ID: 1169103991

View in Genome Browser
Species Human (GRCh38)
Location 20:2978573-2978595
Sequence CTTCTTTCCTTGAAAACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 474}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169103991_1169103996 22 Left 1169103991 20:2978573-2978595 CCCTTTGTTTTCAAGGAAAGAAG 0: 1
1: 0
2: 4
3: 59
4: 474
Right 1169103996 20:2978618-2978640 GTCCCGGGACACCATTTTAGTGG 0: 1
1: 0
2: 0
3: 3
4: 30
1169103991_1169103993 -9 Left 1169103991 20:2978573-2978595 CCCTTTGTTTTCAAGGAAAGAAG 0: 1
1: 0
2: 4
3: 59
4: 474
Right 1169103993 20:2978587-2978609 GGAAAGAAGTTATAGCAAGTAGG 0: 1
1: 0
2: 2
3: 16
4: 195
1169103991_1169103994 6 Left 1169103991 20:2978573-2978595 CCCTTTGTTTTCAAGGAAAGAAG 0: 1
1: 0
2: 4
3: 59
4: 474
Right 1169103994 20:2978602-2978624 CAAGTAGGTATCTGTTGTCCCGG 0: 1
1: 0
2: 0
3: 7
4: 94
1169103991_1169103995 7 Left 1169103991 20:2978573-2978595 CCCTTTGTTTTCAAGGAAAGAAG 0: 1
1: 0
2: 4
3: 59
4: 474
Right 1169103995 20:2978603-2978625 AAGTAGGTATCTGTTGTCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169103991 Original CRISPR CTTCTTTCCTTGAAAACAAA GGG (reversed) Intronic
900615083 1:3561882-3561904 CTTGTTTTCTGGGAAACAAATGG - Intronic
900775828 1:4584884-4584906 CTGTTTTCCTTCAAAACAAGAGG - Intergenic
901693312 1:10988582-10988604 CTTTTTTCTTTGACATCAAATGG - Intergenic
904004281 1:27355576-27355598 GTTCCTTCCTGGAAACCAAAGGG - Intronic
904064651 1:27739892-27739914 CTTCTCTCCTTAAAACCCAATGG - Intronic
905152031 1:35937093-35937115 TTTCCTCCCTTGAAAATAAAAGG - Intronic
905984266 1:42263505-42263527 CTCCTTTCCTTTAAAGGAAAAGG + Intronic
906918721 1:50040567-50040589 CTTTTTTCCTTGGAAACACTGGG + Intergenic
907423823 1:54365793-54365815 CTTCTTTCCTTGAAATCTGGTGG + Intronic
907745551 1:57209554-57209576 CCTCTTACCTTGAAAAACAAAGG - Intronic
909034179 1:70578698-70578720 CTTCTTTCCTTGAATGAAAATGG + Intergenic
910126307 1:83846387-83846409 CATCTTCCCTTGAAAACAGCAGG - Intergenic
911381477 1:97120395-97120417 CAGCTTTCCTTGAAGACAAAGGG + Intronic
911554479 1:99326782-99326804 TCTCTTTCCTTTAAAACAATGGG + Intergenic
914970190 1:152302851-152302873 GATCTTTCCTTGAAAACAACAGG + Exonic
914977600 1:152380363-152380385 CTTCTTTCAGTGAAAACTCAGGG + Intergenic
916676457 1:167067829-167067851 TTTCTTTCCTTTAAAAAAAATGG - Intronic
917188836 1:172391686-172391708 CTTCCTTCTCTGAAAACAAAGGG - Intronic
918229482 1:182515003-182515025 CTTCTTTCAGTGAAAACTCAGGG + Intronic
920859876 1:209697053-209697075 CTTCATGACTTGAGAACAAATGG + Intronic
921025469 1:211276375-211276397 GCTCTTTCCATGAAAACTAAAGG - Exonic
921482733 1:215681498-215681520 CTTCTTTCCTTGATGAACAAGGG + Intronic
922267523 1:223998314-223998336 CTCTTTATCTTGAAAACAAAGGG + Intergenic
922587758 1:226748452-226748474 CTCCTTTCCCTTACAACAAAGGG + Intergenic
923001742 1:230011803-230011825 CTTCTTTCCTTGAACAAAGCAGG + Intergenic
923122956 1:231010547-231010569 CTTCTTCCCTTGGAGAAAAAAGG - Intergenic
923190716 1:231617807-231617829 CTTCCTTCTTTGAAAACAAAGGG - Intronic
1062847540 10:718889-718911 CTTGTTTCAGTGAATACAAATGG + Intergenic
1062974094 10:1671029-1671051 ATTCTTTCTTTGAAAAGAAAAGG + Intronic
1063266749 10:4459525-4459547 GTTCTTTCCCTAAAAACAAGAGG - Intergenic
1063280393 10:4623120-4623142 CTTTTCTACTTGAAGACAAATGG - Intergenic
1063760428 10:9068220-9068242 CTTCCTTTCTTGGAAAGAAAAGG - Intergenic
1063977119 10:11426457-11426479 CTTCTTGCCATGAAACCAAATGG + Intergenic
1064600623 10:16988654-16988676 GTTCTTACCTTGAAAAGAAATGG - Intronic
1064726957 10:18289984-18290006 CTTCTCTCACTGAAATCAAATGG - Intronic
1064861213 10:19827978-19828000 ATTGTTTCCTAGGAAACAAATGG + Intronic
1064950983 10:20849990-20850012 CTATTTTCATTGAAAAAAAAAGG + Intronic
1065312418 10:24429348-24429370 CTTTTTTCCTTGTAAACTGAAGG - Intronic
1065824357 10:29556478-29556500 CTTCTATCCCTGAACACAAAGGG - Intronic
1066312564 10:34211942-34211964 CTTCTTTCCATCAAGAGAAAAGG + Intronic
1066320885 10:34302742-34302764 CTTCTTTCTCTGAACTCAAAGGG - Intronic
1066726189 10:38397294-38397316 CTCTTTATCTTGAAAACAAAGGG - Intergenic
1067992075 10:51225514-51225536 CTTCATTTCCTCAAAACAAAGGG + Intronic
1068030062 10:51695383-51695405 CCTTTTTCATTAAAAACAAAAGG + Intronic
1068106382 10:52622077-52622099 CTCCTTTCCTTAAAAGCAAGGGG + Intergenic
1068478659 10:57562138-57562160 CTTCCTTTCTTCCAAACAAATGG + Intergenic
1068782604 10:60937721-60937743 CTTTTTTTCTTGAACACAACAGG - Intronic
1069380361 10:67838031-67838053 CTTCTTCCCTCGGAAACAAGAGG + Exonic
1069582915 10:69577519-69577541 CTTCTTTTATTGAAAGCATATGG + Intergenic
1070496232 10:77026187-77026209 TTTCTCTCCTTGGAACCAAAAGG + Intronic
1072867234 10:99076844-99076866 GTTCTTTAAGTGAAAACAAAAGG - Intronic
1074044457 10:109824484-109824506 GTTCTTTACTGGAACACAAAAGG + Intergenic
1074251576 10:111756025-111756047 CTTATTTACTTAGAAACAAATGG + Intergenic
