ID: 1169105224

View in Genome Browser
Species Human (GRCh38)
Location 20:2988801-2988823
Sequence CAGTGAGTTCCTTGAGAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 423}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169105224 Original CRISPR CAGTGAGTTCCTTGAGAATA GGG (reversed) Intronic
900843535 1:5077574-5077596 CTGTAATTTCCTTGACAATATGG + Intergenic
901498301 1:9635530-9635552 CAGTGATTTCCCTGGGAATATGG - Intergenic
902371186 1:16008047-16008069 CTGTGAGCTCCTTGAGGACAGGG - Exonic
903457590 1:23498527-23498549 CTGTGAGCTCCTCAAGAATAAGG + Intergenic
903628866 1:24750913-24750935 CAGTAAATTCCTTGAGGATAGGG + Intronic
904146100 1:28392940-28392962 CAGTAAGTTCCTAGTGAAGATGG + Intronic
904289155 1:29472452-29472474 CAGTGATTGCCTGGAGAAAAAGG - Intergenic
904362289 1:29984091-29984113 TGGTGAGTTCCTTGAAACTATGG + Intergenic
904457423 1:30656008-30656030 CTGTGAGTTCCTTGAGGGTAGGG + Intergenic
904598907 1:31663154-31663176 CTGTGAGCTCCTTGAGGACAGGG - Intronic
904775680 1:32904766-32904788 CAGTGAGTTGATGGAGGATAAGG - Intergenic
905025795 1:34848416-34848438 CTGTGAGTTCCTTGAGGGCAGGG - Intronic
905601510 1:39256173-39256195 TAGTGAGGTCATTGAGAAAAAGG + Intronic
905786099 1:40758978-40759000 TTGTGAATTCCTTGAAAATAAGG - Intronic
906022750 1:42645115-42645137 CAGTGAGTTCCTGGAGGGCAAGG + Intronic
906244810 1:44265504-44265526 TTGTGAGCTCCGTGAGAATAGGG - Intronic
906639033 1:47430461-47430483 CTGTGAGCTCCTTGAGAACAGGG - Intergenic
906926878 1:50127284-50127306 CAGGGAATGCCTTGAAAATAAGG - Intronic
907669840 1:56464685-56464707 AAGTGAGGTCCTGGAAAATATGG - Intergenic
907716809 1:56933751-56933773 TTCTGAGTTCCTTGAGAGTAGGG - Intronic
907810896 1:57868660-57868682 TATTGAGTTCCTTGAGGATGTGG + Intronic
907905172 1:58777979-58778001 ATGTGAGTTCCTTGAGAATAGGG + Intergenic
908156738 1:61361022-61361044 CTGTGAATTCCTTGAGAGCAGGG - Intronic
908339445 1:63161512-63161534 CTGTGAGTTCCTTGAAGATGGGG + Intergenic
908638448 1:66194724-66194746 AGGTGAGTTCCTTGAGGACAGGG + Intronic
908638451 1:66194771-66194793 ATGTGAGTTCCTTGAGGACAAGG + Intronic
909393843 1:75147426-75147448 AAGTGAGTTCCTTGAGATCAAGG - Intronic
909600074 1:77451946-77451968 TTGTGAGTTCCTTGAGGACAAGG + Intronic
909615773 1:77606397-77606419 CGGTGAGTTCCCTGAGACTCTGG - Intronic
910093029 1:83487991-83488013 CAGAGAGTGCCTTGGGATTAAGG + Intergenic
910799090 1:91128051-91128073 TAGTAAGTTCTTTGAGGATAAGG + Intergenic
911452041 1:98075352-98075374 CATTGAGTTCCTAGAGAATGTGG - Intergenic
912207257 1:107522357-107522379 GAGTGAATTCTTTGACAATAAGG - Intergenic
912578825 1:110701890-110701912 CTGTAAGTTCCTTGGGGATAAGG - Intergenic
912584110 1:110746295-110746317 CTGTGAATTCCTTGAGGACAGGG - Intergenic
912952615 1:114130676-114130698 CTGTGAGTTCCTTGAAAGCAAGG + Intronic
912958686 1:114175615-114175637 TAGTGAGTTCCTTGTCACTAGGG - Intergenic
913102967 1:115586353-115586375 CAGTGCCTGCCTTGAGAAAAAGG + Intergenic
913264630 1:117032384-117032406 CTGTGAGCTCCTTGAGGGTAGGG - Intronic
914316797 1:146520845-146520867 CTGTGAACTCCTTGGGAATAGGG + Intergenic
914497558 1:148212515-148212537 CTGTGAACTCCTTGGGAATAGGG - Intergenic
914963190 1:152225332-152225354 CTATGAGCTCCTTGAGAATAAGG + Intergenic
916205572 1:162313180-162313202 CAGTGAGATCCTTGAGGGCATGG - Intronic
916527750 1:165627640-165627662 TAAGGAGTTCCTTGAGAAGAGGG + Intergenic
916558862 1:165915693-165915715 CACTGAGGTCCTTGAGGAGAAGG - Intergenic
916843957 1:168629408-168629430 CTGTGAGCTCCTTAAGGATAAGG + Intergenic
916849239 1:168686244-168686266 CAGTAAATTCCTTGAGGACAAGG - Intergenic
916911332 1:169350293-169350315 GAGTGAGCTCCTTGAGAGCAGGG - Intronic
917180216 1:172288119-172288141 CTGTGAATTCCATGAGAATAGGG - Intronic
917508205 1:175648194-175648216 CTGTGAGTTCTTTGAGACTGAGG + Intronic
917646233 1:177031531-177031553 CTGAAAATTCCTTGAGAATATGG - Intronic
917791083 1:178499189-178499211 CTGTGAGCTCCTTGAGAGCACGG + Intergenic
918056830 1:181029120-181029142 CAGTGAATTTCTTGACAAGACGG + Intergenic
918461019 1:184776754-184776776 TAGTTAAATCCTTGAGAATAGGG - Intergenic
918549545 1:185726292-185726314 CCATGAGCTCCTTGAAAATAAGG - Intergenic
919078996 1:192847676-192847698 TAGTAAATTCCATGAGAATAGGG - Intergenic
919973808 1:202598060-202598082 CTGTGAGGTCCTTGAGAGCAAGG + Intronic
920001872 1:202806676-202806698 CAGGGAGATCCCTGAAAATAAGG - Intronic
