intergenic
953091368 3:39729398-39729420 CAAAAATAAAACATTAGGCCGGG - Intergenic
953802677 3:46038311-46038333 AAAAAAACACACACACGGCCAGG - Intergenic
953988575 3:47465469-47465491 CAAAATTCTAACAGCTGGCCAGG + Intronic
954351284 3:50046282-50046304 AAAAAAAAAAAAAGACGGCCAGG + Intronic
954403025 3:50329143-50329165 CAAAAAAAAAAAAAACGGCCGGG - Intergenic
954482756 3:50816751-50816773 CAAAAATCCAATAGAAGGCTTGG - Intronic
954606004 3:51910115-51910137 CAAAAAACAAACAAACTGCCGGG + Intergenic
955365869 3:58309594-58309616 TAAAAACCAAACAGGAGGCCAGG + Intronic
955775315 3:62426442-62426464 TAAAAAACCAACACACGGCCGGG - Intronic
956341687 3:68231654-68231676 CAAAAATCAAATAGATTGGCCGG - Intronic
956533791 3:70252782-70252804 AGAAAATCAAAAAGAAGGCCAGG + Intergenic
956948814 3:74256400-74256422 CAAAAATCAAATAGAAGGCTGGG + Intergenic
957064865 3:75513491-75513513 CAAAAATCATACTCAAGGCCGGG - Intergenic
957426383 3:80045060-80045082 AAAAAATCAAACTGAAGGGCGGG - Intergenic
958147265 3:89641382-89641404 AAAAAATCAAACAGAAGTTCTGG + Intergenic
958191116 3:90185839-90185861 CAAAAATAAAACAGACGTGAAGG - Intergenic
958413314 3:93844956-93844978 CAAAAATAAAACAGACGTGAAGG - Intergenic
959105195 3:102057541-102057563 CAAAAATTAAAAATAAGGCCAGG - Intergenic
960120241 3:113941912-113941934 CAAAAAAAAAAAAGATGGCCGGG - Intronic
961288479 3:125825909-125825931 CAAAAATCATACTCAAGGCCGGG + Intergenic
961294731 3:125875732-125875754 CAAAAATAAAAGTGATGGCCAGG + Intergenic
961316926 3:126044598-126044620 TTAAAATCATACAGAGGGCCGGG + Intronic
961564266 3:127752392-127752414 CATAAAACAAAATGACGGCCGGG - Intronic
961884855 3:130090058-130090080 GAAAAATAAAACTGAGGGCCTGG + Intronic
961891230 3:130131750-130131772 CAAAAATAAAAGTGACGGCCAGG - Intergenic
962132620 3:132698272-132698294 CAAAAAACAAACAAATGGCTGGG - Intronic
962224961 3:133598222-133598244 CCAAAATCCAGGAGACGGCCAGG + Intronic
963946746 3:151153862-151153884 CAAAAAGAAAACAGAAGGCCGGG - Intronic
964121215 3:153185542-153185564 CAGAAATACAACAGAAGGCCAGG - Intergenic
964803591 3:160581720-160581742 AAAAAATCAAACAGAAGTCTTGG + Intergenic
966776670 3:183548562-183548584 CAAAAATCAGGCATAAGGCCAGG + Intronic
967014178 3:185466670-185466692 TAAAAAACAAACAAACAGCCGGG - Intronic
967193049 3:187001660-187001682 TGAAAAACAAACAAACGGCCGGG + Intronic
967669255 3:192212922-192212944 CAAAAATCAAACACCCTGTCTGG + Intronic
968719145 4:2186926-2186948 AAAAAATCAAACAGAAATCCTGG + Intronic
968851787 4:3085426-3085448 CAAAATTAAAACAAACGGCCAGG - Intronic
969002620 4:3994191-3994213 CAAAAATAAAAGTGACGGCCAGG - Intergenic
969751400 4:9114337-9114359 CAAAAATAAAAGTGACGGCCAGG + Intergenic
969811308 4:9650621-9650643 CAAAAATAAAAGTGACGGCCAGG + Intergenic
972112653 4:35584744-35584766 TAAAAATCAAATAGAGGGCCGGG + Intergenic
972470932 4:39403872-39403894 AAAAAAAAAAAAAGACGGCCGGG + Intergenic
972759674 4:42090902-42090924 CTAAAAACTAACAGGCGGCCGGG - Intergenic