1075699434 10:124459622-124459644 CTACTGGCCTTGAATACAAAGGG - Intergenic
1077733280 11:4759544-4759566 TTTATTACCTTGAAAATAAAAGG - Intronic
1077774639 11:5257918-5257940 CTTGATTCCTTGATATCAAAGGG + Intronic
1077905784 11:6532429-6532451 CTTTAATCCTTAAAAACAAAAGG + Intronic
1079294626 11:19221918-19221940 CTTCCAGCTTTGAAAACAAATGG + Intergenic
1079346325 11:19655996-19656018 CTTGTCTCTTTGAAAACCAAGGG - Intronic
1079635818 11:22739213-22739235 CTTCTGGCCTGGAAGACAAATGG + Intronic
1079827571 11:25216596-25216618 CATTGTTCATTGAAAACAAAGGG - Intergenic
1079874698 11:25842226-25842248 TTTCTTTCCTTTAAAATAATGGG - Intergenic
1080400679 11:31932840-31932862 TTCCTTTCTTTGAAAAGAAATGG + Intronic
1080406367 11:31983379-31983401 CTTCCTTCCTTGAAGATGAATGG + Intronic
1080711310 11:34750287-34750309 CATCTCTCTTTGAAAATAAATGG - Intergenic
1080747892 11:35125579-35125601 CTTCTTTTCTTGACAAAATAGGG - Intergenic
1082180370 11:49110285-49110307 GATCTTCCCTAGAAAACAAAAGG - Intergenic
1083552390 11:63599698-63599720 TTTTTTTCCTGGAAAACAATGGG - Intronic
1083861089 11:65420448-65420470 CTTTTGTCCTTGAAAACCCAGGG + Intergenic
1084183632 11:67458777-67458799 CTTCTATCCCTGAAAACACCTGG + Exonic
1084470897 11:69358460-69358482 GTTCTTTCCTTGAAGAAAATGGG + Intronic
1084819217 11:71672969-71672991 CTTCTCACCTTAAACACAAATGG - Intergenic
1085559785 11:77460747-77460769 CTTCTTTCATTGTAAAAGAAGGG + Intronic
1086685123 11:89724559-89724581 GTTCTTCCCTAGAAAACAAAAGG + Intergenic
1087235830 11:95717666-95717688 CTTCTTTGGTAGAAAATAAAAGG - Intergenic
1087539002 11:99491123-99491145 CTTCTTTGCTTGGAAACTAAAGG - Intronic
1088213550 11:107482683-107482705 CCTCTTTCCATGGAAACAAATGG - Intergenic
1088312239 11:108472080-108472102 CCTCTTTCTTAAAAAACAAAAGG + Intergenic
1088704149 11:112446596-112446618 ATTTTTTCCATGAAAACACATGG - Intergenic
1089072869 11:115714866-115714888 GCTCTTTCCTTGAAAACAACAGG - Intergenic
1089217571 11:116844050-116844072 CTCCTTTCCCAGAAAAAAAAAGG + Intronic
1089751181 11:120652385-120652407 CCTCTCTCCCTGACAACAAATGG - Intronic
1090132707 11:124161293-124161315 CTTGTTTACTGGAAAACAAGGGG - Intergenic
1090738077 11:129629961-129629983 CATCTTTCCTTCCATACAAAGGG + Intergenic
1090777551 11:129978699-129978721 CTACTTTCCTTGTGCACAAAGGG + Intronic
1091847287 12:3667167-3667189 TTTCTTCACTTGAAAACCAAAGG - Intronic
1092800819 12:12164404-12164426 CTGCTCTCCGTGAAAACAAAAGG + Exonic
1093569779 12:20653839-20653861 CTTCTTTACTTGACAGCTAAAGG - Intronic
1093707173 12:22287283-22287305 TTTCTCTCCTAGGAAACAAATGG - Exonic
1093810872 12:23491007-23491029 GTCCTTCCCATGAAAACAAATGG - Intergenic
1095261979 12:40107365-40107387 CTTTTTTCCTTTCAGACAAAAGG + Intergenic
1095613036 12:44154453-44154475 GTTCTTTCAATGAAAACAGATGG - Intronic
1095703516 12:45215251-45215273 ATGCTTTCCTGGAAACCAAAGGG - Intergenic
1096922808 12:55107071-55107093 GTTCCTACCTTGAAAAAAAAAGG + Intergenic
1097732191 12:63141169-63141191 CTACTTTACTTGAAAATTAAAGG + Intergenic
1098077148 12:66744262-66744284 CTTCTATTCCTGAAAAAAAAAGG + Intronic
1098389689 12:69956479-69956501 CTACTTTCCATGAAGATAAATGG + Intronic
1099883849 12:88502647-88502669 CTTTTTTCCTCCTAAACAAATGG + Intronic
1100005252 12:89887891-89887913 CTTCTGTACTTGAGAACCAAAGG + Intergenic
1100036263 12:90256046-90256068 CTTCATTCGTTGACAACTAAAGG - Intergenic
1101217043 12:102595397-102595419 CTTCTTTCAGTGAAAACTCAGGG + Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1102540567 12:113616330-113616352 CTGCTTTCCTAGAAAAGAACTGG + Intergenic
1102726673 12:115071589-115071611 CTTCTTTCTCCCAAAACAAAAGG + Intergenic
1102967844 12:117141736-117141758 CTCCTTTCCTAGAACACAACTGG + Intergenic
1103645690 12:122390729-122390751 GTTCTTGACTTGAAAAAAAATGG - Intronic
1103770590 12:123320093-123320115 CCTCTTTCCTTGAAGACACTTGG + Intronic
1104558716 12:129824983-129825005 CTTCGTTCCTTTAACACAGATGG + Intronic
1104737000 12:131141257-131141279 TTTCATTCATTGGAAACAAAAGG - Intronic
1105310220 13:19200619-19200641 CCCCATTCCTTGAAGACAAATGG + Intergenic
1105539169 13:21299591-21299613 GTTTTTGCCTTGAAAAAAAAAGG + Intergenic
1105677323 13:22686035-22686057 TTTCCTTTGTTGAAAACAAATGG - Intergenic
1106209923 13:27632484-27632506 CTTGGTACCTGGAAAACAAATGG - Intronic
1106306993 13:28521463-28521485 CTTTTTTCTTTCAAAACATATGG - Intergenic
1107180810 13:37456637-37456659 CTTCTTTCCTGGAAAACAGTAGG - Intergenic
1108165362 13:47687519-47687541 CATCTTTCCTTAATATCAAAAGG - Intergenic
1108966676 13:56314953-56314975 CTTGTTACCTTGACAACAACAGG - Intergenic
1108969418 13:56354057-56354079 TTTCTTACCTTTAAAACAACAGG - Intergenic
1109763093 13:66856876-66856898 CTTTTTACCTTGAAAAGGAATGG + Intronic
1109864125 13:68239773-68239795 CTACTTTCCTTGAAAATCAATGG + Intergenic
1110543715 13:76733812-76733834 CAACATTCCTTGAAAACAAATGG + Intergenic
1111619936 13:90712231-90712253 CTTCTTTGCTTAAAAAACAAGGG - Intergenic