920378276 1:205521119-205521141 CCCTGAGTTTCTTGAGAATGGGG + Intronic
923118817 1:230970827-230970849 CACTGAGCTACTTGAAAATAAGG + Intronic
923243977 1:232113002-232113024 CTGTGAGTTCTTTGAGAACAGGG + Intergenic
923520200 1:234729408-234729430 CAGTGAGCTCTTTGAGAACAGGG + Intergenic
923778541 1:237001117-237001139 AAGTGAGTTGCTTCAGAATGCGG + Intergenic
923974734 1:239249436-239249458 CAGTGAACTCCTTGAGGACAAGG - Intergenic
1063411169 10:5837695-5837717 CAGGGAGTTCCTTAAGAGCAGGG - Intronic
1063438906 10:6056123-6056145 GAGTGAGTTACTTGAGAATATGG + Intronic
1065677019 10:28187230-28187252 CAGAGATTTCCTTGAGAGTAAGG - Intronic
1068856809 10:61806215-61806237 CAGTGAATTCCATGAGCATAGGG - Intergenic
1069037369 10:63659446-63659468 CTGTGAACTCCTTGAGAACAAGG + Intergenic
1069315432 10:67093866-67093888 TAGTCAGTTGTTTGAGAATATGG - Intronic
1070013658 10:72502605-72502627 CAGGGAGTGGCTTGGGAATAGGG - Intronic
1070605039 10:77892658-77892680 CAGTGAATTCCTGGAGACCAGGG + Intronic
1071178776 10:82958734-82958756 ATGTGAATTCCTAGAGAATATGG + Intronic
1071878075 10:89864198-89864220 CAGTAAGTTACTTGAGGACACGG + Intergenic
1072258903 10:93648276-93648298 CAGAGAGGTCCTTGAAAAGATGG - Intronic
1072558862 10:96550295-96550317 TAGTAAGTTCCTTGAGAGTAAGG - Intronic
1073384263 10:103110012-103110034 CTCTGAGTTCATTGAGAAAAAGG - Intronic
1073533808 10:104256030-104256052 CAGAAAATTCCTTAAGAATAGGG - Intronic
1074149863 10:110748976-110748998 TAGTAAGCTCCTTGAGAGTAAGG - Intronic
1074346665 10:112692880-112692902 CAGTGAGTCCCTGGAGGACAGGG + Intronic
1074593554 10:114838990-114839012 CAGTATGTTCCTTGAGGACAAGG + Intronic
1074741427 10:116488082-116488104 CTGTGTGTCCCTTGAGAATAGGG - Intergenic
1074768707 10:116719321-116719343 AAGTGAGTACCCTGAGAAGAGGG + Intronic
1075025712 10:118981755-118981777 CAGTGAGTTGTCTGAGAATTTGG - Intergenic
1076030120 10:127150197-127150219 CAGTGAGTTCCTTGGGCAGGAGG - Intronic
1077603085 11:3587442-3587464 CAGTGATGTTATTGAGAATATGG - Intergenic
1077611495 11:3645687-3645709 CAGTGAGTTCCTTGAGGGCAGGG - Intronic
1077700404 11:4436186-4436208 CTGTGACCTCCTTGAGAACAGGG - Intergenic
1078183788 11:9034021-9034043 CCATGAGCTCCTTGAGAATAGGG + Intronic
1078742615 11:14081292-14081314 CGCTGAGTGGCTTGAGAATATGG - Intronic
1080279750 11:30543198-30543220 ACGTGAGATCCTTGAGAATGAGG - Intronic
1080612887 11:33920203-33920225 CTGTAAGTTCCTTGAGGACAGGG + Intergenic
1080988340 11:37499215-37499237 CAGTGAGTTGATTAAGAAGATGG + Intergenic
1081194790 11:40148316-40148338 CAGTGAGGTTGTGGAGAATAAGG - Intronic
1081385923 11:42473122-42473144 GACTGAGTTCCCTGAGAATTTGG - Intergenic
1083291938 11:61695379-61695401 CTGTGAGCTACTTGAGGATAGGG + Intronic
1084163706 11:67365267-67365289 CAGTGACTTCCTCCAGAAGATGG - Exonic
1084258969 11:67961980-67962002 CAGTGATTTTATTGGGAATATGG - Intergenic
1085190417 11:74615774-74615796 CTATAAGTTCCATGAGAATAGGG + Intronic
1085618476 11:78020041-78020063 CTGTGAGTTCCTTGAAAGCAGGG - Intronic
1085769816 11:79314749-79314771 CTGTGAGCTCCATGAGTATATGG - Intronic
1085799274 11:79573492-79573514 CACTGAGTTCCTTGAGAGATGGG + Intergenic
1086156297 11:83670118-83670140 CAGTGAGTTCCATGAGGATTAGG + Intronic
1086775729 11:90830595-90830617 CAATGAGTTCTTTGAATATAGGG + Intergenic
1086781176 11:90908402-90908424 CAGTGATTTGATTAAGAATAGGG - Intergenic
1086794162 11:91079964-91079986 CAGTGAGATCCTTGAGAGAAAGG + Intergenic
1086915302 11:92523271-92523293 CAATGGGTTCCTATAGAATATGG - Intronic
1086965048 11:93018726-93018748 CAGTGAGCTGCTAGAGAAAAGGG - Intergenic
1087079534 11:94156497-94156519 AAGGCTGTTCCTTGAGAATAAGG + Intronic
1087603709 11:100348154-100348176 CAGAGAGTTCTTAGAGAATATGG - Intronic
1087852691 11:103050805-103050827 CTGTGAGCTCCTTGAGAGCAGGG - Intergenic
1087883999 11:103456056-103456078 CTGTAAGTTCCTTAAGGATAAGG - Intronic
1089229517 11:116959637-116959659 GAGTGAGTGCCTTGTGAATCAGG - Intronic
1089709555 11:120305332-120305354 CCCTGAGTTCTCTGAGAATAGGG + Intronic
1090307040 11:125700032-125700054 CAGTGAGTTGAGTGAGAACAGGG + Intergenic
1091086918 11:132729949-132729971 AACTGAGTTCCTTGAGAAAAGGG + Intronic
1091160646 11:133416589-133416611 CCATGAGCTCCTTGAGAACAAGG + Intronic
1092134839 12:6139707-6139729 CAGTGAGGCCTTTGACAATAAGG + Intergenic
1092501106 12:9049108-9049130 CAGTGAGTCCCTTCAGAGCAGGG + Intergenic