975774218 4:77766766-77766788 AAAAAATAAAACAGTTGGCCAGG + Intronic
975856090 4:78626053-78626075 CAAAAATAAAAGAGAGGGCTGGG - Intergenic
975863264 4:78700509-78700531 AAAAATTCAAAAAGATGGCCGGG + Intergenic
976754550 4:88483823-88483845 CAAAAACCTAATAGAAGGCCAGG - Intronic
976787566 4:88839077-88839099 CAAAAATAAAACAAAAGCCCAGG - Intronic
977150764 4:93508488-93508510 AAAAAATCAAAAACAAGGCCAGG - Intronic
978552744 4:109945439-109945461 AAAAAAACAAATAGAAGGCCAGG + Intronic
978759320 4:112338259-112338281 TAAAAATTAAAATGACGGCCGGG - Intronic
981025564 4:140073790-140073812 CCAAAATCAAACAGGAGGCCTGG + Intronic
981523363 4:145688040-145688062 CAAAAATCAAAAAAATAGCCAGG + Intronic
981608473 4:146565995-146566017 CAAAAATCAAAGAAAAGGCAAGG + Intergenic
981642633 4:146962858-146962880 CAGAAAACAAACAAATGGCCCGG + Intergenic
982072108 4:151704746-151704768 CAAAAACAAAAAAGAAGGCCAGG - Intronic
982999955 4:162401951-162401973 TAAAAATTATACAGGCGGCCGGG + Intergenic
983310631 4:166056798-166056820 CAAAAAACCCACAGAAGGCCTGG - Intronic
984877328 4:184380878-184380900 CAAACATAACACAGAAGGCCTGG + Intergenic
985089057 4:186344645-186344667 AAAAAAACAAACTGGCGGCCAGG - Intergenic
986694437 5:10339406-10339428 CACAGACCAAACAGAAGGCCTGG + Intergenic
986883613 5:12206561-12206583 CTAAAATCAAACACACAACCAGG - Intergenic
987388754 5:17355217-17355239 TAAAAATAAAACAGATGGCCAGG - Intergenic
988869737 5:35376033-35376055 CAACAATAATACAGACGGCAGGG + Intergenic
989245701 5:39251847-39251869 CAAAAATAAAATATAGGGCCGGG + Intronic
990294976 5:54392310-54392332 CAAAAAATAAACAGCAGGCCGGG + Intergenic
992507197 5:77398614-77398636 CAAAAGTAAAACAGCCGGTCGGG - Intronic
993941169 5:94060941-94060963 CAAAAATTCAACACTCGGCCAGG + Intronic
994026931 5:95095316-95095338 TAAAAATCTAACATAAGGCCGGG - Intronic
994577132 5:101592812-101592834 CAAAAAACAAACATACGGCTGGG + Intergenic
996057495 5:118998132-118998154 TAAACATCACACACACGGCCAGG + Intergenic
996113512 5:119592914-119592936 AAAAAATCAAACAGAAATCCTGG + Intronic
996286892 5:121804487-121804509 GAAAAATCAAACATCCAGCCAGG - Intergenic
996971729 5:129377712-129377734 GAAAGATCAAAGAGAGGGCCAGG - Intergenic
997132443 5:131290630-131290652 CAAAAATTAACCAGCCAGCCTGG - Intronic
998426829 5:142036001-142036023 CAAAAATCAAACAGGTAGCTGGG + Intergenic
999480377 5:151942567-151942589 CAAAAAAGAAAAAGAAGGCCGGG - Intergenic
999911924 5:156210622-156210644 TAAAAATCAAACAGAAGTCCTGG + Intronic
1000344318 5:160301728-160301750 CAAAAAAAAAAAAGACGACCGGG - Intronic
1000726890 5:164782961-164782983 CAAAAATCAGAGGGACAGCCAGG - Intergenic
1000914212 5:167060355-167060377 TAAAAAGCAAAAAGAAGGCCAGG + Intergenic
1001070650 5:168582021-168582043 CAAGAATCAGAGAGACGGCCAGG - Intergenic
1002014791 5:176312238-176312260 CAAAAATCTAGCACAAGGCCAGG + Intronic
1003199677 6:3947576-3947598 CAAAAATCAGAGAAATGGCCGGG - Intergenic
1003618343 6:7674965-7674987 CAAGATTCAACCAGAGGGCCGGG - Intergenic