1111792217 13:92871847-92871869 TTTCTTTCATTGAATATAAAAGG + Intronic
1112629424 13:101144354-101144376 CCTGTTTGCTTGAAAATAAAAGG + Intronic
1112717915 13:102207590-102207612 CATCTGTCCTTGAGAAAAAAGGG + Intronic
1112866196 13:103902281-103902303 CTTCTTTCTTTGTAGACCAAAGG + Intergenic
1113181762 13:107636481-107636503 ATTTTTTCCTTGAAAATAAATGG - Intronic
1113897019 13:113770974-113770996 TTTCTTTCCTTTTAAAAAAATGG + Intronic
1114369343 14:22068610-22068632 CTTCTTGTATTTAAAACAAAGGG + Intergenic
1114714426 14:24809192-24809214 TCACTTCCCTTGAAAACAAATGG + Intergenic
1114911492 14:27204531-27204553 CTTCTGTCCCTGAGAACAAGTGG + Intergenic
1115203380 14:30875736-30875758 CTACTTTCAAGGAAAACAAACGG - Intronic
1115900244 14:38139036-38139058 TTTCTTTCCTTAAAAAATAAGGG + Intergenic
1116994489 14:51308267-51308289 CTTCTTTCCTGGCACACAATAGG - Intergenic
1117694710 14:58348540-58348562 CTTCTTTCCTTTAATATATAAGG + Intronic
1117718067 14:58600995-58601017 TTTTTTTTCTTGAAAACTAAAGG - Intergenic
1118519178 14:66562008-66562030 TCTCTTTCTTTGAAAACAATTGG + Intronic
1118996753 14:70843466-70843488 CTTCTTTCCTCCAATAAAAAGGG - Intergenic
1119230678 14:72976965-72976987 CTTTTTTCCATGAAAGGAAAAGG + Intronic
1121876229 14:97456079-97456101 CTTCTTTCCTGGCAAACAGCTGG + Intergenic
1121895852 14:97646866-97646888 CTTTTTTCCTGCAAAACAAATGG + Intergenic
1124453065 15:29815914-29815936 TTTTTTTCCTTCAAATCAAACGG + Intronic
1124826573 15:33102276-33102298 CTTCTTTCATTGAAAATTAAGGG - Intronic
1125345348 15:38713553-38713575 TTTCTTTCCAGGAACACAAAGGG + Intergenic
1126687260 15:51259245-51259267 TTTTTTTCCTTGAAAAATAATGG + Intronic
1127931399 15:63599814-63599836 CCGCTTTCCCTGGAAACAAACGG - Intronic
1128304561 15:66589464-66589486 TTTCTTTTCTTGAAACGAAAGGG - Intronic
1128591181 15:68898941-68898963 CTTCTTCCCTGGAAAATTAAAGG - Intronic
1129865205 15:78902207-78902229 CCTTTCTCCTTTAAAACAAATGG + Intergenic
1131019533 15:89086936-89086958 CATGTTACCTTGAAAAAAAAAGG - Intergenic
1134316699 16:13125453-13125475 CTTCTTTCCTGGCAAACGAGGGG + Intronic
1135764845 16:25168616-25168638 TTTTTTTCCTTGAAGACAGATGG + Intronic
1135828332 16:25750391-25750413 CTTCTTGCCTTGAACACAGTTGG - Intronic
1136360835 16:29778707-29778729 CTTCTTTCCTTGAGACCAGGTGG + Intronic
1137609815 16:49810820-49810842 TTTCTCTCCTTCAACACAAATGG + Intronic
1137663890 16:50236499-50236521 CTTTTATCCTTTAACACAAATGG + Intergenic
1137893215 16:52183880-52183902 CTTCTTTCCTGCAATGCAAAAGG + Intergenic
1138413301 16:56856360-56856382 CTTTTTTTCTTGAAAGCAATAGG - Intergenic
1138932442 16:61677211-61677233 CGTCTTTCCCAGAAAACACAGGG + Intronic
1139041416 16:63003402-63003424 AGTCTTTCCTTTAAAATAAAAGG - Intergenic
1140634848 16:76900020-76900042 TTTTTTTCCATGAATACAAATGG + Intergenic
1142902361 17:3020016-3020038 CTTCATTCCTCGCAAACAAATGG - Intronic
1144234388 17:13243412-13243434 CTTTTTTCTTTGAAAACACATGG + Intergenic
1144235070 17:13252548-13252570 CTTCTCTTCTTATAAACAAAAGG + Intergenic
1146099837 17:29970453-29970475 CTTGTCTACTTGAAAAAAAATGG + Intronic
1146132320 17:30289163-30289185 CTTATTTCATTGCAAAAAAATGG + Intronic
1146981354 17:37164717-37164739 TTTCATTCCTGAAAAACAAAAGG - Intronic
1148498498 17:48070579-48070601 CTTCGTTACTGGAAAAGAAAGGG + Exonic
1148590035 17:48809336-48809358 CTTCCTTCCTTGAAGGTAAACGG + Intronic
1148989535 17:51653386-51653408 CTTCTGTCCTAGAAAGAAAAAGG - Intronic
1149264835 17:54916594-54916616 CTTCTTAACTTGGCAACAAAGGG - Intronic
1149284282 17:55144758-55144780 CTTCTTTCCCTGATACCAGATGG - Intronic
1150215097 17:63463182-63463204 CTTCTGTCCTTGAAAACGTTCGG + Intergenic
1151160904 17:72164985-72165007 CTTCTTTCCTTCAATGTAAATGG + Intergenic
1153247307 18:3085117-3085139 CATCTTTCTTGGAAAACTAAGGG + Exonic
1153577232 18:6534655-6534677 CTTCTTTCTCTGAAAACTCATGG - Intronic
1154049183 18:10937260-10937282 GTTCTTTCCTAGCAAACACAAGG + Intronic
1155306867 18:24487166-24487188 CCTCATTCCTTAGAAACAAATGG + Intergenic
1156210246 18:34932002-34932024 CTTTTTACAGTGAAAACAAAAGG - Intergenic
1156730093 18:40183153-40183175 CTTCTTTTTTTTAAAAAAAAAGG - Intergenic
1156907373 18:42370093-42370115 TTTATTTCCTTCAAAACCAAGGG + Intergenic
1157642362 18:49230273-49230295 CTTCTTCCCTTGAATACAGTTGG - Intronic
1157775295 18:50389990-50390012 TTTATTTACTTTAAAACAAATGG + Intronic
1157969757 18:52253056-52253078 CTTTTTTCCCTGAAAAAGAAGGG - Intergenic
1158390981 18:57044666-57044688 GTTCTTTCCTTGAAAATCAGAGG + Intergenic
1158409674 18:57194340-57194362 CTCCTTTCATTAAAAAGAAAAGG - Intergenic
1158577378 18:58650084-58650106 CTTCTTTCCTAGGAAAGAACTGG + Intergenic
1159091198 18:63851465-63851487 CTTCTTTTTATGAAAACAATAGG + Intergenic
1159602420 18:70441323-70441345 CTTTGTTCCATGAAAACAAGAGG - Intergenic
1161206764 19:3045502-3045524 CTTCTTTCTCTTAAACCAAATGG + Intronic
1161221876 19:3121657-3121679 CTTCTTTTCTTCATCACAAAAGG + Exonic