1092791093 12:12071628-12071650 CAGAGAATTCCTTGAGTCTAAGG + Intronic
1092855354 12:12667829-12667851 TTATGAGTTCCTTGAGGATAAGG + Intronic
1093132326 12:15407070-15407092 CAGTGATTTCCTTGAGCTTTTGG + Intronic
1094105718 12:26809454-26809476 TAGTGGGTACCTGGAGAATATGG - Intronic
1094726522 12:33123891-33123913 CTATGAATTCCTTGAGGATACGG - Intergenic
1094784645 12:33833060-33833082 CACTGAGTTCCTTAAAAATAAGG + Intergenic
1095681180 12:44977877-44977899 AAGTGAATTCCCTAAGAATAAGG + Intergenic
1096115785 12:49054307-49054329 CTGTGAGATCCCTGAGAAGATGG + Exonic
1097126254 12:56778005-56778027 CTGTGAGCTCCTTGAAGATATGG + Intronic
1099045718 12:77716363-77716385 CTGTGAGTTTCTTGAGAACATGG - Intergenic
1099182516 12:79484565-79484587 CAATTAGTTCATTGAGAATGGGG - Intergenic
1099318686 12:81117687-81117709 AAGTGATTTCTTTGACAATATGG - Intronic
1100889803 12:99112519-99112541 TTGTGAGTTCCTTGAAAGTAGGG + Intronic
1101312781 12:103598877-103598899 CTGTGAGCTCCTTGGGGATAGGG - Intronic
1101422454 12:104560793-104560815 CTGTGAGCTCCTTGAGTATGGGG + Intronic
1101536291 12:105619873-105619895 CAGTGAATTCCTGGATCATATGG + Intergenic
1104181651 12:126387414-126387436 CTATGAGTTACTTGAGAACATGG + Intergenic
1104189003 12:126459751-126459773 CAGTGAATGCCTGGGGAATAAGG - Intergenic
1104375229 12:128260141-128260163 CATTTAGGTCCTTGTGAATAAGG + Intergenic
1104999522 12:132680833-132680855 CAGTGTGGTTCTTGTGAATAAGG - Intronic
1106562635 13:30859872-30859894 CTGTAAGTTCCTTGAGGACAAGG - Intergenic
1106575643 13:30972025-30972047 TAATGAGTTCCCTGAGAAGAAGG - Intronic
1106694457 13:32157149-32157171 CAATGACTTCCTTGAGCAAAAGG - Intronic
1106804435 13:33291652-33291674 CAGACAGTCCCTTGAGAACAGGG - Intronic
1106909782 13:34451361-34451383 CTGTGGGTTCCTTGAGGAAAAGG - Intergenic
1107835065 13:44406284-44406306 CTGTAAGTTCCTGGGGAATAGGG - Intergenic
1107995326 13:45853702-45853724 AAGTAAGTTCCATGAGAATGGGG + Intergenic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1108681994 13:52788351-52788373 CTGTAAGTTCCTTGAGGGTAGGG + Intergenic
1110013364 13:70367111-70367133 CAGTGAGTGCCTTCAGAGGATGG - Intergenic
1110404342 13:75133200-75133222 CAGTGAGTTCCATGAGGGCAAGG - Intergenic
1111494422 13:89029805-89029827 CTATGAGTTCCTTGATAAGAGGG - Intergenic
1111586868 13:90292673-90292695 CAGTGTGTTCCTTTAGGATTGGG - Intergenic
1111777521 13:92683293-92683315 CAGTCTGTTCCTTGGGAATGTGG + Intronic
1112147310 13:96714613-96714635 CAGTAAGTTGCTAGAGAGTAGGG - Intronic
1112307626 13:98289612-98289634 CAGTGATCTCCTTGAGAGCAGGG - Intronic
1112943751 13:104898458-104898480 CAGTTATTTTCTTAAGAATATGG - Intergenic
1114696711 14:24632837-24632859 CAGGGAGCTCCTTGGGAAGAAGG + Intronic
1115047841 14:29019592-29019614 CACTGAGTACTTTGAGAAAATGG - Intergenic
1115922099 14:38386785-38386807 CAGTGAGTTAGTTAAGAGTATGG + Intergenic
1116531295 14:45977006-45977028 CAGTGAATTCCATGAGCATGAGG + Intergenic
1116761066 14:49015011-49015033 GAGAGAGTTGCTTGAGGATAAGG - Intergenic
1117330890 14:54710808-54710830 CTGTGAGCTCCTTGGGGATAGGG + Intronic
1117523923 14:56578716-56578738 CTGTGAGTTCCTGGAGGAGAGGG - Intronic
1119205252 14:72789122-72789144 CTGTGAGCTCCTGGAGAACATGG + Intronic
1119466021 14:74859334-74859356 CTGTGAGCTCCTTGAGAGTGAGG + Intronic
1119869728 14:78006515-78006537 CTGTGAGTACCTTGAGGAAAAGG + Intergenic
1119902103 14:78269900-78269922 CAGTGATTTCCTTGAGACAGAGG - Intronic
1120153640 14:81065678-81065700 CTGTGAGTTCCTTGAAGGTAGGG + Intronic
1120713827 14:87819282-87819304 CAGTGAGTTGCATGGGAAGAAGG + Intergenic
1120716402 14:87845687-87845709 CTGTGAGTTCCATGAAGATAGGG - Intronic
1120896454 14:89537149-89537171 CAGGAAGTTCCTTGAGAATGGGG + Intronic
1120997817 14:90429780-90429802 CTGTGAGTTTCCTGAGAACAGGG - Intergenic
1121505302 14:94472631-94472653 CAGTGGGCTCCTTAAGAACAAGG - Intronic
1122164109 14:99808192-99808214 TAGTGAGTTCCTTGAGGGCAGGG + Intronic
1125928694 15:43584369-43584391 CAGCGAGCTCCTTGAGGATGAGG - Exonic
1125941860 15:43684204-43684226 CAGCGAGCTCCTTGAGGATGAGG - Intergenic
1126079840 15:44949187-44949209 CAATGAGTGCCTTGAGGAAAGGG - Intergenic
1128840985 15:70851942-70851964 CAGCTAGTTCCCTGAGCATAGGG - Intronic
1130245110 15:82239955-82239977 CTGTGAGCTCCTTGAAAATAGGG + Intronic
1130415493 15:83690694-83690716 CAGTGAGTTCCATGGGAGCATGG + Intronic
1130455565 15:84103455-84103477 CTGTGAGCTCCTTGAAAATAGGG - Intergenic
