ID: 1169108306

View in Genome Browser
Species Human (GRCh38)
Location 20:3016250-3016272
Sequence GAACCAGCCTGGACCCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 198}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169108306_1169108308 -8 Left 1169108306 20:3016250-3016272 CCTCACAGGGTCCAGGCTGGTTC 0: 1
1: 0
2: 1
3: 16
4: 198
Right 1169108308 20:3016265-3016287 GCTGGTTCTCCCCCAGCTCATGG 0: 1
1: 0
2: 1
3: 24
4: 205
1169108306_1169108309 -7 Left 1169108306 20:3016250-3016272 CCTCACAGGGTCCAGGCTGGTTC 0: 1
1: 0
2: 1
3: 16
4: 198
Right 1169108309 20:3016266-3016288 CTGGTTCTCCCCCAGCTCATGGG 0: 1
1: 0
2: 0
3: 27
4: 190
1169108306_1169108316 25 Left 1169108306 20:3016250-3016272 CCTCACAGGGTCCAGGCTGGTTC 0: 1
1: 0
2: 1
3: 16
4: 198
Right 1169108316 20:3016298-3016320 CACCATTATTCACAGATAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169108306 Original CRISPR GAACCAGCCTGGACCCTGTG AGG (reversed) Intronic
900640802 1:3687276-3687298 GAACCAGCCAGGGTCCTGAGAGG - Intronic
901207110 1:7503602-7503624 GAAGCAGCCTGGCCACTGTCAGG - Intronic
901422979 1:9163280-9163302 GAACAAGGCTGTACCCTGGGAGG - Intergenic
903580435 1:24366629-24366651 GAGCCAGCCTGGACCCACAGAGG - Intronic
904946307 1:34201083-34201105 GAGCCACCCTGAAGCCTGTGAGG - Intronic
911234107 1:95391403-95391425 GAACCAGCCTCTCCCCTGTGTGG + Intergenic
911408015 1:97465909-97465931 AGACCAGCCTGGACAATGTGGGG + Intronic
911536415 1:99105947-99105969 GAACCAGCTTGGCCACAGTGCGG + Intergenic
912230135 1:107783604-107783626 GTACCATCCTGAACCCAGTGAGG + Intronic
912431847 1:109632222-109632244 CATCCAGCCTGTTCCCTGTGAGG + Intergenic
914343625 1:146780001-146780023 GGACCAGTCTGTACCCTGTCTGG - Intergenic
915571956 1:156749697-156749719 GACCCACACTGGCCCCTGTGAGG - Intronic
915999855 1:160605466-160605488 GTACCAGCCTGGAGCCTGGTAGG - Intergenic
916003697 1:160639873-160639895 GAAACAGCCAGGAGCCAGTGTGG - Intronic
917476764 1:175375501-175375523 GCACCAGCCTGGACTCTGTGTGG + Intronic
920921680 1:210302670-210302692 GAACCAGCCAGCTCCATGTGAGG - Intergenic
1065402400 10:25320400-25320422 GAAGCTGCCTGGACCATCTGTGG + Intronic
1069652676 10:70061232-70061254 AGACCAGGCTGGACCCAGTGAGG + Intronic
1069677665 10:70260204-70260226 GAACCAGCAAGGAGCCAGTGGGG + Intronic
1069717430 10:70530017-70530039 GGACCCGCCTGAACCCTGAGAGG - Exonic
1070783715 10:79151351-79151373 GAATCAGCCTTTTCCCTGTGAGG + Intronic
1071509613 10:86253295-86253317 GCTCCAGCCTGGTGCCTGTGGGG - Intronic
1074425478 10:113347589-113347611 GGCCCAGCCTGGACCCTGGCTGG - Intergenic
1075166655 10:120073986-120074008 GGAACAGCCTTGAACCTGTGGGG + Intergenic
1075416371 10:122267533-122267555 GCAGCAGCCTGGACCCTGGCTGG + Intergenic