1164143389 19:22494092-22494114 CTTCTTTCAGTGAAAACTCAAGG - Intronic
1164477767 19:28588360-28588382 CTTTTTCCCTTCAAAACAGAAGG - Intergenic
1164969910 19:32522961-32522983 TTTCTTTGCTTGAAAACTAAAGG - Intergenic
1165093758 19:33399775-33399797 CTTTTTTCCTTGAACACTGAGGG + Intronic
1165389266 19:35529023-35529045 TTTTTTTCTGTGAAAACAAAAGG - Intergenic
1166620342 19:44293073-44293095 GTTCTAACCATGAAAACAAAAGG + Intronic
925886654 2:8399515-8399537 CTTCCTTACTTGGAAACAAATGG - Intergenic
926849617 2:17180637-17180659 CTTTTCTCCTTGAAATCAAAGGG + Intergenic
927185976 2:20482801-20482823 TTGCTTTCCTTAAAAAGAAAAGG - Intergenic
927669907 2:25060457-25060479 TTTCTTTCCTGAAAAAAAAATGG - Intronic
928128309 2:28630980-28631002 CTCCCTTCATTAAAAACAAAAGG + Intronic
928856633 2:35810363-35810385 CTTCTTTCCTTTTAAAGAAATGG - Intergenic
929562702 2:42965709-42965731 CTTCCTTCCGTGCAAACAAAAGG - Intergenic
929846222 2:45531128-45531150 CTGCTTTCCTTGAAAAGAAAAGG + Intronic
929966051 2:46537513-46537535 CTTCTTTCCTGGAAGCAAAATGG - Intronic
930226473 2:48799354-48799376 ATTGTTACCTTGAAACCAAATGG - Intergenic
930600340 2:53435626-53435648 TTTTTTTCTTTGAAAAGAAAGGG + Intergenic
931127507 2:59294378-59294400 TTTCTTTCCTTGAAAAATTAAGG + Intergenic
931159535 2:59673592-59673614 CTTCTTTCCTATAAATGAAATGG + Intergenic
931163948 2:59725121-59725143 CTTCTTCCCAGGAAAACATATGG + Intergenic
931928816 2:67105921-67105943 CTTCTACCCTTGATAACAATCGG + Intergenic
932018431 2:68057461-68057483 CTTTTTTTCTTCAAAATAAATGG - Intronic
932195443 2:69779156-69779178 CTTATTTCATTAAAAAAAAAAGG - Intronic
933145542 2:78847716-78847738 CTTGTTTGCTTGAAAAAAACTGG + Intergenic
933218968 2:79666193-79666215 CTTCTTTCCCAGAAAAAAACAGG + Intronic
933491531 2:82991195-82991217 CTTCCTTGCTTGAAGCCAAAGGG - Intergenic
935466800 2:103408112-103408134 CTTCTTTCCATGTAAAGATAGGG - Intergenic
935618045 2:105105367-105105389 CTGGTTTCCTTGAAAATGAATGG + Intergenic
936964151 2:118110679-118110701 TTTCTTTCATTGAAAAAAATAGG - Intronic
939020171 2:136949211-136949233 CTTGCTTCTTTGGAAACAAATGG + Intronic
939418252 2:141929473-141929495 CTTCTGTCTTTTAAAAAAAATGG - Intronic
939946249 2:148414952-148414974 ATACTGACCTTGAAAACAAATGG - Intronic
940070767 2:149684957-149684979 CATCCTTCTTTGAAAAGAAATGG - Intergenic
940100383 2:150030952-150030974 CTTCTTTCATTTAAGAGAAATGG - Intergenic
940794102 2:158058753-158058775 GTTCGTTCCCTCAAAACAAATGG - Intronic
941456848 2:165719318-165719340 CTCATTTTCTTGACAACAAAAGG + Intergenic
941636434 2:167940033-167940055 CATCTTTCCTGGAAACCAAATGG - Intergenic
941809694 2:169743605-169743627 TTTCTGTCCTTTAAAAGAAAAGG + Intronic
942340901 2:174945409-174945431 CCTCTTCCCCTAAAAACAAAAGG + Intronic
942401621 2:175609303-175609325 TTTCTTTCCTTGGGAACAAACGG - Intergenic
942859451 2:180591509-180591531 CTGCTTTCCTTGGCTACAAAAGG + Intergenic
943697071 2:190948215-190948237 ATTCTTCCCATGAAAACAAAAGG - Intronic
945643829 2:212464749-212464771 TTTCTTTCCCACAAAACAAATGG + Intronic
945847954 2:214970006-214970028 TTTTTTTCCTTGAAGCCAAAGGG - Intronic
946133381 2:217625097-217625119 CTTCTTGCATAGAAAACAAGGGG + Intronic
946474966 2:219998180-219998202 CTCATTTACTTGAACACAAATGG + Intergenic
947236606 2:227948187-227948209 TTTCTTTCATGGAAAACAACAGG - Intergenic
947389193 2:229622267-229622289 GTTGTTTCCTGGAATACAAAGGG - Intronic
947508980 2:230733421-230733443 ATTCCTTCCTTGAAACTAAAAGG + Intronic
947765455 2:232634418-232634440 CTTTTATCTTTTAAAACAAAAGG + Intronic
947844302 2:233231851-233231873 CTGCTTTCCTGGAAAATAAGTGG - Intronic
1169103991 20:2978573-2978595 CTTCTTTCCTTGAAAACAAAGGG - Intronic
1169792120 20:9422240-9422262 CTTCTTTCCTTAACAAAATAGGG + Intronic
1171948804 20:31402583-31402605 ATTCTTCCACTGAAAACAAAAGG + Intergenic
1172642023 20:36446267-36446289 TTTCTTTCCTTGTAAAATAAAGG + Intronic
1173664129 20:44753210-44753232 CTTCTTTCTTTGAAGCCTAATGG - Intronic
1174701999 20:52618453-52618475 ATGCTTTCTTTAAAAACAAAAGG + Intergenic
1176078232 20:63258884-63258906 GTTCTTCCTTTGAAAAAAAAGGG + Intronic
1176882508 21:14214946-14214968 CTTAATTCTTGGAAAACAAAGGG - Intergenic
1177190022 21:17840494-17840516 CATCTTTCCCTGAGTACAAAAGG - Intergenic
1178002088 21:28173516-28173538 CTTCTTTCCTTTAAAATGCAGGG + Intergenic
1178124498 21:29502273-29502295 CTTCTTTCCTTGAACATGAAAGG - Intronic
1179163347 21:38915841-38915863 CTTTAATCCCTGAAAACAAAAGG - Intergenic
1179386939 21:40952253-40952275 CCTCTTTGCTTGATAACAGAAGG - Intergenic
1181847133 22:25719925-25719947 CTTCTTTCTTTTCAAAGAAATGG - Intronic
1182852537 22:33488029-33488051 CCTCTTTTCTGGGAAACAAATGG - Intronic
1183383088 22:37500273-37500295 CTTCTGTCCTTGCAAAGAGAGGG - Intronic
949460147 3:4283270-4283292 CTTGTTTCTTTTAATACAAATGG - Intronic
951694977 3:25437021-25437043 ATTCTTGTCTTGAAAACATATGG + Intronic
951929770 3:27952246-27952268 CTTCTTTCCTTCAAGGCAGAAGG + Intergenic
