ID: 1169132132

View in Genome Browser
Species Human (GRCh38)
Location 20:3171825-3171847
Sequence GGCAACAGGCTGTCATCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169132132_1169132137 18 Left 1169132132 20:3171825-3171847 CCCTGAGATGACAGCCTGTTGCC 0: 1
1: 0
2: 1
3: 8
4: 152
Right 1169132137 20:3171866-3171888 TCACCTCAGCCCTCAGTGCCTGG 0: 1
1: 0
2: 4
3: 45
4: 373
1169132132_1169132139 20 Left 1169132132 20:3171825-3171847 CCCTGAGATGACAGCCTGTTGCC 0: 1
1: 0
2: 1
3: 8
4: 152
Right 1169132139 20:3171868-3171890 ACCTCAGCCCTCAGTGCCTGGGG 0: 1
1: 0
2: 2
3: 35
4: 308
1169132132_1169132138 19 Left 1169132132 20:3171825-3171847 CCCTGAGATGACAGCCTGTTGCC 0: 1
1: 0
2: 1
3: 8
4: 152
Right 1169132138 20:3171867-3171889 CACCTCAGCCCTCAGTGCCTGGG 0: 1
1: 0
2: 1
3: 54
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169132132 Original CRISPR GGCAACAGGCTGTCATCTCA GGG (reversed) Intronic
904293200 1:29500844-29500866 GGCAAAGGGCTGACCTCTCAGGG - Intergenic
904345962 1:29869919-29869941 GGCAACAGGCAGAAATCTGAAGG - Intergenic
906212606 1:44020498-44020520 GGTGACAGGCTGTCTTCTAAGGG + Intronic
907664025 1:56418445-56418467 GGAAACAGGATGTCTTCTCCAGG - Intergenic
911509438 1:98792826-98792848 GGCATGAGGCTGTCAGCTAAGGG + Intergenic
914343144 1:146776971-146776993 GGGACCAGGCTGTAATGTCATGG + Intergenic
914723188 1:150306297-150306319 GGCAACAGACTCTTGTCTCAAGG - Intronic
915871500 1:159564536-159564558 GCCAGCATGCAGTCATCTCAAGG + Intergenic
916573370 1:166046342-166046364 GGCATCAGGCTGTCCTTCCAGGG + Intergenic
918636160 1:186776898-186776920 GCTAACAGGATGTCATCTTATGG + Intergenic
920501500 1:206488216-206488238 GGCAACAGGCAGGCATGTAAAGG - Intronic
922717298 1:227884351-227884373 GGCAACAGGCCCACATCTCCTGG + Intergenic
922810896 1:228414976-228414998 GGCCACAGGTGGTCATCACAGGG + Exonic
922949807 1:229549212-229549234 GGTAACAGTCTCTCCTCTCAGGG - Exonic
923519815 1:234726669-234726691 AGGAACAGGCTGTTTTCTCAGGG + Intergenic
1063064077 10:2591060-2591082 GGCAACAGTTTGTTATTTCAGGG + Intergenic
1065602540 10:27384355-27384377 GGCAGAAGGATGGCATCTCAGGG + Intergenic
1067581465 10:47449273-47449295 GGAACCAGGCGGTTATCTCAGGG + Intergenic
1070603685 10:77883419-77883441 GTCAGCAGGCTGTCTTCACAGGG - Intronic
1071385777 10:85119968-85119990 GACGAAAGGCTGTAATCTCATGG + Intergenic
1075777259 10:124996936-124996958 CGCTACAGGCTGTGATCTCCTGG - Intronic
1076215788 10:128692659-128692681 GGCAACAGGACATCAGCTCATGG - Intergenic
1078584761 11:12573768-12573790 TGCAACAGGCTGTCTTCCTATGG - Intergenic
1078895623 11:15594617-15594639 TGCAACAGCCTGTCAACTAAGGG + Intergenic
1079116490 11:17643551-17643573 GGGCACAGGGTGTCATGTCAGGG + Intronic
1079182308 11:18204540-18204562 GGGAAAAGCCTGTCTTCTCAGGG - Intronic
1079370008 11:19844101-19844123 GTCCCCAGGCTGACATCTCATGG + Intronic
1079470139 11:20770232-20770254 AGCAACAGGCCGTGAGCTCAAGG + Intronic
1080640511 11:34155740-34155762 GGGAAGAGGCTGACATCTCCAGG - Intronic
1084118616 11:67056276-67056298 GGCACCAGGGGGACATCTCATGG + Intergenic