1075619957 10:123919149-123919171 GACCCAGACTGGACCCTGGGTGG + Intronic
1076138264 10:128059646-128059668 GAACCAGCCTGGTCCCAGCCTGG + Intronic
1078566026 11:12415017-12415039 GAACCAGCCTGGGCACTGGTGGG + Intronic
1079400566 11:20103401-20103423 GAACCAGCCTTTACCATTTGTGG - Exonic
1081807349 11:45897750-45897772 GCACCTGCCTTGACCCTGGGAGG + Intronic
1081854448 11:46295046-46295068 GAACCAGCCTGGGCCGGGGGAGG + Intronic
1083332635 11:61906073-61906095 GAGGCTGCCTGGACCCCGTGTGG - Intronic
1084889565 11:72230036-72230058 CAACCACCCTTGGCCCTGTGAGG - Intronic
1085323796 11:75591521-75591543 GAACCAGCTTCCACCCTGAGGGG - Intronic
1086468188 11:87076527-87076549 GTACCAGCTTGGACACAGTGGGG - Intronic
1088418839 11:109620107-109620129 AACCCAGCCTCCACCCTGTGAGG + Intergenic
1089158932 11:116423227-116423249 GGACAAGGCTGGACCCAGTGAGG + Intergenic
1091339907 11:134802253-134802275 CAAGCAGGCTGGAGCCTGTGGGG - Intergenic
1091763314 12:3102011-3102033 AAACCATCCTTGACCCAGTGGGG - Intronic
1092239150 12:6826918-6826940 GAAGAAGCCAGGACCCCGTGGGG - Exonic
1093707858 12:22295298-22295320 GACCCAGCCAGGACCCTACGAGG - Intronic
1095960859 12:47833467-47833489 GAAGCAGCCTGGAGCCAGCGAGG + Intergenic
1096543636 12:52322454-52322476 CAATCAGCCTGGACATTGTGAGG - Intergenic
1096572215 12:52530122-52530144 GAATCTGCCAGGACCCTCTGCGG + Intergenic
1098683248 12:73384914-73384936 AAACCAGCCTGGAGCATGTAAGG + Intergenic
1099818526 12:87679442-87679464 GAACCAGCCTCCACCCAGTCTGG + Intergenic
1100348778 12:93758187-93758209 AAACCAGTCTCTACCCTGTGGGG + Intronic
1101742207 12:107509496-107509518 CAGCCAGCCTGAAGCCTGTGAGG - Intronic
1102203831 12:111076663-111076685 GAAACAGACTGGAACCTGGGAGG - Intronic
1104989588 12:132618411-132618433 GAACCGGCCTGGACGGGGTGGGG + Intergenic
1105752437 13:23433696-23433718 GGAGCCGCCTGGACCCAGTGCGG - Exonic
1110544707 13:76743602-76743624 GAACCCTACTGGATCCTGTGTGG - Intergenic
1111045929 13:82812950-82812972 GCCCCAGCATGGACTCTGTGTGG - Intergenic
1113774988 13:112938910-112938932 GAACCTGCCTGGCCCCCGCGTGG - Intronic
1113808732 13:113124456-113124478 GGGCCGGCCTGGACCCTGGGTGG + Intronic
1115128293 14:30023027-30023049 CAAGCAGCCAGGTCCCTGTGTGG + Intronic
1117358201 14:54946684-54946706 GAACCAGCCTGGGCAATGTAGGG - Intronic
1121444828 14:93972291-93972313 GGACCACCCTGGATCCTGGGGGG - Intronic
1121953405 14:98192473-98192495 GAACCATACTGGACACTGAGAGG + Intergenic
1122754268 14:103965516-103965538 GAGCGTGCCTGGACCCTGGGAGG + Exonic
1122958828 14:105085271-105085293 AAACCAGCCTGAACCCAGCGAGG + Intergenic
1125720569 15:41843277-41843299 GGACCAGCCTGGCCAATGTGGGG - Intronic
1126285790 15:47009198-47009220 GTACCAGCTTGGTCACTGTGGGG - Intergenic