1130617692 15:85428031-85428053 CAGTGAGTACCTGGAGAACCTGG - Intronic
1131349037 15:91679660-91679682 GAGTCAGTTCCTTTAGAACAGGG - Intergenic
1131741958 15:95402565-95402587 CAGTGAGGTCCTGTAGAAAAAGG - Intergenic
1133365896 16:5209885-5209907 CAGTGATTTTATTGGGAATATGG + Intergenic
1133497865 16:6336994-6337016 TTTTGAGTTCCTTTAGAATAAGG - Intronic
1134207451 16:12249707-12249729 CAGGGAGATCATTGAGAATTAGG + Intronic
1135882559 16:26272676-26272698 CAGTGATTACCTAGGGAATAGGG + Intergenic
1136474426 16:30503799-30503821 AATTTTGTTCCTTGAGAATAGGG - Intronic
1138048447 16:53750733-53750755 ATGTGAGTTCCTGGAGAATTGGG + Intronic
1138088471 16:54155082-54155104 CAGTGAGGGCCCTGAGGATATGG + Intergenic
1139198916 16:64952333-64952355 CTGTGAACTTCTTGAGAATAGGG + Intronic
1139326274 16:66154925-66154947 CAGTGCGTCCCTTGAGAATCTGG - Intergenic
1141238493 16:82242738-82242760 CTGTGAGCTCCCTGAGGATAGGG - Intergenic
1141284865 16:82662122-82662144 CATTTACTTCATTGAGAATATGG - Intronic
1141382868 16:83591469-83591491 CTGTGAGTTCCTTGAAGGTAGGG + Intronic
1144233428 17:13232361-13232383 CTGTAAGTTCCTTGAGGACAGGG - Intergenic
1144447935 17:15348477-15348499 CTATGAGTCCCATGAGAATAAGG + Intergenic
1145304158 17:21663268-21663290 CAGTGGGTTCATGGAGAATGTGG + Intergenic
1146313927 17:31792535-31792557 CAGTGAGCTCCCTGAGAGCAAGG + Intergenic
1147439632 17:40440086-40440108 CAGTGAGCTCCTTGAGGGCAGGG + Intergenic
1147567567 17:41547165-41547187 CAGTGAGCTCCTTGAGGCTGGGG + Intergenic
1147747698 17:42705418-42705440 CAGTGAATTCCTATAGACTAAGG - Intronic
1149652342 17:58283821-58283843 CTGTGAGCTCCTTGAGGATAAGG - Intergenic
1151893172 17:76963206-76963228 CACTGAGCTCTTTGAGAATGAGG - Intergenic
1155670755 18:28368290-28368312 CAGTAAGCTCCTTGACAACAAGG + Intergenic
1155901461 18:31395994-31396016 CTGTAAATTCCTTGAGAACAGGG - Intronic
1156044727 18:32864804-32864826 AAGTGAGGTCCTTGAAAAAAGGG - Intergenic
1156304024 18:35859927-35859949 CAGTGAATTCCATGAGCATGAGG - Intergenic
1158766018 18:60450514-60450536 CAGTGAGTTTCTTGAGAGAAGGG - Intergenic
1159202032 18:65199209-65199231 TAGTGAGTTGCTTGAGATTAGGG - Intergenic
1160403252 18:78626978-78627000 CAAAGAGTTGGTTGAGAATATGG - Intergenic
1164203872 19:23041688-23041710 CAGTGAGCTCCTGGGGGATACGG - Intergenic
1165443321 19:35843393-35843415 CTGTGAGTTCCTTGGGAGTGGGG - Intronic
1165617820 19:37217923-37217945 CAGGGAGTTCCCTGAGAAACAGG - Intronic
1166341673 19:42141165-42141187 CTGTGAGCTCCTTGAGAAGAGGG + Intronic
1167167966 19:47812248-47812270 CAACGAGTTCCCTGAGAACAAGG - Intronic
925018073 2:546761-546783 CAGTGATTTCCATGTGGATAGGG + Intergenic
926057431 2:9782423-9782445 CTGTGAGTTTCCTGAGAAGAAGG - Intergenic
926364547 2:12121298-12121320 CAGTGAGTTCCATTATAAGATGG - Intergenic
926430482 2:12780349-12780371 CAGTGAGTTCCTTGGGGGCATGG + Intergenic
926855169 2:17248179-17248201 AAGTAAGATCTTTGAGAATAGGG + Intergenic
926955191 2:18286987-18287009 GAGTGAGTTCCTGGATAACAGGG + Intronic
927910967 2:26899505-26899527 CTGTGAGCTCCTTGAGAGCAAGG + Intronic
928219201 2:29389167-29389189 CTGTAAGCTCCTTGAGAACAAGG - Intronic
928223436 2:29424965-29424987 CAGTGAATGCCTTTAGAATAGGG - Intronic
928618203 2:33060312-33060334 CAGTGAGTTTTTTAAAAATAGGG - Intronic
928733545 2:34260516-34260538 TAATAAGTTCCATGAGAATAGGG - Intergenic
928735742 2:34286668-34286690 CAGTGGGGTCCATGAGAATCTGG - Intergenic
929085695 2:38165225-38165247 CTGTGAGATCCTAGAGAACAGGG + Intergenic
929417249 2:41755814-41755836 AAGAAAGTTCCATGAGAATAGGG + Intergenic
929489686 2:42385261-42385283 CTGTGTGTTCCTTGAGGGTAAGG - Intronic
929742120 2:44613584-44613606 CTGTGAGCTCCTTGAGAGCAGGG - Intronic
929927550 2:46228173-46228195 CTGTGAGTTCTTTGAGAACGGGG - Intergenic
931057005 2:58483500-58483522 CAGTGAGGGCCTGGAGGATAGGG - Intergenic
931507271 2:62943411-62943433 AAGTCAGTTCTTTGAGATTAAGG - Intronic
932811145 2:74827254-74827276 CACTGAGTTCTTATAGAATAGGG + Intergenic
934714359 2:96535102-96535124 TAGTGAGTTCCTTGTCATTAGGG + Intergenic
934727228 2:96631134-96631156 GTGTGAGCTCCTTGAGAGTAGGG - Intronic
935752224 2:106245706-106245728 GAGTGAGTTCTTTGAAAATTTGG - Intergenic
935898734 2:107767288-107767310 CAGTGGCTTCCTGGAGAAAAAGG + Intergenic
935912635 2:107913251-107913273 GAGTGAGTTCTTTGAAAATTTGG - Intergenic
936414675 2:112294135-112294157 CTCTGTGTTCCTTCAGAATATGG - Intronic