1088793123 11:113244020-113244042 GACAACAGGCTGTGCTCGCATGG + Intronic
1089590812 11:119539557-119539579 GGCAGCAGGCTGTCAGATGAAGG - Intergenic
1094067153 12:26373374-26373396 GGCAACAGGTTGTGATATAAAGG - Intronic
1095610182 12:44119132-44119154 TGCAACAAGCTGTCATCATAAGG - Intronic
1095944838 12:47747960-47747982 GGCAGCAGGCTGGCATTTAAAGG + Intronic
1096597996 12:52709372-52709394 GTCAAAAGGCTCTCATTTCAAGG - Intergenic
1097734095 12:63163130-63163152 AGCAAAAGGGTGTGATCTCATGG - Intergenic
1100596548 12:96077280-96077302 GGAAACAGGCTGTGATCCAATGG + Intergenic
1103920311 12:124395842-124395864 GCCAACAGGCTGAGATCCCAGGG + Intronic
1104953299 12:132451928-132451950 GGCCACAGGCTGTGCACTCAGGG - Intergenic
1105774276 13:23642499-23642521 GGCAAGAGGCTGTCATTTGCTGG + Intronic
1109360045 13:61283330-61283352 GGAAGCAGGCTCTCATCACATGG + Intergenic
1112121644 13:96418906-96418928 GCCAACTGGCTGTCCTTTCAAGG + Intronic
1112281415 13:98065963-98065985 GGCCACAGGCTGTGATCTGCTGG + Intergenic
1112514916 13:100045061-100045083 CGAAACAGGCTGTCTTTTCATGG - Intergenic
1112563569 13:100533895-100533917 CCCCACAGGCTGTCACCTCATGG - Intronic
1113508134 13:110831138-110831160 GGAAACTGTCTGGCATCTCAGGG - Intergenic
1117382767 14:55181690-55181712 CTCAAAAGGCTTTCATCTCAGGG + Intronic
1117532869 14:56676227-56676249 GGAAACACTCAGTCATCTCAAGG - Intronic
1118738121 14:68717008-68717030 GTCAATTGGCTGACATCTCATGG + Intronic
1120824076 14:88939530-88939552 GGGAACAAGCTGTAATCTAAAGG - Intergenic
1121753640 14:96382250-96382272 GGAAACAGACTGTAATCCCATGG + Exonic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122637031 14:103134965-103134987 GGGAAGAGGCGGTCATCTCAGGG + Intronic
1129778608 15:78253948-78253970 GGCAACCAGCTGTCATCTTGAGG - Intergenic
1132068342 15:98752020-98752042 GGCATCAGGCTGTCTTCCTAGGG + Intronic
1135669203 16:24360785-24360807 GTCAACAGTCTTTCATCTCCTGG + Intronic
1139569845 16:67804955-67804977 GCCACCGGCCTGTCATCTCAGGG - Intronic
1139946809 16:70647398-70647420 GGGAACAGGCTGCCTTCTCCAGG - Intronic
1139990847 16:70938357-70938379 GGGACCAGGCTGTAATGTCATGG - Intronic
1141996735 16:87640867-87640889 GGACACAGGCTGCCATCACAGGG - Intronic
1143038157 17:4012404-4012426 AGTAACAGGTTGTCTTCTCATGG - Intronic
1148198371 17:45731005-45731027 GGCTACAGGCTGGCCTCTGAAGG + Intergenic
1148578589 17:48728100-48728122 GGCAACAGGGAGTCATGTCGCGG + Exonic
1148748262 17:49930490-49930512 AGCATCAGCCTGGCATCTCAAGG - Intergenic
1150340079 17:64359411-64359433 AGCTACAGGCTGTGGTCTCATGG - Intronic
1153098823 18:1440532-1440554 TTCATCAGGCTGTCAACTCAGGG + Intergenic
1155769753 18:29681696-29681718 GGCAACAGATTGACATGTCAAGG + Intergenic
1160539239 18:79611426-79611448 GGAAGCAGGCTGGCATGTCACGG + Intergenic
1163534790 19:17870979-17871001 ACCAACGAGCTGTCATCTCAGGG - Intergenic
1163564851 19:18045025-18045047 GGCACCAATCTGTCAGCTCAGGG - Intergenic
1165171052 19:33891886-33891908 GGCACCAGCCTTTCATCTCCTGG - Intergenic
1166654451 19:44599936-44599958 CTCAACAGGTTGTCCTCTCATGG - Intergenic