1126439791 15:48675149-48675171 AAGCCTGCCTGGTCCCTGTGTGG + Intergenic
1126440547 15:48683660-48683682 GTACCAGCCTGGCCACAGTGGGG + Intergenic
1128296507 15:66525244-66525266 GAACCAGCCAGCACCATGGGTGG - Intronic
1129448238 15:75633875-75633897 GAACCAGCCTGGCCCCAGGTAGG + Intergenic
1132980559 16:2736841-2736863 AAACCAGCCTGGACACTATGGGG - Intergenic
1133025157 16:2985990-2986012 GGACCAGGCTGGACCCAGTCGGG - Intergenic
1133190724 16:4131804-4131826 GGCCCTTCCTGGACCCTGTGTGG - Intergenic
1136236667 16:28918320-28918342 GAACCAGCCTGGGCCGGGCGCGG + Intronic
1137716245 16:50600065-50600087 GAACCAGCCTGACCACTGTGGGG + Intronic
1138904002 16:61308213-61308235 GTAGCACCCTTGACCCTGTGGGG + Intergenic
1139556868 16:67717947-67717969 GAACCTGCCTGGACCAAGAGAGG - Intronic
1139990366 16:70935333-70935355 GGACCAGTCTGTACCCTGTCTGG + Intronic
1140133799 16:72187435-72187457 GATCCACCCTGTACCCTGTAGGG + Intergenic
1142434810 16:90049470-90049492 CAACCAGACTGGCCCCAGTGGGG + Intergenic
1142639729 17:1279093-1279115 GATCCTGCCTGGACCCTGCATGG - Intergenic
1142741652 17:1935057-1935079 GACCCAGCAAGGGCCCTGTGTGG - Exonic
1143248582 17:5505428-5505450 GAACCTGTCTGGGCGCTGTGAGG + Intronic
1143766831 17:9143328-9143350 GGACCAGCCTGAGCCCTGGGTGG + Intronic
1144789409 17:17849128-17849150 GAACCAGCCTGCACCGTTTTTGG - Intronic
1144998226 17:19285648-19285670 GACCCAGCGGGGCCCCTGTGCGG - Exonic
1146142537 17:30379762-30379784 GAACCAGCCTCGGCCCTTGGAGG - Intronic
1147537063 17:41327996-41328018 CAGCCAGCCTGAACCCTGGGAGG + Intergenic
1147674239 17:42193697-42193719 GAAGAAGGCAGGACCCTGTGGGG + Intronic
1151400592 17:73853436-73853458 CATCCAGCCTGCCCCCTGTGGGG + Intergenic
1151424663 17:74023195-74023217 GAACCAACCTCCACCCTGGGTGG - Intergenic
1151553553 17:74835520-74835542 GACCCAGCCTGCTCCCTGCGAGG + Intronic
1154358702 18:13641963-13641985 GGCCCAGCCTGGGCCCTGGGCGG + Intronic
1155797650 18:30060029-30060051 CAACCAGCCTGCACACTGGGAGG - Intergenic
1156842323 18:41623743-41623765 GAAGCAGCATGGAACATGTGAGG - Intergenic
1157309331 18:46540376-46540398 GAAACAGCCTCGACCCTGCTGGG + Intronic
1160240501 18:77119227-77119249 GAAGCCACCAGGACCCTGTGGGG + Intronic
1160860926 19:1236999-1237021 GGAGCCGCCTGGACGCTGTGCGG + Intronic
1161324608 19:3657496-3657518 GACCCAGCGTTGACCCTGGGGGG - Intronic
1161522734 19:4734439-4734461 GAACCAGCCTGGACCTTAAAAGG + Intergenic
1162696622 19:12481718-12481740 ACACCAGCCTGGACACAGTGAGG + Intronic
1164416210 19:28048358-28048380 GAACTGGCCTGGATCCTGTGAGG + Intergenic
1164416624 19:28051042-28051064 GAACCAGGCTGGACCCAATGAGG - Intergenic
925267881 2:2579963-2579985 GATTCAGCCTGGACCCTGGGGGG - Intergenic