1005654139 6:27915322-27915344 GAAAAGTCAGACAGAGGGCCTGG - Intergenic
1005768258 6:29036696-29036718 CAAAAAACAAACAAATAGCCGGG - Intergenic
1006464297 6:34182366-34182388 TAAAAAATATACAGACGGCCAGG + Intergenic
1006550708 6:34820945-34820967 AAAAAAACAGACAGAGGGCCAGG - Intronic
1006605630 6:35254872-35254894 CAAAAACAAAAAAAACGGCCAGG + Intergenic
1006649408 6:35538438-35538460 CAGAAAACAAACAAACAGCCGGG + Intergenic
1006666900 6:35701537-35701559 CAAAAAACAAACAAACAGGCCGG - Intronic
1006846523 6:37065832-37065854 CAAAAATTAGCCAGACGTCCTGG - Intergenic
1006963453 6:37957960-37957982 CACAAATCAAATAGAGGGACTGG + Intronic
1007396113 6:41578732-41578754 CAAAAGGTAAACAGAAGGCCTGG - Intronic
1008261615 6:49372294-49372316 CAATAATGAAACAAATGGCCAGG - Intergenic
1008804882 6:55414934-55414956 GAAAAATCAAATTGTCGGCCAGG - Intergenic
1010917737 6:81641641-81641663 CAAAAAACCAAAACACGGCCGGG + Intronic
1011615553 6:89194693-89194715 CAAAAATCAAACAGAAATCCTGG + Intronic
1011773293 6:90699239-90699261 CAAAAATGAAACATATGGACAGG + Intergenic
1012753877 6:103198903-103198925 CAAAAAACAAACAAATGGGCCGG - Intergenic
1013102081 6:106995611-106995633 AAACAAACAAACAAACGGCCTGG - Intergenic
1013257382 6:108401435-108401457 CAAAAATTAGCCAGGCGGCCGGG - Intronic
1013549673 6:111195094-111195116 CTAAAATCAAAGACAAGGCCTGG - Intronic
1013953820 6:115817806-115817828 TAAAAATAAAAAAGAAGGCCAGG + Intergenic
1014052035 6:116965913-116965935 GAAAATTGAATCAGACGGCCGGG - Intergenic
1014130855 6:117830454-117830476 AAAAAATCAAACAGAAATCCTGG + Intergenic
1015397135 6:132747320-132747342 CAAAAATTAAAAACAAGGCCAGG + Intronic
1017731068 6:157316578-157316600 CAAAAATCAAGGTGAGGGCCAGG + Intronic
1018458944 6:163979324-163979346 AAAAAGTTAAACACACGGCCAGG + Intergenic
1019470191 7:1215548-1215570 CAAAAAGCAAAAACAAGGCCAGG + Intergenic
1019873701 7:3790511-3790533 AAAAAGTCTAACAGTCGGCCAGG + Intronic
1020160082 7:5763891-5763913 AAAAAATAAAACAGACGGCAGGG + Intronic
1020800720 7:12728924-12728946 CAAAAATAAAAAAGTCAGCCTGG - Intergenic
1021183810 7:17539186-17539208 CAAAATACAAAAAGATGGCCAGG + Intergenic
1021746929 7:23750333-23750355 CTAAAATTAAACAGACAGACAGG - Intronic
1022657988 7:32338706-32338728 CAAAAACCAAAGAGAAGGCCGGG + Intergenic
1022743236 7:33143262-33143284 AAAAAATTAAACATAGGGCCGGG - Intronic
1022932712 7:35137597-35137619 AAAAAATAAAACAGACAGCCAGG + Intergenic
1023403522 7:39808474-39808496 AAAAAATCATCCAGTCGGCCGGG + Intergenic
1025070998 7:55899056-55899078 CAAAAAACAAAAAATCGGCCAGG + Intronic
1025710885 7:63907831-63907853 AAAAAATCAAACAGAAATCCTGG - Intergenic
1026072022 7:67130376-67130398 CAAAAAACAAACAGATGGCTGGG + Intronic
1026265972 7:68796411-68796433 TCAAAAACAAACAAACGGCCAGG - Intergenic
1026285340 7:68957764-68957786 CAAAAAATAAAAAGAGGGCCAGG - Intergenic
1026689048 7:72536593-72536615 AAAAAAACAAAAAAACGGCCAGG + Intergenic
1026879430 7:73899515-73899537 CCAAAATCATACACTCGGCCGGG - Intergenic