952594389 3:34998391-34998413 TTTCTGTCATTGAAAACATAAGG - Intergenic
952637893 3:35554031-35554053 CTTCTTTCCTTGAAGCCATCAGG - Intergenic
952743058 3:36752548-36752570 CCTGTTTCATTAAAAACAAAAGG + Intergenic
953095236 3:39768301-39768323 TTACTCTACTTGAAAACAAAGGG - Intergenic
953719290 3:45341239-45341261 CTGCCTTCCTTGAAACCAAAGGG - Intergenic
954058400 3:48047698-48047720 CTTGTTTCCTTGTAAACACATGG + Intronic
956889967 3:73603351-73603373 TTCCTTTCCTTAAAATCAAAAGG + Intronic
957144460 3:76405574-76405596 CTTCTTTGCTTAAAAACAGCAGG + Intronic
957356074 3:79088598-79088620 TTTCTTTACTTAACAACAAAAGG + Intronic
957687431 3:83520209-83520231 TTTCTTTCCTTCAAAATATAAGG + Intergenic
958459171 3:94372245-94372267 CTTCTTTCCATGAACCCAAAAGG + Intergenic
958632547 3:96701536-96701558 CTTCTTTCAATGAAAACTCAGGG - Intergenic
958740591 3:98065770-98065792 CATATTACCTTGAAAAGAAAAGG + Intergenic
960572465 3:119198627-119198649 CTTCTGTCCATGAAAACCAGAGG - Intronic
961425050 3:126838494-126838516 CTTCCTTCATTGACATCAAATGG - Intronic
962069931 3:132022890-132022912 CTTGTTTCCATAAAAATAAAAGG + Intronic
962183696 3:133235664-133235686 CTTCCTGCCTGGAAAACATAAGG + Intronic
963398200 3:144760101-144760123 CTTCTTACTATGAAAAAAAAAGG - Intergenic
964043760 3:152296903-152296925 TTTCTGTCCTTAAAAACATATGG + Intronic
964090510 3:152870892-152870914 ATGCTATCCTTGCAAACAAAAGG + Intergenic
965239235 3:166173257-166173279 CTTCTTTACTTGAAAACTACTGG - Intergenic
965250805 3:166342115-166342137 GTTCTTTCCTTTAAAGCAGAAGG - Intergenic
965375033 3:167912218-167912240 CTTCTTTGCTTAAAAAGCAAAGG - Intergenic
965488560 3:169308753-169308775 CTTCTTTCCTTTTTAAAAAAGGG + Intronic
965512699 3:169586163-169586185 CTACTTTACTTGCAAAGAAATGG - Intronic
966274904 3:178153600-178153622 ATTTTTTCTTTTAAAACAAATGG - Intergenic
966514637 3:180805097-180805119 CTTCTTTCCAAGAAGACAAAGGG - Intronic
967383819 3:188889988-188890010 TTTTTTTCCTTGGAAACAAATGG + Exonic
967387404 3:188925334-188925356 CTTCTTTTCGTCAAACCAAAGGG + Intergenic
967546723 3:190738744-190738766 CTTCATTTCTTGAAGCCAAAGGG - Intergenic
970752648 4:19383376-19383398 CTTCTTCACTTTAAAACATAAGG + Intergenic
970905833 4:21215260-21215282 CTTCATTAATTGAAAAAAAAAGG - Intronic
971012450 4:22453394-22453416 TACCTTTCCCTGAAAACAAAAGG + Intronic
971041611 4:22759165-22759187 TTTCTTTAATTGAAAATAAAAGG + Intergenic
971085397 4:23269069-23269091 TTTCTTTCATGGAAAAAAAAGGG + Intergenic
971624515 4:28901266-28901288 ACTCTTTTCTTGAAAATAAATGG + Intergenic
971768387 4:30864321-30864343 ATTCCTTCCTTGAAAAAATAGGG + Intronic
971941134 4:33217093-33217115 GTGCTTTCCTTGAAGACAAAGGG - Intergenic
972919673 4:43922735-43922757 CATGTTTCCTTGGAAACAATAGG + Intergenic
973008156 4:45039357-45039379 CTTTTTTCATTGAAAATACAGGG + Intergenic
973164946 4:47065297-47065319 TTTCTTCCCTTGAACCCAAATGG + Intronic
973938225 4:55873574-55873596 CTTCTTGCCTTGTAAACTAATGG + Intronic
974298700 4:60037326-60037348 TTTCTTTCAATGAAAACAAGAGG - Intergenic
974348567 4:60714905-60714927 TTTCTTTATTTCAAAACAAATGG - Intergenic
974425865 4:61742801-61742823 CTGATTTCCCTGAAAACAAATGG + Intronic
976812924 4:89116145-89116167 TTTCTTTCATTGAAAACTGAAGG + Intergenic
978174394 4:105711452-105711474 CTTCTTTCCATGAAAGGTAAAGG - Intronic
978194825 4:105958887-105958909 CTTCTTTCCATAAGACCAAAGGG - Intronic
978850012 4:113323641-113323663 CCTTATTCATTGAAAACAAATGG - Intronic
978881488 4:113708690-113708712 TTTCTTCCCTTCAAAATAAAAGG + Intronic
979970916 4:127134179-127134201 TTTCTTTCCTTTAATATAAATGG + Intergenic
980630213 4:135421753-135421775 CTTGTTTCCTTAAAAATAAAAGG + Intergenic
980723559 4:136728037-136728059 GTTCTTTCCTTCAATACAATTGG + Intergenic
981469051 4:145108715-145108737 CTTCTCTCCTTGTAAGTAAATGG + Intronic
982041349 4:151399860-151399882 CTACTTTCCTTTAAAAAAAATGG + Intergenic
982724808 4:158894930-158894952 CTTTTTACCTTGAAAATAACAGG + Intronic
982956080 4:161768316-161768338 CTACCTTCCTTGAAAACGAATGG - Intronic
982961890 4:161849610-161849632 CTTCTTTGCTTAAAAATGAATGG + Intronic
983696038 4:170532398-170532420 CTTCTTTTCTTAACAACAATGGG + Intergenic
983781960 4:171680006-171680028 CTTCTTTCATTAATAACTAATGG + Intergenic
984609969 4:181826930-181826952 CTTCTTTCCTGGGAAAGAAGAGG - Intergenic
985028314 4:185761815-185761837 CTTTTATCTTTGAAAACACAGGG + Intronic
985077335 4:186229014-186229036 CTTTTTTCCTGGAAAAAAAAAGG - Intronic
987183295 5:15388163-15388185 CTTCTTTCTTGTAAAACAAAGGG - Intergenic
987278994 5:16393370-16393392 CTTCTTTACTTGAAGACAGCAGG + Intergenic
987866037 5:23540364-23540386 CTTTGCTCCCTGAAAACAAAAGG - Intergenic
988529596 5:32016061-32016083 CTTCTTTCCTTGTAAGAAACAGG - Intronic
988923152 5:35962992-35963014 CTTCTTTCAATGAAAACTCAGGG + Intronic
989479550 5:41914344-41914366 CTTCTTTAGATGAGAACAAAAGG - Intronic