936690276 2:114879260-114879282 CAGTAAATTCCTTGAGGGTAGGG - Intronic
938723756 2:134088892-134088914 CTGTGAGCTTCTTGAGAATAAGG + Intergenic
939727615 2:145742783-145742805 CAGTGAGTTTCTCGAGATCAGGG + Intergenic
940335572 2:152523821-152523843 GAGTAAGTTCCTTTAGGATATGG + Intronic
941219461 2:162757924-162757946 CAGTGAGCTTATTGAGAATAAGG - Intronic
941447187 2:165617085-165617107 CAGTGAGATACAAGAGAATACGG - Intronic
942526111 2:176854676-176854698 CCGTGAGTTCCCTGAAATTATGG + Intergenic
944054492 2:195509355-195509377 GAGAGAGGTCCTTGAGAAGATGG - Intergenic
945091745 2:206182421-206182443 CTGTGAACTCTTTGAGAATAAGG + Intronic
945805002 2:214479475-214479497 CAGTCAATTCCTTGAGAAAGTGG - Intronic
945867232 2:215189979-215190001 GAGTGAGTTCCTTAAGGACAAGG + Intergenic
946012315 2:216575324-216575346 TAGTGAGTTCTTTGAGGGTAGGG + Intronic
946231666 2:218295314-218295336 CTGTGAGTTTCTTGAGAGCAGGG - Intronic
946319039 2:218938229-218938251 CTGTGAATTCCTTGAGGGTAGGG + Intergenic
947022482 2:225695900-225695922 TAGAGAGTTCCTTGAAAAAATGG - Intergenic
948673438 2:239583404-239583426 CAGTGGGTTCATTGAGAAAGTGG + Exonic
1168798826 20:630770-630792 CAGTGAGCTCCTGGAGGACAGGG + Intergenic
1169105224 20:2988801-2988823 CAGTGAGTTCCTTGAGAATAGGG - Intronic
1170448056 20:16450646-16450668 CTGTGAGTTTCATGAGAAAAGGG + Intronic
1170675052 20:18471332-18471354 CAGTGACTTCCTGGAGACAATGG - Intronic
1172944338 20:38675631-38675653 CTGTGAGCTCCTTGAGGACAGGG + Intergenic
1173135079 20:40432267-40432289 CTTTGAGTTCCTTGAGGACATGG + Intergenic
1174061471 20:47835980-47836002 AAGTAAGCTCCATGAGAATAGGG + Intergenic
1174070055 20:47893343-47893365 AAGTAAGCTCCATGAGAATAGGG - Intergenic
1174156337 20:48517884-48517906 AAGTAAGCTCCATGAGAATAGGG + Intergenic
1177096001 21:16834009-16834031 AAGTCACTTCCTTGAGAATTAGG - Intergenic
1180580913 22:16835951-16835973 AATTGAGTTCCTTTAGTATATGG - Intergenic
1180737694 22:18030629-18030651 AAGTGAGTTGCTTCAGAATTTGG + Intergenic
1182070673 22:27461581-27461603 CTGTGAGCTCCTGGAGAATGAGG + Intergenic
1182137615 22:27920034-27920056 CTGTGAGCTTCTTGAGAACAGGG - Intronic
1182188077 22:28428533-28428555 CTGTAAGCTCATTGAGAATAGGG + Intronic
1183435309 22:37790706-37790728 CAGTTAGTGCATTGAGAGTATGG + Intergenic
1183567162 22:38623731-38623753 CCATGAGTTCCCTGAGAACAGGG + Intronic
1183592449 22:38787852-38787874 CAGTGACTTGTCTGAGAATAGGG - Intronic
1184104186 22:42357971-42357993 CAGTGAGTTACTGGAGAGCAGGG - Intergenic
949379862 3:3432445-3432467 CTGTGACTTCCTTGAGAATAGGG - Intergenic
949409526 3:3748819-3748841 GAGTGAGTTCCTTGAGGGTAGGG - Intronic
949578731 3:5364811-5364833 CAGAATGTTCCTTGAGAATGAGG - Intergenic
951245341 3:20334866-20334888 CTGCAAGTTCCTTGACAATATGG - Intergenic
951596838 3:24327611-24327633 ATGTAAGCTCCTTGAGAATAAGG - Intronic
954469908 3:50684262-50684284 GACTGAGTTTCTTGAGGATAAGG + Intronic
954992849 3:54855869-54855891 CTGTGAGCTCCTTGAGAGCAGGG - Intronic
955277192 3:57557378-57557400 CGGTGAGTTCCTTCTGGATAAGG - Exonic
955790814 3:62587355-62587377 CAGGCAGTTCCTGGAGAAAAGGG - Intronic
955840311 3:63105860-63105882 CTGTGGGTTCCTTGAGAAAAAGG - Intergenic
955986187 3:64576407-64576429 GAGTGAGTTCATTGCCAATAAGG - Intronic
956097740 3:65735022-65735044 AATTGAGTTACTTGAGAATCTGG + Intronic
956141598 3:66151849-66151871 CAGTGAGCTTTTTAAGAATAGGG + Intronic
957073918 3:75586500-75586522 CAGTGATTTTATTGGGAATATGG - Intergenic
957181475 3:76884401-76884423 AAGTGAGTTCTGTGAGAACAGGG - Intronic
957563159 3:81851138-81851160 CAGTAAGTTCCTAGAATATAGGG - Intergenic
960127602 3:114017464-114017486 CTGTGAGTTCTTTGAGGACAAGG + Intronic
960826256 3:121787999-121788021 CTGTGAGTTCTTCAAGAATAAGG - Intronic
961280167 3:125760220-125760242 CAGTGATTTCATTGGGAATATGG + Intergenic
961874237 3:130009352-130009374 CAGTGATTTCATTGGGAATATGG - Intergenic
962743886 3:138383131-138383153 TTGTGAGTTCCTTGAGGAAAAGG + Intronic
962753209 3:138449812-138449834 CTGTGAGTTCCTTGAGGGCAAGG + Intronic
963274203 3:143314113-143314135 CTGTGGGATCCATGAGAATAGGG + Intronic
964110719 3:153084605-153084627 CAGTGATTTCCTTGAGAGGGGGG + Intergenic
964224924 3:154387351-154387373 CTCTGAGTTACTTGAGAACAAGG + Intronic
964887248 3:161498541-161498563 CAGAGGCTTCCTTGAGAAAATGG - Intronic
964918619 3:161867993-161868015 CACTGAGTTCTTTGATAAGAAGG - Intergenic