1027394907 7:77744329-77744351 AAAAAGTCAAACAGTAGGCCAGG - Intronic
1027409322 7:77897975-77897997 AAAAAAAAAAACAGAAGGCCAGG - Intronic
1027642771 7:80757673-80757695 ATAAAATAAAAAAGACGGCCGGG + Intronic
1027946399 7:84750258-84750280 CAAAAATCAAACAGAATTTCTGG + Intergenic
1028153682 7:87405577-87405599 CAAAAATCAACCAGGCGTCGTGG - Intronic
1029068526 7:97876150-97876172 CAAAAATCATACTCAAGGCCGGG - Intergenic
1029133243 7:98349712-98349734 CAAAAAAAAAAAATACGGCCGGG + Intronic
1029173296 7:98645869-98645891 CAAAAATAAAAAAGACTGGCCGG - Intergenic
1029234404 7:99101642-99101664 AAAAAATGATACACACGGCCGGG + Intronic
1029379795 7:100205534-100205556 TAAAAATCAAATAGAGGGCCAGG + Intronic
1029781524 7:102739179-102739201 CAAAAATCAAGCAGTGGACCAGG - Intergenic
1029828632 7:103230364-103230386 AAAAAATAAAAGAGACAGCCGGG + Intergenic
1030044609 7:105483789-105483811 TAAAAAACAAAAAGATGGCCAGG - Intronic
1032147451 7:129396714-129396736 AAAAAACCAAACACACGGCCAGG - Intronic
1034155906 7:148955938-148955960 CAAAAAACAAACACCCGGCGCGG - Intergenic
1034784909 7:153916700-153916722 TAAAAATAAAAAAGAAGGCCGGG - Intronic
1035009209 7:155698071-155698093 TAAAAATTATACAGAAGGCCAGG + Intronic
1036250843 8:7161334-7161356 CAAAAATCATACTCAAGGCCGGG - Intergenic
1036366647 8:8126125-8126147 CAAAAATCATACTCAAGGCCGGG + Intergenic
1036374608 8:8189751-8189773 CAAAAATAAAAGTGACAGCCGGG + Intergenic
1036531066 8:9587695-9587717 CTAAAATCAAAGTGTCGGCCAGG - Intronic
1036603892 8:10289306-10289328 CAAAAATTAAAAAGAAGGCTGGG - Intronic
1036854934 8:12233396-12233418 CAAAAATAAAAGTGACAGCCGGG - Intergenic
1036876293 8:12475884-12475906 CAAAAATAAAAGTGACAGCCGGG - Intergenic
1037109463 8:15148368-15148390 CAAAAATCAAACTGACATCGAGG - Intronic
1037339240 8:17825075-17825097 CAAAAATGAAAGAGAAGGGCCGG + Intergenic
1037518600 8:19658436-19658458 CAAAAACCAAACAAGAGGCCGGG + Intronic
1037940503 8:22947627-22947649 TAAAAAGAAAACAGTCGGCCAGG - Intronic
1038654617 8:29438011-29438033 CAAAAATCAGACAGACGTGGTGG - Intergenic
1039060429 8:33567756-33567778 CAAAAAAGAAAAAGAGGGCCGGG - Intergenic
1039882756 8:41635865-41635887 AAGAACTCAAACAGAAGGCCGGG + Intergenic
1040055367 8:43052834-43052856 AAAAAAAGAAAAAGACGGCCAGG - Intronic
1040420165 8:47232079-47232101 CAGAAATGAAACACAGGGCCGGG + Intergenic
1042061792 8:64826067-64826089 CAAAGATCATTCAAACGGCCAGG - Intergenic
1042797054 8:72675845-72675867 CAAAAATCAGACTGCAGGCCAGG - Intronic
1043135057 8:76512358-76512380 GACAAAACAAACAGAAGGCCGGG + Intergenic
1043363752 8:79506648-79506670 GAAAAATTAAACAGAAGCCCGGG - Intergenic
1043459864 8:80448914-80448936 CAAAAATTTAAAAGTCGGCCGGG + Intergenic
1044228488 8:89746527-89746549 CAAAAATAAATCAGAGTGCCAGG + Intergenic
1044423635 8:92026820-92026842 TCAAAAACAAACAAACGGCCGGG + Intronic
1045124774 8:99077463-99077485 CAAAAATGAAAGAGCAGGCCAGG - Intronic
1045507221 8:102787399-102787421 CAAAAATACCACAGACAGCCGGG - Intergenic