926136125 2:10337817-10337839 GAACCAGCCTGCACCTCCTGGGG - Intronic
926892541 2:17650448-17650470 GACCCAGCCTGGAGCCTGGCAGG + Intronic
927109216 2:19852230-19852252 GTTCCAGCCTGGGGCCTGTGGGG - Intergenic
927224192 2:20746180-20746202 TAACCAGTCTGGAATCTGTGTGG - Intronic
928204074 2:29271694-29271716 CAACCAGCCAGGGCCCAGTGGGG + Intronic
928395551 2:30940891-30940913 CATCCAGTCTGGACCCTGTATGG + Intronic
929057294 2:37889381-37889403 AAGTCGGCCTGGACCCTGTGGGG - Intergenic
930244563 2:48969901-48969923 GCACCAGCTTGGACCTGGTGGGG + Intronic
932565208 2:72901827-72901849 GACCATGCCTGGAGCCTGTGAGG - Intergenic
934989839 2:98913466-98913488 GTACAAGACTGGAGCCTGTGGGG + Intronic
935341207 2:102061378-102061400 TGACCAGCATGGGCCCTGTGTGG - Intergenic
936142014 2:109948637-109948659 GATGCAGCATGGACCCTGAGGGG - Intergenic
936178704 2:110246597-110246619 GATGCAGCATGGACCCTGAGGGG - Intergenic
936202674 2:110422835-110422857 GATGCAGCATGGACCCTGAGGGG + Intronic
938705087 2:133916820-133916842 CAACCAGCCTGCACACTGGGAGG + Intergenic
940270990 2:151889801-151889823 GACGCAGCCTGGACCCTGCTAGG - Intronic
942209431 2:173655491-173655513 GGACCTGCCTGGAACCTGTAGGG - Intergenic
946654407 2:221930402-221930424 GGACCTGCCTGGTCCTTGTGTGG - Intergenic
948173730 2:235927287-235927309 GAACCAACCTGGAACCTCTGGGG - Intronic
1169075000 20:2754976-2754998 TCTCCAGCCTGGGCCCTGTGGGG - Intronic
1169108306 20:3016250-3016272 GAACCAGCCTGGACCCTGTGAGG - Intronic
1169146132 20:3253695-3253717 GGAACAGCGTGGTCCCTGTGTGG - Intronic
1169483076 20:6002630-6002652 AAACCAGCCTGGGCACTGTGAGG - Intergenic
1169699698 20:8432338-8432360 CAACCAGCCTGCACACTGGGAGG - Intronic
1170099053 20:12678680-12678702 GAAACAGCCTGGGTCCTGGGTGG - Intergenic
1170290325 20:14762062-14762084 GAACCAGCCGAGGCCCTGAGCGG - Intronic
1171119653 20:22557646-22557668 CAGCCAGCCAGCACCCTGTGAGG + Intergenic
1172166532 20:32903081-32903103 GATCCAGCCAGGGCCCTGTATGG + Intronic
1172646055 20:36470310-36470332 GAGGAAGCCTGGACACTGTGGGG - Intronic
1172689870 20:36782993-36783015 GAAAGAGCCTGGACGCTGGGTGG + Exonic
1172752305 20:37259350-37259372 GAGGCAGCCTGGACCAGGTGGGG - Intronic
1174105800 20:48161396-48161418 GAGCAAGCCAGGACCCTCTGGGG - Intergenic
1175241813 20:57555270-57555292 GGACCTGCCTGCACCCTGAGTGG + Intergenic
1176037243 20:63045569-63045591 GAAACAGACTGGAGCGTGTGGGG + Intergenic
1176411106 21:6450071-6450093 GAACCAGTCTGGGCCCTGGTGGG + Intergenic
1179686599 21:43058393-43058415 GAACCAGTCTGGGCCCTGGTGGG + Intronic
1180869673 22:19139030-19139052 GAACCATCTGGGGCCCTGTGCGG - Intronic
1181313596 22:21958402-21958424 GCACCAGGCTGGACTCTGAGGGG - Intronic