991180626 5:63747001-63747023 GTTCTTTCCTTCAAATAAAAAGG + Intergenic
991273601 5:64816474-64816496 CTTCCTTCCTTTAAAAAAGACGG - Intronic
991613597 5:68473222-68473244 CTTTGTTCTTTGAGAACAAAGGG + Intergenic
992098826 5:73386556-73386578 CTTCTTACCTTTAAAATTAAGGG - Intergenic
992134604 5:73731452-73731474 ATTCTTTCCTTAAAACCAAATGG - Intronic
992632277 5:78693150-78693172 TTTCTCTACTGGAAAACAAATGG + Intronic
992928099 5:81611286-81611308 TTTCTTTCCTTCATATCAAAGGG + Intronic
993047017 5:82879192-82879214 ATTCTATCCTTCAAAACTAAAGG - Intergenic
993530050 5:89013226-89013248 CTTCTATCCTTGAATCCCAAGGG + Intergenic
993582272 5:89677500-89677522 CTTCTTTCCTTCAAGGCAACAGG - Intergenic
994110074 5:95992413-95992435 TTTTTTTCCTTGAAAACCCATGG + Intergenic
994752018 5:103749950-103749972 CTTCTTTCTCAGAAAAAAAATGG - Intergenic
995338034 5:111025200-111025222 TTTGTTTCCTTGCACACAAATGG - Intergenic
996319280 5:122196090-122196112 CTTATTTCCATGAGAACAAGGGG - Intergenic
996882201 5:128312164-128312186 TTTCTTTAATTAAAAACAAATGG - Intronic
996901698 5:128549712-128549734 CTGTTTTCTTTGAAAACACATGG + Intronic
997247892 5:132366717-132366739 CTTCATTCCTTGACATCACATGG + Intergenic
997286081 5:132679614-132679636 CTTCTTTCCAGGAGGACAAATGG - Intronic
997916914 5:137936061-137936083 CTTCTCACCTTGTAAGCAAATGG - Intronic
999161033 5:149499286-149499308 CTTTATTCCTTAAAAAAAAAGGG + Intronic
999642870 5:153689357-153689379 CTTTTTTCCCTGAGAGCAAAAGG - Intronic
999837213 5:155387179-155387201 CTTATTACTTTGATAACAAATGG + Intergenic
1000026707 5:157364795-157364817 CTTCTTTCATTGAGAAGAATTGG - Intronic
1000311054 5:160045129-160045151 CTTCTTTCTCTGTAACCAAATGG + Intronic
1000368534 5:160512837-160512859 CTTCTTGCCTGGACTACAAATGG + Intergenic
1000417247 5:160995861-160995883 CTTCCTTCCTTTAAATCAACAGG + Intergenic
1000611719 5:163382400-163382422 TTTTTTTCCTTGCAATCAAAAGG + Intergenic
1000744576 5:165017063-165017085 CATCTTTCCTTGTAAATCAAAGG + Intergenic
1000753133 5:165121985-165122007 CTGCTTTCCTTTAAAAACAAAGG - Intergenic
1000898508 5:166885525-166885547 CTTCTTTCATAGAAGACAAATGG - Intergenic
1001208661 5:169789463-169789485 CTTCTTTCCTTTAGTACACATGG + Intronic
1001263856 5:170257429-170257451 CTTCTCTCCTTGAATATTAAGGG + Intronic
1001293490 5:170483040-170483062 CATCTGTCCTTGGAAACAAAAGG - Intronic
1001450800 5:171822911-171822933 CTGCTTCCCTTGGAAACACAAGG + Intergenic
1001559860 5:172661925-172661947 CTTCTGTCCTTGGACACCAAGGG + Intronic
1001723284 5:173874687-173874709 TTTCTCTACTTGAAATCAAATGG + Intergenic
1003375513 6:5573290-5573312 TTTCTCTCATTGAAAACAATAGG + Intronic
1003716347 6:8650606-8650628 CTTTTTTCCTCACAAACAAAAGG + Intergenic
1004401163 6:15289937-15289959 CTTCTTTCCATGAAGACAAGTGG - Intronic
1004607085 6:17204977-17204999 CTTTTTTCCCTGAAAAAAAGAGG + Intergenic
1005176462 6:23050999-23051021 GTTCTGTACTTGAAAACATATGG - Intergenic
1005281874 6:24283239-24283261 ATTCTAGCCTTAAAAACAAAAGG - Intronic
1005966036 6:30727189-30727211 CTTCTTCCCTTGCATACAATAGG - Intergenic
1007368842 6:41413166-41413188 CTCCTTTTCTTGAAAAAAAGGGG - Intergenic
1007837126 6:44682370-44682392 CTGGTTTCCTAGAAAAAAAAGGG + Intergenic
1008277415 6:49557835-49557857 CTTAATTCCTTTGAAACAAAAGG - Intronic
1009162639 6:60302258-60302280 CTTTTATCCTTGAAAGCGAAGGG - Intergenic
1009249232 6:61277259-61277281 CTTTTTTCCTTGAATATATATGG - Intergenic
1009925579 6:70116650-70116672 TTTTTTTTCTTGAATACAAAGGG + Intronic
1011326047 6:86150890-86150912 CTTCTTTCAGTGAAAACTCAGGG + Intergenic
1011367074 6:86594857-86594879 TTTCTTTCATTTAAAACAAGAGG + Intergenic
1011646756 6:89466326-89466348 TTACTTTCCTTGAAGAGAAATGG + Intronic
1012235836 6:96814166-96814188 CTCCTTTGCTTGAAAACTTAAGG - Intronic
1012783901 6:103598900-103598922 CTTCTTTCCTAGAAATGCAAAGG + Intergenic
1013019366 6:106197351-106197373 CTACCTTTTTTGAAAACAAAAGG - Intronic
1013138028 6:107301196-107301218 CTCCTTTCCTTGAAAAGCAGTGG + Intronic
1014139821 6:117928489-117928511 CTTAATGCCTTGAAAAAAAATGG + Intronic
1014208684 6:118685161-118685183 CTTATATTCTTAAAAACAAAAGG - Intronic
1015118344 6:129674318-129674340 CTTCCTTCCTTGAAAACCAAGGG + Intronic
1015855945 6:137624803-137624825 CTTCTCTGCTTGAAGAGAAAGGG - Intergenic
1016363460 6:143291736-143291758 CTGCTTTCCTTGAACACAGCAGG - Intronic
1016456129 6:144232743-144232765 CCTCTTTCCTTGAAAAAAGGGGG + Intergenic
1016525077 6:144992372-144992394 CTGCTCTCCTTGTAAACAAGAGG + Intergenic
1016630668 6:146226468-146226490 CATCTTTCCTGAAGAACAAAGGG - Intronic
1016724292 6:147343471-147343493 TTTCTTTTCTTGAAAAATAAAGG - Intronic
1017111654 6:150938470-150938492 TTTCTTTGCTTAAAAAAAAAAGG - Intronic
1017589786 6:155966567-155966589 CATCTTTCCATGATCACAAATGG + Intergenic
1017857069 6:158359160-158359182 CCTCTTACCTAGAAAAGAAATGG + Intronic
1018072876 6:160181559-160181581 TTTCTGTCCTTGAAAAGTAAAGG - Intronic