1048814218 8:138316683-138316705 TAAAAATTAAACATACGGCCGGG + Intronic
1049260665 8:141637350-141637372 CAAAAATCTAACAATTGGCCAGG - Intergenic
1049959701 9:726662-726684 CAAAAATTAAAAATAAGGCCAGG + Intronic
1050270127 9:3934702-3934724 TCAAAATCAAACAGAAGGCTGGG - Intronic
1050327647 9:4512923-4512945 CAAAAATCAATTGGAGGGCCAGG - Intronic
1051385728 9:16506733-16506755 AAAAAACCAAACAAACAGCCTGG - Intronic
1052208039 9:25867342-25867364 AAATAAGCAAACAGAAGGCCAGG + Intergenic
1052446929 9:28575106-28575128 TAAAAATCAAACACCAGGCCAGG + Intronic
1052910449 9:33876618-33876640 AAAAAATCAATCATAAGGCCGGG + Intronic
1052914620 9:33915140-33915162 AAAAAATCAAATAGTTGGCCAGG + Intronic
1052940687 9:34129872-34129894 AAAAAATCAAACACACTGCTGGG + Intergenic
1053238196 9:36474844-36474866 GAAAAATCACACACAGGGCCGGG + Intronic
1053668301 9:40333626-40333648 CTAAAATCAAACACATGGACAGG - Intergenic
1053918107 9:42959920-42959942 CTAAAATCAAACACATGGACAGG - Intergenic
1054379443 9:64473678-64473700 CTAAAATCAAACACATGGACAGG - Intergenic
1054516311 9:66042667-66042689 CTAAAATCAAACACATGGACAGG + Intergenic
1054821706 9:69528213-69528235 CAAAAATTATACAGACTGCAAGG - Intronic
1055089151 9:72344903-72344925 TTAAAAACAAACAAACGGCCGGG - Intergenic
1055444696 9:76371019-76371041 AAAAAATCAAAGAAAAGGCCAGG + Intergenic
1055457753 9:76488796-76488818 CAAAAATGAAAAACTCGGCCAGG - Intronic
1055875872 9:80941034-80941056 CAAAAATTAGCCAGGCGGCCGGG + Intergenic
1056616686 9:88173905-88173927 CAAAAAATGAACAGACGGCCAGG + Intergenic
1056879334 9:90375747-90375769 GAAAAAGAAAAAAGACGGCCGGG + Intergenic
1057084709 9:92198725-92198747 CAAAAATAATAATGACGGCCAGG + Intergenic
1057115989 9:92522706-92522728 CACAGATCAAACAGACAGCTTGG - Exonic
1057240286 9:93401858-93401880 AGAAAATAAAACAGCCGGCCAGG + Intergenic
1058224851 9:102347186-102347208 TAAAAATAAAACAAACGGGCCGG - Intergenic
1059744480 9:117186833-117186855 CAAAAATTATAAAGAAGGCCGGG + Intronic
1060390510 9:123272712-123272734 AAAAAATCAAACAGACTGGTTGG + Intergenic
1060703281 9:125778255-125778277 CAAAAAAAAAAAAGAGGGCCAGG - Intronic
1061057298 9:128231096-128231118 TAAAAATCACACAGACGGCAGGG - Intronic
1061358008 9:130120909-130120931 TAAAAAACAAACAAACGGGCTGG + Intronic
1061364191 9:130162666-130162688 CAAAAAACAAAAAAACGGCCAGG - Intergenic
1061623942 9:131829768-131829790 CAAAAATCAATCACATGGCCGGG + Intergenic
1062604992 9:137342824-137342846 CAAGAATCACAGAAACGGCCAGG + Intronic
1185518261 X:717043-717065 TAAAAAACAAACAAAAGGCCAGG + Intergenic
1185529260 X:804542-804564 CACAAAACAAACAAAAGGCCAGG - Intergenic
1185731513 X:2465505-2465527 TGAAAAGAAAACAGACGGCCAGG + Intronic
1185837123 X:3355072-3355094 CTAAAATCAAAGTGTCGGCCAGG - Intergenic
1186068455 X:5791673-5791695 TAAAAATGCAACAGATGGCCAGG + Intergenic
1187338399 X:18400552-18400574 CAAAAATTAAAAAAACAGCCAGG + Intergenic
1187867587 X:23738160-23738182 TCAAAAACAAAAAGACGGCCAGG - Intronic
