ID: 1169118440

View in Genome Browser
Species Human (GRCh38)
Location 20:3082052-3082074
Sequence TGGGAATCCCGGGACCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169118433_1169118440 1 Left 1169118433 20:3082028-3082050 CCTTGGGTGAATCAGACATTGCA No data
Right 1169118440 20:3082052-3082074 TGGGAATCCCGGGACCAGGGTGG No data
1169118429_1169118440 23 Left 1169118429 20:3082006-3082028 CCGCCACTACACACGAGCACTGC No data
Right 1169118440 20:3082052-3082074 TGGGAATCCCGGGACCAGGGTGG No data
1169118426_1169118440 28 Left 1169118426 20:3082001-3082023 CCCCACCGCCACTACACACGAGC No data
Right 1169118440 20:3082052-3082074 TGGGAATCCCGGGACCAGGGTGG No data
1169118427_1169118440 27 Left 1169118427 20:3082002-3082024 CCCACCGCCACTACACACGAGCA No data
Right 1169118440 20:3082052-3082074 TGGGAATCCCGGGACCAGGGTGG No data
1169118428_1169118440 26 Left 1169118428 20:3082003-3082025 CCACCGCCACTACACACGAGCAC No data
Right 1169118440 20:3082052-3082074 TGGGAATCCCGGGACCAGGGTGG No data
1169118430_1169118440 20 Left 1169118430 20:3082009-3082031 CCACTACACACGAGCACTGCCTT No data
Right 1169118440 20:3082052-3082074 TGGGAATCCCGGGACCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169118440 Original CRISPR TGGGAATCCCGGGACCAGGG TGG Intergenic
No off target data available for this crispr