965291581 3:166888359-166888381 CAGTGAATTCCATGAGCATGAGG + Intergenic
965789482 3:172372424-172372446 CAGTGACTTTATTGAGCATATGG + Intronic
966212300 3:177466052-177466074 CTGTGAGTTCCTTGAGGGCAGGG - Intergenic
966930488 3:184672569-184672591 GTGTGAGCTCCTTGAGAACAGGG - Intronic
966954052 3:184854962-184854984 AAGTGAGTTCCTTCACCATAGGG - Intronic
967553473 3:190827054-190827076 GTGTGAGTTCCTTGAGAGCAGGG - Intergenic
967693248 3:192501846-192501868 CTGTGAGTTCTTTTAAAATAGGG + Intronic
969017501 4:4113810-4113832 CAGTGATTTTATTGGGAATATGG - Intergenic
970179335 4:13373477-13373499 CTGGGAGCTCCTTGAGGATAGGG + Intronic
970837335 4:20426071-20426093 CTGTGAGCTTCTTGAGAACAGGG + Intronic
971781274 4:31037520-31037542 TGATGAGTGCCTTGAGAATATGG + Intronic
972085246 4:35207315-35207337 AAGTGAGTTACATGAGAAAATGG + Intergenic
973566667 4:52195550-52195572 TTGTGAGTTCATTGAGAAAAGGG + Intergenic
973794156 4:54406607-54406629 AAGTAAGTACCTTGAGGATAGGG + Intergenic
973804629 4:54513859-54513881 CAGTAAGTTCCTTGACTCTATGG + Intergenic
973919169 4:55667253-55667275 CAATGAATTCCATGAGAACAGGG + Intergenic
975660372 4:76682512-76682534 CTGTGAGTTCCTTGAAGTTAGGG + Intronic
975779332 4:77821880-77821902 TAGTGAGTTACTTAAGAAAAGGG - Intergenic
975848820 4:78551453-78551475 CAGTGAGTTCCTTAGGTATAGGG + Intergenic
975881687 4:78916514-78916536 CTCTGAGCTCCTTAAGAATAGGG - Exonic
976112964 4:81696585-81696607 CTGTGACTTCCTTGTGAACATGG - Intronic
976401300 4:84610074-84610096 CACTGAGTTCCTTGAAATCAGGG - Intronic
976942898 4:90728188-90728210 CTGTCAGTTCCTTGGGAATGTGG - Intronic
976974122 4:91146275-91146297 CAGTGGGTTCCTTCTTAATATGG + Intronic
977084920 4:92582341-92582363 AAGTGAGTTCCAATAGAATATGG - Intronic
978647071 4:110947465-110947487 CAGTGAATTACTAAAGAATAAGG - Intergenic
981104897 4:140869537-140869559 CAATGAGCTCCTTCAGGATAGGG - Intronic
981178926 4:141716211-141716233 CTGTGAGCTCCTTGAGGACAGGG + Intronic
982047457 4:151463049-151463071 CTGTGAGCTCCTTGAGATTTGGG + Intronic
983971643 4:173882765-173882787 GAGTGAGTACCTTGAGGACAGGG - Intergenic
984328431 4:178283682-178283704 CATTTAGTTCCTGGAGCATATGG - Intergenic
986341061 5:6789629-6789651 CAGTGATTTTCTTGAGGAAATGG - Intergenic
986858622 5:11902560-11902582 CAGTGACTTCCATGAAAACAAGG - Intronic
987597293 5:20018772-20018794 AAGAGAGTTCTCTGAGAATAAGG + Intronic
989801794 5:45551069-45551091 CAGAGTTTTCCTTAAGAATAGGG - Intronic
990596218 5:57314918-57314940 CCATGAGTTTCTTGAGAATAAGG + Intergenic
991019865 5:61969117-61969139 CTGTGAGTTCCTTGAGTTCAAGG + Intergenic
991126590 5:63076606-63076628 CAGTCAGCTCCTTGAGAACTGGG - Intergenic
991306582 5:65182844-65182866 CAGTCATTTTCTTGAAAATATGG - Intronic
991917286 5:71617422-71617444 CTGTTAGCTACTTGAGAATAGGG + Intronic
992654437 5:78894521-78894543 CAGTGAGATCCTTTAGAATCTGG - Intronic
992674144 5:79088810-79088832 CAGTAAGTTCTTGGAGAACAAGG - Exonic
993415267 5:87621051-87621073 TAGTAAGTTCCTTGAGAACATGG + Intergenic
993839140 5:92854550-92854572 CTGTGAGCTCCTTGAAAAAAAGG + Intergenic
994093397 5:95827674-95827696 CAGTGAGTTCCTTGAGGGCAGGG + Intergenic
994903572 5:105806207-105806229 CATTGATTTCCTTCAGGATACGG + Intergenic
994939213 5:106299262-106299284 AAGTCAGTTCCTTGAAATTAAGG - Intergenic
996927466 5:128845440-128845462 CCATGAGTTCCTTGAGAACAGGG + Intronic
996944240 5:129047557-129047579 CAGTGAATTCCATGAGCCTAGGG + Intergenic
997272063 5:132548304-132548326 CTATGAGCTCCTTGAGAATAAGG + Intronic
1001215294 5:169850354-169850376 CAGTGAGCTGCTTAAGAAGATGG - Intronic
1001420654 5:171584273-171584295 CAGTAAGCTCCATGAAAATATGG + Intergenic
1001868736 5:175131456-175131478 CAGTCAGCTCCTGGAGAATTTGG - Intergenic
1001957016 5:175854651-175854673 CAGTGAGTTCTTTGAAGATGGGG - Intronic
1002284020 5:178150302-178150324 CGGTAAGTTCCTTCAGAACAGGG + Exonic
1003844672 6:10160780-10160802 CTGTGAGCTCCTTGAGGACAGGG - Intronic
1004236853 6:13882055-13882077 CAGTGATTTCCTTGACATAAGGG - Intergenic
1004744087 6:18492587-18492609 CCGTGAGCACCTTGGGAATATGG - Intergenic
1004873847 6:19935493-19935515 CTGTGAGTTCCTTGAGAGCAAGG - Intergenic
1005755262 6:28920442-28920464 CTCTGAGTTGCTTGAGAACAGGG - Intronic
1005990735 6:30900163-30900185 GAGTGGGTTCCTTGGGAATTTGG + Intergenic
1006013770 6:31064471-31064493 ATGTCAGTTCCTTGAGAATAGGG + Intergenic
