ID: 1169108536

View in Genome Browser
Species Human (GRCh38)
Location 20:3018109-3018131
Sequence GTTGTTTGACTACCAAATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169108536_1169108541 17 Left 1169108536 20:3018109-3018131 CCTGTATTTGGTAGTCAAACAAC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1169108541 20:3018149-3018171 CAGCCTGAAAGAGACTGACTTGG 0: 1
1: 0
2: 1
3: 23
4: 172
1169108536_1169108542 18 Left 1169108536 20:3018109-3018131 CCTGTATTTGGTAGTCAAACAAC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1169108542 20:3018150-3018172 AGCCTGAAAGAGACTGACTTGGG 0: 1
1: 0
2: 0
3: 20
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169108536 Original CRISPR GTTGTTTGACTACCAAATAC AGG (reversed) Intronic
911178223 1:94838761-94838783 ATGCTTTGACTCCCAAATACTGG + Intronic
911750653 1:101493295-101493317 GTTGTTTGACTAATAAATTCAGG - Intergenic
911904788 1:103553039-103553061 GGTGTTTAACTGCCAAATATGGG + Intronic
912145198 1:106785235-106785257 GTTGTCTGACCACCAACTTCTGG + Intergenic
915553661 1:156649300-156649322 GATCTTTAACTACCAAATACTGG + Intronic
917822944 1:178784254-178784276 GTTGTTAGAGTACCAGATAAAGG - Intronic
920822223 1:209391904-209391926 GTTGTTTGGCTTCCAACCACGGG - Intergenic
1063267230 10:4466649-4466671 GGTGTTTGCCTACAAAATAAAGG - Intergenic
1065117109 10:22493693-22493715 GTGGTTTGACTTCCAATTTCTGG + Intergenic
1069266967 10:66471764-66471786 GTTGTTTGACTATTCAATTCTGG + Intronic
1078017179 11:7624917-7624939 TTTGTTTGACTCCAAAATCCAGG + Intronic
1080895265 11:36443777-36443799 GTTGAGTGTCTACCATATACTGG + Intronic
1081145495 11:39558085-39558107 GTTGTTTGGCTAGCATTTACAGG + Intergenic
1086632721 11:89042724-89042746 CTTGTTTGACTTCTAAAAACTGG - Intronic
1089379954 11:118022471-118022493 GTTGTTTAATTTCCAAATATTGG - Intergenic
1090194303 11:124801203-124801225 GTTCTTTGAGTACGAAAAACCGG - Intergenic
1091250555 11:134140748-134140770 GTTTTTTGACAACAAAATTCAGG + Exonic
1092594108 12:9981569-9981591 GTTATTTGGCTACAAAATTCTGG + Intronic
1093280566 12:17190500-17190522 GTACTCTGTCTACCAAATACTGG + Intergenic
1094627525 12:32138131-32138153 GTTCATTGCCTACCACATACTGG + Intronic
1095103649 12:38206753-38206775 GTTTTTTGACTCCCAAGGACAGG - Intergenic
1101230053 12:102731657-102731679 ATGGTTTGGCTACCTAATACAGG + Intergenic
1101292945 12:103389646-103389668 GTTGAATGAATATCAAATACTGG - Intronic
1101553222 12:105782953-105782975 GTTGTTTGCCTAAAAAATAAGGG - Intergenic
1102862317 12:116346729-116346751 TTTCTTTAACTACCAAATGCTGG + Intergenic
1105661614 13:22502102-22502124 TTTCTTGGACTACAAAATACAGG + Intergenic
1106035871 13:26044786-26044808 TTTGTTTAATTACAAAATACTGG + Exonic
1107806527 13:44158641-44158663 TTTATTGGACCACCAAATACTGG + Intronic
1110610737 13:77485148-77485170 GTTGTTGTGCTATCAAATACTGG + Intergenic
1114978114 14:28127054-28127076 GTTGTTTGTCTTCCAAAATCAGG + Intergenic
1116434691 14:44883958-44883980 GTTGTTTGAGTTCCATATACTGG - Intergenic