1188504693 X:30869353-30869375 CAAAAAACAAACAAAAGGCTGGG - Intronic
1189389856 X:40567186-40567208 CCAAAATCTAAAATACGGCCAGG + Intergenic
1189681881 X:43525639-43525661 TAAAAATCACAAAGACGGCCAGG + Intergenic
1189771287 X:44430170-44430192 AAAAAATCAAGCATAAGGCCAGG - Intergenic
1189780335 X:44507795-44507817 CAAAAAGGATACAGACAGCCAGG + Intergenic
1189787946 X:44576522-44576544 CAAAAAACAAACAAACTGGCTGG - Intergenic
1189791561 X:44610046-44610068 CAAAAATCAAACTTAAGGCCGGG - Intergenic
1190036199 X:47026961-47026983 GAAAAATGAAACATAAGGCCTGG + Intronic
1190193618 X:48297732-48297754 CAAAAATAAAACACACGGACGGG - Intergenic
1190312816 X:49129031-49129053 CAAAAAACAAAAAAAAGGCCGGG - Intergenic
1190660137 X:52646356-52646378 CAAAAATAAAAAACACGGACGGG - Intronic
1190767423 X:53487125-53487147 CAAAAAACAAAAACAAGGCCAGG - Intergenic
1190769935 X:53505788-53505810 AAACAAACAAACAAACGGCCAGG - Intergenic
1190859446 X:54330076-54330098 CAAAAAATAAAAACACGGCCAGG + Intronic
1190859762 X:54333067-54333089 CATGAATCACACAGAAGGCCAGG + Intronic
1190865049 X:54377407-54377429 CAAAAAACAAAAAAATGGCCGGG + Intergenic
1191056934 X:56251754-56251776 CAAAAATTAAAAATAAGGCCAGG - Intronic
1191206369 X:57837539-57837561 AAAAAATCAAACAGAAATCCTGG + Intergenic
1192096130 X:68213070-68213092 TAAAAATCAAATACACGGGCTGG + Intronic
1192456287 X:71278790-71278812 AAAAAAAAAAAAAGACGGCCGGG - Intergenic
1192744404 X:73924666-73924688 CAAAAATTAAATTAACGGCCGGG - Intergenic
1193123955 X:77851667-77851689 CAAAACTTAGCCAGACGGCCAGG - Intronic
1193172882 X:78357221-78357243 AAAAAATCAAATGGAAGGCCAGG - Intergenic
1194235797 X:91381923-91381945 CAAAAATGTAATTGACGGCCGGG + Intergenic
1195033975 X:100954121-100954143 CTAAAATCAAAATGACAGCCGGG + Intergenic
1195263725 X:103159990-103160012 CAAAAATTAAAAACATGGCCAGG + Intergenic
1195315022 X:103668896-103668918 CAAAAATGAAACATGCAGCCGGG - Intergenic
1195943658 X:110187056-110187078 AAAAAGTGAAACAGTCGGCCAGG + Intergenic
1196290687 X:113937176-113937198 AAAAAAACAAAAAAACGGCCGGG - Intergenic
1196825895 X:119739966-119739988 CAAAAATACAACCGACGGCCAGG + Intergenic
1197998021 X:132401320-132401342 CAAAAATTAAAAAGTAGGCCAGG + Intronic
1198644338 X:138789748-138789770 TAAAAAACAAACACACGGCCAGG + Intronic
1199042725 X:143132749-143132771 CAAAAATAAAACAAGAGGCCAGG + Intergenic
1199107811 X:143891854-143891876 CAAAAAGCAAACAGAAGCACTGG + Intergenic
1199732973 X:150655028-150655050 AAAAAATTAAACATATGGCCAGG + Intronic
1199781751 X:151067774-151067796 AAAAAATCAAAAAGTTGGCCAGG - Intergenic
1201689318 Y:16745270-16745292 TTAAAAACAAACAAACGGCCGGG - Intergenic
1201921371 Y:19236607-19236629 CAAAAATCAAGGAAACAGCCAGG - Intergenic
1202178738 Y:22121355-22121377 GAAACATCAAACAGAGGCCCAGG - Intergenic
1202212623 Y:22465039-22465061 GAAACATCAAACAGAGGCCCAGG + Intergenic
1202590158 Y:26474120-26474142 TAAAAATCAAATAGAATGCCTGG + Intergenic