1006218498 6:32467018-32467040 TATTGAGTTCCATGAGAGTAGGG + Intergenic
1006874490 6:37283532-37283554 CAGTGAGTGCCTGGAGAGTGGGG - Intronic
1007210630 6:40191231-40191253 CTGTGAGTTCCTCCAGGATAGGG + Intergenic
1007575374 6:42922305-42922327 AACTGAGTTCCTTGAGAGCAGGG + Intronic
1007900760 6:45409853-45409875 GTGTAAGTTCCTTGAGAACAGGG - Intronic
1008080941 6:47194025-47194047 CTGTGAGCTCCTTGAGGACAGGG + Intergenic
1008207220 6:48676261-48676283 CTATGAGTTCCTAGAGAATATGG + Intergenic
1008368771 6:50711112-50711134 CAATGAGTTTCTTTAGAAAAGGG + Intergenic
1008405120 6:51110604-51110626 CAGTGTTTTCTTTGAGAATGTGG + Intergenic
1008480459 6:51980558-51980580 CAGTGAGCTTCTTGAGAGCAGGG - Intronic
1008840478 6:55896935-55896957 TAATGAGTTCCTTGAGAGCAAGG + Intergenic
1009299247 6:61994055-61994077 CAGTCAGTTCCTTGAGCAGCAGG - Intronic
1009981070 6:70726377-70726399 CAGTGATCTCTTTGAGAACAGGG - Intronic
1010025923 6:71216649-71216671 CTGTGAGCTCCTTGAAAATAAGG + Intergenic
1010636767 6:78269271-78269293 CAGTGAGTTCTATGAAAATCAGG - Intergenic
1012053963 6:94381420-94381442 CTGTGAACTCCTTGAGAAAAAGG + Intergenic
1013251381 6:108337451-108337473 CCGTGAGTTCCTTGGAAACAAGG + Intronic
1013472641 6:110478161-110478183 CCTTGAGTTCCTAGAGAACAGGG + Intergenic
1013658590 6:112271266-112271288 CAGGGTGGTCCGTGAGAATAAGG - Intergenic
1014318782 6:119899347-119899369 CTGTGACTGCCTTGAGAATGTGG + Intergenic
1015905869 6:138115755-138115777 CCGTGAGCTCCTTGAGGAAAGGG + Intergenic
1016298722 6:142605235-142605257 TAATGAGTTCCTTGAAAAAAGGG + Intergenic
1016558530 6:145368262-145368284 CTGTCAGTTCCGTGAGAACAGGG - Intergenic
1017986472 6:159447066-159447088 CAGTGAGTTCCTTGTGGGTAGGG + Intergenic
1018412080 6:163560181-163560203 AAGTAAGCTCCATGAGAATAGGG - Intronic
1019773569 7:2898817-2898839 CTGTCAGCACCTTGAGAATAGGG + Intergenic
1021040009 7:15849704-15849726 CAGTGAGTACATTGAGACTCAGG - Intergenic
1022221927 7:28322164-28322186 AAGTGTGTTACTTGAGAAAAGGG + Intronic
1025108767 7:56195036-56195058 CAGAGATTTCCCTGAGGATAGGG - Intergenic
1027309889 7:76944486-76944508 CAGAGAGTGCCTTGGGATTAAGG + Intergenic
1027903131 7:84144016-84144038 CAGTGATATCCTTTAGAAGAAGG - Intronic
1028078226 7:86541639-86541661 CTGTGAGTTCCTTGTTGATAGGG - Intergenic
1028301099 7:89202050-89202072 CTGTGAGTTTCTTGAAAATAGGG + Intronic
1028829024 7:95306499-95306521 CACTGAGTTCTTTCAGAATTTGG - Intronic
1028872746 7:95787076-95787098 CAGTAAGTTGCTAGAGAATGTGG - Intronic
1029785603 7:102787146-102787168 CTGTGAATGCCTTGAGAGTAAGG + Intronic
1030165702 7:106553024-106553046 CTGTGAGTCACTTGAGATTATGG + Intergenic
1030751038 7:113233153-113233175 CAGAGATTTCCTTCAGAATTTGG - Intergenic
1031387532 7:121170613-121170635 CTGTGAGCTCCATGAGAAGACGG - Intronic
1031654548 7:124337448-124337470 CAGTGAATTCCTTGTGGACAGGG + Intergenic
1031829225 7:126605937-126605959 CTGTGAGTTCCCTGAGAACAGGG + Intronic
1031938194 7:127758429-127758451 CATGGAATTCCTTGAGGATAGGG - Intronic
1032323766 7:130907837-130907859 CAGTGAATTTCTTGAGTAAAAGG - Intergenic
1032360352 7:131249544-131249566 CTGTCAGTTCCTTGAGAACAAGG - Intronic
1032376572 7:131425504-131425526 TTGTAAGTTCCTTGAGGATAGGG + Intronic
1033137300 7:138796166-138796188 CCTTGAGTTCCTTGAGCACAAGG + Intronic
1033171323 7:139086998-139087020 CGTTGAGTTCCTGGAGAATAAGG - Intronic
1034031821 7:147775044-147775066 AACAGAGTTCCATGAGAATAAGG - Intronic
1034356374 7:150453703-150453725 AGGTGAGTTCCATGAGAATAAGG - Intronic
1034720699 7:153290005-153290027 CAGTGAGTTCCCAGCGAATGGGG + Intergenic
1036001204 8:4607163-4607185 CAATTAGTTCCTTGAGTACAAGG - Intronic
1036062853 8:5343982-5344004 CAGTAAGCTCTTTGACAATAGGG + Intergenic
1036357148 8:8053091-8053113 CAGTGATTTTATTGGGAATATGG + Intergenic
1036901422 8:12672163-12672185 CAGTGATTTTATTGGGAATATGG - Intergenic
1037229906 8:16645441-16645463 CACTGAGTTACTTGAGATAATGG - Intergenic
1037968281 8:23150616-23150638 CAGTCAGCTACTAGAGAATATGG + Intronic
1038988516 8:32840219-32840241 CTGTGAGTTCCATGAGGGTAGGG + Intergenic
1039042902 8:33424953-33424975 CTGTAAGTTCCATGAGAACAAGG - Intronic
1040539898 8:48343161-48343183 CAGTGAGCTGCAAGAGAATATGG + Intergenic
1040920708 8:52613407-52613429 CAGTAATTTCCTTTAGAATCGGG + Intergenic
1041614772 8:59893593-59893615 CAGTAAGTTCTTGGAGAACAAGG + Intergenic
1042543636 8:69931452-69931474 CTGTCAGTGCCTGGAGAATAAGG + Intergenic