1123504947 15:20932680-20932702 GTTTTTTGACTCCCAAGGACAGG - Intergenic
1123562192 15:21506374-21506396 GTTTTTTGACTCCCAAGGACAGG - Intergenic
1123598437 15:21943661-21943683 GTTTTTTGACTCCCAAGGACAGG - Intergenic
1128294103 15:66503029-66503051 TTTGTTTCACTACCTAAGACTGG - Intronic
1128830555 15:70763993-70764015 CCTGTTTTACTACCAAATCCTGG + Intergenic
1129576641 15:76756002-76756024 GTTATCTGCCTCCCAAATACTGG - Intronic
1131234964 15:90688089-90688111 GTTGTTTAATTTCCAATTACTGG + Intergenic
1132135038 15:99327989-99328011 GTTGTTTAATTTCCAAATACGGG + Intronic
1202970539 15_KI270727v1_random:233516-233538 GTTTTTTGACTCCCAAGGACAGG - Intergenic
1133105033 16:3501936-3501958 GTTTCCTCACTACCAAATACAGG - Intronic
1136482959 16:30554177-30554199 GATATTTTACAACCAAATACAGG - Exonic
1146241289 17:31229444-31229466 GTTTTTTGACTCCCAAGGACAGG + Exonic
1149259785 17:54866368-54866390 GTAAATTCACTACCAAATACTGG - Intergenic
1154248619 18:12723013-12723035 GGTGTTTGAGAACCAAGTACTGG + Intronic
1155065052 18:22261868-22261890 CCTGTTTGACTAAAAAATACTGG + Intergenic
1157704604 18:49793340-49793362 GTTGTTTTAAAACCAAATAAGGG - Intronic
1167534160 19:50038979-50039001 TTTCTTTGCCTACAAAATACAGG + Intronic
925472976 2:4182795-4182817 GTGGTTTGTTTCCCAAATACAGG + Intergenic
928261211 2:29768295-29768317 GTTGTTTAATTACCATTTACTGG - Intronic
930547654 2:52789560-52789582 GTTGTTTGTTTTCCAAATATGGG + Intergenic
930889803 2:56371243-56371265 GTTTTGTGAGTACCAACTACTGG + Intronic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
937409825 2:121664373-121664395 GGTGTTTGAATACGAAATAAAGG - Intergenic
937500945 2:122478248-122478270 GTTGCTTGAATTCCAATTACTGG + Intergenic
939358252 2:141132638-141132660 GTTGTTTAACTATTATATACTGG - Intronic
939812363 2:146850002-146850024 GGTTTTTGGCTACCAAATATTGG + Intergenic
940549451 2:155134396-155134418 GTTGTCTGACTTGGAAATACTGG + Intergenic
943337142 2:186629726-186629748 TTTGTTTGCCACCCAAATACAGG - Intronic
1169108536 20:3018109-3018131 GTTGTTTGACTACCAAATACAGG - Intronic
1172114651 20:32566506-32566528 GTCTTTTGATTCCCAAATACAGG + Intronic
1173024214 20:39293094-39293116 ATTGTTTCTCTACCAAAGACAGG + Intergenic
1174883992 20:54311695-54311717 GTTGTTAGAATACCATAAACTGG + Intergenic
1177126233 21:17196245-17196267 CCTGTTTGACTTCCAAATGCTGG + Intergenic
949189526 3:1235550-1235572 GGTGTTTAAATAGCAAATACAGG + Intronic
956809844 3:72854144-72854166 GTTGTTTGACTTTCTAATAATGG + Intronic
957515646 3:81247426-81247448 GTTGTTTGAGTACCTAATGTGGG + Intergenic
957991313 3:87631037-87631059 GTGGTTGGACAACCAAATCCAGG - Intergenic
958266154 3:91439790-91439812 CTTGTTTTACTATCAAATAATGG - Intergenic
965169823 3:165248700-165248722 TTTGCTAGACTACCAAATTCAGG + Intergenic
970915775 4:21332725-21332747 GTTGTTTCAGTACTAAACACAGG - Intronic
979563473 4:122126810-122126832 GTTATTTCACTATCAAAAACAGG + Intergenic
982069197 4:151680668-151680690 GTTTTCTGACTTCTAAATACAGG + Intronic
987101368 5:14594126-14594148 GTTGTTTTTCTACCAGTTACGGG - Intronic