1181346704 22:22224474-22224496 GCACCAGGCTGGACTCTGAGGGG - Intergenic
1181471816 22:23145335-23145357 GAACCTGCCTGGAGTCTGGGCGG - Exonic
1181575249 22:23790073-23790095 GAACCAGCCTTCACCCTCTTGGG - Intronic
1182412900 22:30202256-30202278 CAGCCTGCCTGGACCCTGTCAGG - Intergenic
1182477745 22:30585343-30585365 GAGCCACCCTGGGCACTGTGTGG + Intronic
1182857669 22:33532359-33532381 GACCCAACCTAGATCCTGTGGGG - Intronic
1183953311 22:41364570-41364592 GCACCAGCCTAAACCCTGTGAGG - Intergenic
949791867 3:7801616-7801638 GAACCAGCTTGGCACCTTTGAGG - Intergenic
951093055 3:18597849-18597871 GTCCCAGCAGGGACCCTGTGTGG + Intergenic
953748980 3:45595365-45595387 CCACCAGCCAGGCCCCTGTGAGG + Exonic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
954968678 3:54633660-54633682 CAACCAGCCTGTACACTGGGAGG - Intronic
959431167 3:106256614-106256636 GAACCAGCCTGCTGGCTGTGTGG - Intergenic
967622528 3:191650779-191650801 GCCCCAGTCTGGACTCTGTGTGG + Intergenic
967984541 3:195085348-195085370 GAACCAGCTTGGAGCCGGAGCGG - Intronic
968905518 4:3448985-3449007 CCACCAGCATGAACCCTGTGTGG - Intronic
970667801 4:18358098-18358120 GAACCTGCCTGGTCCCTGTACGG + Intergenic
979442985 4:120774500-120774522 GAACCAGGCTGTAGCCTGGGAGG + Intronic
980222391 4:129935862-129935884 TAACCAGAATGGACCCTGAGAGG - Intergenic
986302655 5:6490462-6490484 GAACACGCCTGGTCACTGTGAGG + Intronic
986539069 5:8825259-8825281 GAACCAGCCTGCACACTGGGAGG - Intergenic
986625083 5:9716162-9716184 CAACCAGCCTGGTCACTGGGAGG + Intergenic
987846630 5:23295700-23295722 GTACCAGCCGGGACCCTGAGTGG - Intergenic
990890379 5:60642442-60642464 GGACCAGGGTGGTCCCTGTGAGG - Intronic
994877718 5:105447043-105447065 CAATCAGCCTGGGCCCTGGGAGG + Intergenic
996709023 5:126525727-126525749 CAACCAGCCTGCACACTGGGAGG + Intergenic
1001042351 5:168345977-168345999 GAGCCTGCGGGGACCCTGTGTGG + Intronic
1002173119 5:177386213-177386235 GGACCAGCCTGGACTCTGGATGG - Exonic
1002982830 6:2158830-2158852 TAACCACCGTGGACACTGTGGGG - Intronic
1005944781 6:30587352-30587374 AAACCAGCCTGAGCCCAGTGTGG + Intronic
1006912467 6:37572265-37572287 GAACCAGCGGAGACCCTGGGTGG - Intergenic
1007623607 6:43229582-43229604 GATCCAGCCGGGACCCTTTCGGG + Intergenic
1016389506 6:143560983-143561005 GAACCAGCAAGGACTCTGGGGGG + Intronic
1017070936 6:150575180-150575202 GAATCAGCCTTGAACCTGGGAGG + Intergenic
1019218282 6:170457466-170457488 GAACCAGGCAGGCCCCTCTGTGG - Intergenic
1019390774 7:785643-785665 AAACCAGCGTGGTCACTGTGTGG - Exonic
1019500552 7:1362414-1362436 GGACCAGCCTGGGCCCAGTGTGG - Intergenic
1019547332 7:1584823-1584845 GACCCAGCCTGGGTACTGTGGGG - Intergenic
1021857668 7:24873299-24873321 GAGCCACTCAGGACCCTGTGTGG - Intronic