1019183974 6:170210094-170210116 CTTCTTCCCTTGAAAGGACAAGG + Intergenic
1019789481 7:3001652-3001674 CTTCTCTGCTTGAAAACCACTGG - Intronic
1020674389 7:11163401-11163423 CTTATTTCATTTAATACAAAAGG - Intronic
1020737283 7:11966932-11966954 CTTCTTTCCTTATATAAAAAGGG - Intergenic
1020917482 7:14214155-14214177 CTTCCTTCCTTAAAAACACTTGG + Intronic
1020931491 7:14402175-14402197 CTTCTTTCTTTTAAAAAATAAGG - Intronic
1021126977 7:16862363-16862385 CTTCTTCCCATGAAAAGAAAGGG - Intronic
1021290653 7:18840105-18840127 TTTCTTTTCTTGAAATTAAAAGG - Intronic
1021333148 7:19364306-19364328 ATTCTTACCTTGTACACAAAGGG - Intergenic
1021434185 7:20595530-20595552 CTTCTTTCACTGATAAGAAAAGG + Intergenic
1021469279 7:20982948-20982970 CTTATGTGCTAGAAAACAAAGGG + Intergenic
1021931911 7:25589501-25589523 CTTTTTCTCTTGAAAACTAAGGG + Intergenic
1022275404 7:28849983-28850005 CTTCTTTCATTCAAAACAAAAGG + Intergenic
1023005795 7:35865975-35865997 CTCTTTATCTTGAAAACAAAGGG + Intronic
1023332183 7:39130118-39130140 TTTCTTTACTTTAAAAAAAATGG - Intronic
1024068298 7:45763357-45763379 CTCTTTATCTTGAAAACAAAGGG - Intergenic
1025028773 7:55539020-55539042 TTTCATTCCTTTAAAAAAAAAGG + Intronic
1025193701 7:56916125-56916147 TATCTTTCCATGAAAAAAAAAGG - Intergenic
1025951416 7:66148359-66148381 CTCCTTCTCTAGAAAACAAAAGG + Intronic
1026335047 7:69386975-69386997 CTTCCTTCCTTAAATGCAAAGGG + Intergenic
1026560957 7:71448659-71448681 CATTTTTTCTTGAAAACAAAAGG + Intronic
1027494003 7:78864920-78864942 CTCCTCTCCTTGAAGACATAGGG - Intronic
1027568623 7:79831763-79831785 CTTATTTTCTTTAAAAGAAAAGG - Intergenic
1028445397 7:90916112-90916134 CCTCTTTCCTTCTAAACTAAAGG + Intronic
1028546919 7:92012251-92012273 CTACTTTCCTTGAAAAAGAAAGG + Intronic
1028710825 7:93905680-93905702 CTTATTTCCTTGAATTTAAATGG - Intronic
1028777626 7:94697168-94697190 CTTCTTGCCAGGAAAAAAAAGGG + Intergenic
1029378555 7:100197599-100197621 CTTCTTACTTAAAAAACAAAAGG - Intronic
1030584803 7:111404099-111404121 CTACTTGGCTAGAAAACAAATGG + Intronic
1030821011 7:114091080-114091102 ATTCTTTCCTGTAAAATAAATGG + Intronic
1030949267 7:115768726-115768748 ATTCTATCCCTGAGAACAAAGGG + Intergenic
1031044020 7:116866910-116866932 CTTCTTTCCTCTCACACAAAGGG + Intronic
1031198072 7:118641927-118641949 CTGCTTTTCTTCTAAACAAAGGG - Intergenic
1031225697 7:119035220-119035242 CTTTTTTCCTTAAAAAAAAAAGG - Intergenic
1031277335 7:119744693-119744715 CTTCTTTTCTGTAAAAAAAAGGG - Intergenic
1031357252 7:120801882-120801904 CTTATTTCCTGGAAAAAAAATGG + Intronic
1031871593 7:127093983-127094005 ATAGTTTCCTTGAAAATAAATGG - Intronic
1032378165 7:131445381-131445403 CTTCTTTTTTTGAAAAACAAAGG - Intronic
1032729065 7:134619639-134619661 CTTCTTTCCTTCAGAGGAAAAGG + Intergenic
1033760661 7:144433300-144433322 TCTCTTTCCTTGAGAACACAAGG + Intergenic
1033773439 7:144579967-144579989 TTCCTTTGATTGAAAACAAAAGG - Intronic
1033795755 7:144842756-144842778 ATTCATTCCTGGAACACAAAAGG + Intergenic
1034091755 7:148370460-148370482 TTTCTTTTCTGGATAACAAAAGG + Intronic
1034568630 7:151936163-151936185 CTTAGTTCCTTAAAAATAAAAGG - Intergenic
1034845698 7:154442665-154442687 GTTTTTTTCTTGAAAACAGAAGG + Intronic
1035006557 7:155666553-155666575 TGTCTTTCCTAGAAAAGAAATGG + Intronic
1035215906 7:157366574-157366596 GTTTTTTCTTTGAAGACAAAAGG + Intronic
1035633108 8:1123433-1123455 CTTGTTTACTGGAAAACAATGGG - Intergenic
1036419473 8:8582663-8582685 ATTCTTTCCTTTAAAAATAATGG - Intergenic
1037171486 8:15898164-15898186 TTTCGTTTCATGAAAACAAATGG + Intergenic
1037462447 8:19125721-19125743 CATCTTTCAGTGAAATCAAATGG - Intergenic
1038570557 8:28658470-28658492 TTCCCTTCCTTGTAAACAAAAGG + Intronic
1038701559 8:29854264-29854286 CTTCTTTCTTGGAATTCAAATGG + Intergenic
1039161126 8:34622337-34622359 GTTATTTCCTTTAAAACATAGGG + Intergenic
1039252552 8:35682727-35682749 TCTCTTTCCTTGAACACAAAAGG - Intronic
1039329807 8:36524574-36524596 ATGGTTTCCTTGAAAATAAATGG - Intergenic
1039653778 8:39375815-39375837 ACACTTTCCTTGAAAACAGAAGG - Intergenic
1039969410 8:42308603-42308625 CTTCTCTCCTTTAAAACTGAGGG - Intronic
1040052033 8:43024859-43024881 CTTCCTTTCTAGAAAACAAGGGG + Exonic
1040395097 8:46991159-46991181 CTGCTTTCTTTGAAAAAACAAGG - Intergenic
1040601581 8:48890092-48890114 CTCCTTTCCTTCAAATCAATGGG + Intergenic
1040629194 8:49189970-49189992 TTCCTTTCCTGCAAAACAAAAGG - Intergenic
1040634767 8:49259998-49260020 TTTCTTTTATTGAAAATAAATGG + Intergenic
1040761153 8:50845856-50845878 CTTCCTTCCCTGACAACAAGAGG + Intergenic
1040801563 8:51347529-51347551 CGTTTTTAATTGAAAACAAAAGG - Intronic
1040830227 8:51667867-51667889 TTTCTGACCTTTAAAACAAAAGG - Intronic
1040908897 8:52498154-52498176 CTTCTCTCCTTGAACAAAAGGGG - Intergenic
1041861308 8:62516041-62516063 CTTCCTTTCTTAAAAAAAAATGG - Intronic
1041981622 8:63868024-63868046 TTTCTTTCTTTGCAAAGAAAGGG - Intergenic
1042088277 8:65131984-65132006 CTTTTTCCCTTAAAAACATAGGG - Intergenic