991117701 5:62973075-62973097 ATTGTTTGAATACCTAAGACAGG + Intergenic
992373197 5:76166374-76166396 GATGTTTAGCTACCAAATAGGGG - Intronic
992979237 5:82150579-82150601 TATGTTTGACTTCCAAATGCTGG - Intronic
993043036 5:82836946-82836968 GTTGTTTAAGTAAAAAATACTGG - Intergenic
998975068 5:147636384-147636406 TTTGTTTGCCTGCCAAAGACTGG + Intronic
1008989120 6:57582183-57582205 CTTGTTTTACTATCAAATAATGG + Intronic
1009177654 6:60480424-60480446 CTTGTTTTACTATCAAATAATGG + Intergenic
1012477527 6:99631023-99631045 GGTGTTTGACACCCCAATACTGG + Intergenic
1013918832 6:115375344-115375366 GTTGTTTGAGAATCAAAGACAGG - Intergenic
1015703095 6:136057565-136057587 TTTAGTTGACAACCAAATACTGG - Intronic
1016497600 6:144682052-144682074 CTTGTTTTGCTATCAAATACTGG + Intronic
1017115329 6:150970811-150970833 ATTGTTAGACTTCCAAACACAGG - Intronic
1018611022 6:165647974-165647996 GGTGTTTGTTTAACAAATACAGG + Intronic
1020945900 7:14605998-14606020 CTTGTTTAACTATGAAATACAGG + Intronic
1034856306 7:154551265-154551287 CTTGTTTGATTAGCAAATGCAGG + Intronic
1034926175 7:155124148-155124170 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926177 7:155124170-155124192 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926179 7:155124192-155124214 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926184 7:155124236-155124258 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926186 7:155124258-155124280 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926188 7:155124280-155124302 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926190 7:155124302-155124324 GTTGTTTGACTATTAGAAACCGG - Intergenic
1034926192 7:155124324-155124346 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926200 7:155124390-155124412 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926209 7:155124478-155124500 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926211 7:155124500-155124522 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926213 7:155124522-155124544 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926218 7:155124588-155124610 GTTGTTTGACTATGAGAAACCGG - Intergenic
1040843374 8:51808540-51808562 CCTGTTTGACTTCCAAATTCTGG + Intronic
1041675367 8:60533070-60533092 GTTATTTTACAAGCAAATACTGG - Intronic
1042379617 8:68097656-68097678 GTTGTATGCATACCAAATAGTGG - Intronic
1044276412 8:90305031-90305053 TTTGTGTAATTACCAAATACAGG + Intergenic
1050555669 9:6787851-6787873 GATGTTTGAGTACCAAGAACTGG + Intronic
1052382489 9:27786398-27786420 CTTATTTTGCTACCAAATACTGG - Intergenic
1055677066 9:78674595-78674617 ATTGTTTAAATACAAAATACAGG + Intergenic
1059916027 9:119101365-119101387 TTTTTTTGACTACCAAACTCTGG + Intergenic
1192375471 X:70556395-70556417 GTTGTTTAATTTCCAAATATTGG + Intronic
1194636787 X:96354681-96354703 GTTGTTTAATTTCCACATACTGG - Intergenic
1197029006 X:121790828-121790850 CTCATTTGGCTACCAAATACAGG + Intergenic
1202240875 Y:22767681-22767703 TTTGGTTGACTTCCGAATACTGG - Intergenic