1042573156 8:70189274-70189296 CTGAGATTTCCTTGAGAAAATGG - Intronic
1042714109 8:71753357-71753379 CAGTGAGTTCCTGAAGAGTTGGG - Intergenic
1042809903 8:72813073-72813095 TGGTGAGTTCCTTGAAGATAGGG - Intronic
1043797009 8:84555363-84555385 CAGTAATTTCCATGACAATATGG + Intronic
1043866876 8:85384813-85384835 CTGTGAGTTTCTTGAGGACAGGG - Intronic
1045664788 8:104472542-104472564 CAGTGTGTCCCCTGAGAATCAGG - Intergenic
1045771807 8:105750212-105750234 CTATGAGTTCTTTGAGGATAGGG - Intronic
1046228874 8:111326543-111326565 AAGTGATTTCCATGAGAATATGG - Intergenic
1046523555 8:115356552-115356574 CAATGAGCTCCTTGGCAATAAGG + Intergenic
1046699180 8:117380815-117380837 CTGTGAGCTCCTTGAGAAGAGGG - Intergenic
1047351855 8:124081634-124081656 CTATGAGCCCCTTGAGAATAGGG - Intronic
1047440960 8:124878303-124878325 CTGTGAGTTCCTTGAGGACAGGG - Intergenic
1047600705 8:126423321-126423343 CTGTGAATTCCTTAAGGATAAGG - Intergenic
1047654274 8:126959743-126959765 CAGGGACATCCTTGAGAAAAGGG - Intergenic
1048141967 8:131803423-131803445 CTGTGAGCTCCTTGAGATCAGGG + Intergenic
1048423919 8:134305041-134305063 GAGTGAGTTACTTGAGGAAAAGG + Intergenic
1048619042 8:136111189-136111211 GAGTGAGTTCCTTGAGGGCAGGG + Intergenic
1050052610 9:1618857-1618879 CTGTAAGCTCCTTGAGGATAGGG + Intergenic
1050585245 9:7103992-7104014 CCGTGAGTTCCTTGAGGGCAGGG + Intergenic
1055091527 9:72368377-72368399 CAGTAAGATCCATGAGAACAGGG - Intergenic
1055410279 9:76021598-76021620 CATTGATTTCCTAGAGAACAGGG - Intronic
1055869406 9:80855738-80855760 CAGTGAGCTTCTGGAGAAAAAGG - Intergenic
1055882641 9:81020070-81020092 CTGTGAGTTCCTTGAGTGGAGGG + Intergenic
1055992853 9:82126316-82126338 CAATCAGTTCCATGAGAACAGGG - Intergenic
1056332908 9:85536274-85536296 CTCTGAATTCCTTGAGGATAAGG + Intergenic
1056478810 9:86980149-86980171 CTGTAAGTTCCTTGAAAGTAAGG - Intergenic
1057624069 9:96661875-96661897 AAGTGAGTTCCTTGAATAGAAGG + Intergenic
1058546679 9:106068068-106068090 AACTGAATTCCTTGAGTATAGGG - Intergenic
1058836122 9:108859845-108859867 CTGTAAGGTCCTTGAGCATAGGG - Intergenic
1059428533 9:114236302-114236324 CAGTGAGTTCCCTAAGAACAAGG + Intronic
1059527311 9:115004539-115004561 CACTGAGTTCCTTGAGATCAGGG + Intergenic
1059598497 9:115749146-115749168 CAGTGAATTCCTTGAAAACATGG + Intergenic
1059624667 9:116049870-116049892 CTGTGAGCTCTCTGAGAATAGGG + Intergenic
1060143896 9:121234566-121234588 AAGTGAATTCCTTGATAAGAGGG + Intronic
1060901906 9:127265988-127266010 CAGTAAGCTCCTTAAGAACAAGG - Intronic
1061824101 9:133247173-133247195 AAGTGAGCTCCTTGAGGACAGGG - Intergenic
1186546375 X:10454149-10454171 CACTGAGTTCTCTAAGAATAAGG - Intronic
1186598696 X:11012303-11012325 CAGTAAGTGCCTTTAGGATAGGG - Intergenic
1186808141 X:13160761-13160783 CAGAGAGTTGTGTGAGAATATGG + Intergenic
1186972770 X:14866577-14866599 CAATGAGTTTGTTCAGAATAAGG - Intronic
1187222411 X:17341176-17341198 TGGTGAATTCCTTGAGCATAAGG + Intergenic
1188905879 X:35791004-35791026 CTGTGATTTCGTTGATAATATGG + Intergenic
1189313194 X:40034379-40034401 CAGTGAGTTCATTGAGCGTCAGG - Intergenic
1190733491 X:53239950-53239972 CTGTGAGCTCCCTGAGAACAGGG + Intronic
1191866797 X:65710300-65710322 CAGTAAGTGCCTTGAGATCAGGG + Intronic
1194301633 X:92194076-92194098 CAGTAAGTACTTTGAAAATAAGG + Intronic
1194895586 X:99435526-99435548 AAGTGAGTTCCTTGATCAGAAGG + Intergenic
1195714662 X:107806964-107806986 ATGTGGGCTCCTTGAGAATAGGG + Intergenic
1196050381 X:111297998-111298020 CAATGATTTCTTTTAGAATATGG - Exonic
1196574050 X:117297886-117297908 CAGTGAGTTGCTGGATCATATGG + Intergenic
1197088319 X:122506508-122506530 AAGAGAGTTCCTTAAGAAAAAGG + Intergenic
1197108036 X:122739295-122739317 CTATGATTTCCTTGAGAAAAGGG - Intergenic
1197665218 X:129215960-129215982 CTGGGAGCTCCTTGAGAACAGGG + Intergenic
1197665263 X:129216412-129216434 CTGTGGGTTCCTTGAGAATAGGG - Intergenic
1197675694 X:129327557-129327579 CACTGAATTCCTGGAGGATAGGG - Intergenic
1197731083 X:129810624-129810646 CAATGAGCTCCTTGAGAGCAGGG + Intronic
1198157948 X:133981288-133981310 CTGTGAGCTCCTTGACAAAAGGG + Intronic
1198374834 X:136028412-136028434 CTGTGAGTTCCTTGAGGGCAGGG + Intronic
1198417508 X:136435471-136435493 CAGTGACTTCCTTGAGAACAGGG + Intergenic
1199418039 X:147609442-147609464 CTGTGAGTTCCTTGAGGCTATGG + Intergenic
1200354724 X:155536186-155536208 CTGTGAGTATCTTGAGGATAGGG + Intronic