1024035301 7:45503058-45503080 CAACCAGCCTGCACACTGGGAGG - Intergenic
1026513896 7:71049947-71049969 GAGCCTGCCTGGAGGCTGTGGGG - Intergenic
1026899784 7:74030377-74030399 GAAACAGCCTGGGAGCTGTGCGG - Intronic
1028140926 7:87274136-87274158 GCCCCAGCGGGGACCCTGTGTGG + Intergenic
1028583871 7:92434255-92434277 GAACCAGCCTGGACCAGGACTGG + Intergenic
1029114583 7:98230742-98230764 GACCCACCCTGGGCCCAGTGGGG + Intronic
1029222941 7:99004481-99004503 GCTCCAGGGTGGACCCTGTGGGG + Intronic
1029257225 7:99277748-99277770 CATACAGCCTGGACCCTGGGAGG + Intergenic
1029812940 7:103067556-103067578 GACCCAGCCTCCACGCTGTGAGG + Intronic
1034301330 7:150017717-150017739 GAACAAGCATGGCCCCTTTGAGG - Intergenic
1034308170 7:150063459-150063481 GAGCCAGCTTTGACCCTGGGAGG - Intergenic
1034635593 7:152565046-152565068 GAAACAGCCTGGCACCTCTGAGG + Intergenic
1034798683 7:154037212-154037234 GAGCCAGCTTTGACCCTGCGAGG + Intronic
1037623790 8:20590277-20590299 CAACCAGCCTGCACACTGGGAGG + Intergenic
1037659393 8:20913901-20913923 GAATCAGTCTGGATCCTGGGTGG - Intergenic
1038071759 8:24023714-24023736 GATCCAGCCAGGACCCTAAGAGG + Intergenic
1040684621 8:49857086-49857108 GCACCAGACTGGACCCTGAGAGG + Intergenic
1040786058 8:51164581-51164603 TCATCTGCCTGGACCCTGTGAGG + Intergenic
1041793070 8:61717057-61717079 GACCCAGTATGGACTCTGTGTGG + Intergenic
1041872294 8:62648781-62648803 CAACCAGCCTGGACCCATGGAGG - Intronic
1042298017 8:67243067-67243089 GGACCTGCCTGGAACCTGGGGGG + Intronic
1046810222 8:118525130-118525152 GAAACAGCGAGGAGCCTGTGTGG - Intronic
1052616654 9:30851169-30851191 CAACCAGCCTGCACACTGGGAGG + Intergenic
1052617160 9:30855491-30855513 CAACCAGCCTGCACACTGGGAGG + Intergenic
1054452332 9:65409874-65409896 GAACCACCCTGGCCTCTGAGGGG - Intergenic
1056021298 9:82440965-82440987 GCACCAGCTGGGACACTGTGTGG - Intergenic
1057444561 9:95104517-95104539 GGGCCAGCCTGCATCCTGTGTGG - Intronic
1060492791 9:124097328-124097350 GACCCAGCAGGGACTCTGTGGGG + Intergenic
1060549744 9:124479300-124479322 GAAGCAGCCGAGACCCAGTGAGG + Intergenic
1061010068 9:127949600-127949622 CAATCAGCCTGGACCCTTTCTGG + Intronic
1061034934 9:128108154-128108176 GAGCTGGCCTGGACCCTGTCAGG + Exonic
1061757380 9:132824458-132824480 GAACCTGCCTGGTTCCTGGGTGG - Intronic
1062305815 9:135906866-135906888 GGCCCAGCCCCGACCCTGTGCGG + Intronic
1188820575 X:34770029-34770051 GAACCTGCCTGCACTCTGTGTGG - Intergenic
1189042115 X:37553719-37553741 CAACCAGCCTGCACACTGGGTGG - Intronic
1192836197 X:74802109-74802131 GGACCTGCCTGGGTCCTGTGGGG + Intronic
1195444558 X:104937042-104937064 GAAGCAGGCTGAGCCCTGTGTGG - Intronic
1199878565 X:151954678-151954700 GTACCAGCTGGTACCCTGTGGGG - Exonic