1042248670 8:66733852-66733874 CTGATTTATTTGAAAACAAAGGG + Intronic
1042694707 8:71544137-71544159 TTCCTTTCCTTAAAACCAAAGGG + Intronic
1042789488 8:72587963-72587985 CATTTTTTCTTGAAAGCAAATGG - Intronic
1044094089 8:88040997-88041019 TTTTTTTGCTTTAAAACAAAGGG - Exonic
1045144276 8:99322391-99322413 CTTGAGTTCTTGAAAACAAACGG - Intronic
1045875274 8:106974639-106974661 CCTCCTTTGTTGAAAACAAAAGG - Intergenic
1047124067 8:121940713-121940735 CTCCTTTCCATAAAAAAAAAAGG + Intergenic
1047612125 8:126531433-126531455 TTTCTTTCCTTTCATACAAATGG - Intergenic
1047948112 8:129902943-129902965 TTTTTTTCATTGAAAACAGAAGG - Intronic
1048225840 8:132584612-132584634 GGTCACTCCTTGAAAACAAAAGG - Intronic
1048679982 8:136830720-136830742 TTTCTTTTCTTGAAAAGAAAAGG - Intergenic
1050302987 9:4277625-4277647 CTGCTGTCCTTGGAGACAAAGGG - Intronic
1050622399 9:7467982-7468004 CTTCTTTCCTGGAGCACATAGGG + Intergenic
1050877180 9:10653095-10653117 ATTCTATCCTTCAAAACTAATGG + Intergenic
1051283236 9:15465367-15465389 TTACTTTACTTTAAAACAAAGGG + Exonic
1052485146 9:29087766-29087788 CCTCATTCCTTGGAAAAAAAAGG + Intergenic
1054828292 9:69595590-69595612 ATTCTATCCTTGAATGCAAAAGG - Intronic
1056236747 9:84601984-84602006 CTTCCTTGCCTGAAAAGAAAAGG - Intergenic
1056772365 9:89488239-89488261 GTTGTTTACTTTAAAACAAATGG + Intronic
1057166826 9:92934638-92934660 CTTCTTTCATGGAAAGGAAAGGG - Intergenic
1057512137 9:95689673-95689695 TCTCTTTCCTTTAAAACAAGAGG - Intergenic
1058491981 9:105512069-105512091 CTTCTTTCCTTGGAAACTGAGGG - Intronic
1059238266 9:112780823-112780845 CTTGGGTCATTGAAAACAAATGG + Intronic
1059710527 9:116863726-116863748 CTTCTTCCCTTGGAGAGAAAGGG + Exonic
1186215686 X:7298091-7298113 ATTCTTCTCTTGAAAAAAAAGGG + Intronic
1186250893 X:7665119-7665141 ATTCTTTCATTTACAACAAATGG + Intergenic
1186301477 X:8204451-8204473 CATCTTTCCTTCAAAGAAAAAGG + Intergenic
1186615410 X:11181370-11181392 CTCCTTCCATTGAAAACAACAGG + Intronic
1186836859 X:13447002-13447024 CTTCTCTTGTTAAAAACAAAGGG + Intergenic
1188469868 X:30526171-30526193 CTTCTATCCTTGATGACACAGGG + Intergenic
1188731836 X:33657391-33657413 ATTCTTACCTTAAAAACCAATGG + Intergenic
1188951415 X:36379426-36379448 CTTCTTCCTTTTAACACAAACGG + Exonic
1189530141 X:41871886-41871908 CTACTCTCCTTGAAAACAGAGGG + Intronic
1191628697 X:63298264-63298286 CTTCGTTACTGGAAAAGAAAGGG + Intergenic
1191939372 X:66461828-66461850 CTGTTTTCCTTGAAAATACATGG - Intergenic
1192156928 X:68753641-68753663 CTTCTTTCCAGCAAAACACATGG + Intergenic
1192320300 X:70085410-70085432 ATTTCTTCCTTCAAAACAAAGGG + Intergenic
1193027494 X:76860225-76860247 CTTCTTTCTTGGATTACAAATGG - Intergenic
1193049748 X:77087410-77087432 CTTCTTTCTTTTATGACAAATGG + Intergenic
1193601673 X:83514160-83514182 TTTCTTACCTTTAAAAGAAAAGG + Intergenic
1193825890 X:86226275-86226297 CTTCTTTCAGTGAACAGAAAAGG + Intronic
1194023630 X:88724287-88724309 CTTCCTTTCTTCCAAACAAATGG - Intergenic
1194074097 X:89367426-89367448 CTTTTAACCTTGAAAAGAAAAGG - Intergenic
1194107231 X:89785705-89785727 ATTGTTACCTTGAAAATAAAGGG - Intergenic
1194649298 X:96496744-96496766 TTTCTTTTCCTGAAAACAAATGG - Intergenic
1194756544 X:97745464-97745486 CTTCTTTCCCTGAAAAGTATGGG + Intergenic
1196069936 X:111509375-111509397 ATTTTTTCCTAGAAACCAAATGG - Intergenic
1196164114 X:112519643-112519665 CTTCTATCTCTGAAAACTAATGG + Intergenic
1196721057 X:118854288-118854310 CTTTAAACCTTGAAAACAAAAGG - Intergenic
1198206998 X:134475733-134475755 CTTGTTTCCTAGAAAGCACATGG + Intronic
1198714406 X:139541157-139541179 GTTCTTTCCTTCAAATCCAAAGG - Exonic
1199117618 X:144011010-144011032 TTCTTTTCCTTGAAAACCAATGG - Intergenic
1199141848 X:144322853-144322875 ATCCTTCCCTTGAAATCAAATGG + Intergenic
1199487453 X:148363652-148363674 TTTCTTTACTTGAAATGAAAAGG + Intergenic
1199659635 X:150036023-150036045 CCTCTTCCCTGGAAAGCAAAGGG - Intergenic
1200291574 X:154880321-154880343 CTTCCTTTCATGAAAAAAAAAGG - Intronic
1200336958 X:155361075-155361097 CTTCCTTTCTGGAAAAAAAAGGG + Intergenic
1200349512 X:155480152-155480174 CTTCCTTTCTGGAAAAAAAAGGG - Intergenic
1200459186 Y:3433541-3433563 ATTGTTACCTTGAAAATAAAGGG - Intergenic
1200729489 Y:6718953-6718975 CTTTTAACCTTGAAAAGAAAAGG - Intergenic
1200832270 Y:7698573-7698595 CTTATTTCCTTGAAAATTGAGGG - Intergenic
1202023327 Y:20491571-20491593 GTTCTTCCCTTGAAAGCAACAGG - Intergenic
1202279942 Y:23172670-23172692 TTTCCTTGCTTGAAAACGAATGG + Intronic
1202280671 Y:23183515-23183537 TTTCCTTGCTTGAAAACGAATGG + Intronic
1202281400 Y:23194363-23194385 TTTCCTTGCTTGAAAACGAATGG + Intronic
1202284491 Y:23224156-23224178 TTTCCTTGCTTGAAAACGAATGG - Intronic
1202433072 Y:24808748-24808770 TTTCCTTGCTTGAAAACGAATGG + Intronic
1202436165 Y:24838542-24838564 TTTCCTTGCTTGAAAACGAATGG - Intronic
1202436893 Y:24849392-24849414 TTTCCTTGCTTGAAAACGAATGG - Intronic