927041712 2:19237200-19237222 GGGATGAGGCCGTCATCTCAGGG - Intergenic
927574368 2:24189388-24189410 GGCAACAGCCTGGCAGGTCAGGG - Intronic
928388579 2:30890692-30890714 GGCTTCAGACTGGCATCTCAGGG - Intergenic
939676753 2:145082071-145082093 AGCAACAGGCTGGCATATAAAGG - Intergenic
946004623 2:216513007-216513029 GGCAGCAGTTTGTCATCCCAGGG + Intronic
1169132132 20:3171825-3171847 GGCAACAGGCTGTCATCTCAGGG - Intronic
1171204450 20:23267958-23267980 GGCAACTGGCAGTGATCTCCTGG - Intergenic
1172175389 20:32969196-32969218 GGCCACAGGCTGGCAGCCCAAGG + Intergenic
1174201200 20:48807901-48807923 GGGAGCAGGCTGTCCACTCAGGG + Intronic
1174400403 20:50272907-50272929 GGGAACAGCCTGTCATCCCCAGG + Intergenic
1175135452 20:56820221-56820243 GGAAACAGCCTGTCACCTCATGG + Intergenic
1175408821 20:58752715-58752737 GGCACCAGGCTGTCATCCCAAGG + Intergenic
1178725352 21:35046529-35046551 GGCAACAGGCTGAGAACTCTGGG + Intronic
1179251337 21:39673837-39673859 GGCAACAGGCTGAGATGTCCTGG - Intergenic
1179977655 21:44878662-44878684 GGCAACAGCATGGCATCTAATGG - Intergenic
1181467099 22:23116185-23116207 GGCAACAGGCTGCCAGGTGAGGG + Intronic
1182054215 22:27337225-27337247 GGCAACAAGATGTCAGCTTATGG - Intergenic
959660067 3:108858177-108858199 AGCAACAGCCTGTCATTTAAGGG - Intergenic
960160419 3:114344120-114344142 GGCAACAGGATCACATCCCAGGG - Intronic
961355649 3:126338252-126338274 GGCACCAGGGTGTCCTCTGATGG + Intergenic
962949376 3:140203972-140203994 TGCAAGAGGATGTCTTCTCAAGG - Intronic
967863026 3:194167098-194167120 AGCTACAGGCTCTCATCTCTGGG - Intergenic
968815381 4:2818837-2818859 GGCATCAGGCTGTCTTCTGCCGG - Intronic
969014672 4:4095975-4095997 GGCAAGAAGCCTTCATCTCAAGG + Intergenic
969266922 4:6070552-6070574 GACAACAGGCTCTCGGCTCAGGG - Intronic
969526623 4:7707098-7707120 GGCAGCAGCCTGTCCTCTCCGGG + Intronic
969739268 4:9012466-9012488 GGCAAGAAGCCTTCATCTCAAGG - Intergenic
969798450 4:9543979-9544001 GGCAAGAAGGTTTCATCTCAAGG - Intergenic
971841787 4:31862090-31862112 AGTGGCAGGCTGTCATCTCAAGG + Intergenic
972148494 4:36060099-36060121 GTCAACAGGCTGTAAAATCATGG + Intronic
975186646 4:71411056-71411078 GGCAACAGGTAGTCATCGAATGG - Intronic
976178156 4:82374469-82374491 GGCACAGGGCTGACATCTCAGGG - Intronic
979779726 4:124635537-124635559 GGAAGCAGGCTGTCTTCACATGG - Intergenic
981807354 4:148732186-148732208 GGCAGCAGGCTGGCAACTCCTGG - Intergenic
982526655 4:156487422-156487444 GCCAACAGGCTCCCATCTCATGG - Intergenic
986833968 5:11613669-11613691 GGCAACAGGCTCTAATTCCATGG - Intronic
991200545 5:63986662-63986684 AGCAAGAGGCTGTCAGCTGAAGG + Intergenic
992968117 5:82024718-82024740 GTCATCAGGCTGTTTTCTCAGGG - Intronic
993466753 5:88257007-88257029 GGCTAAAGCCTGTAATCTCAGGG + Intronic
997574717 5:134965858-134965880 GACAACAGGATTTCATCTCCAGG - Exonic
1003127006 6:3363530-3363552 GGCAGCAGCCTGTCACATCAAGG - Intronic
1004187405 6:13432700-13432722 GGCCACAGGCTGGAACCTCAAGG - Intronic
1005095706 6:22113049-22113071 GGCAAAAGGGTGTCCTCTGATGG + Intergenic
1005766242 6:29014951-29014973 GGCACCACGCTGTCACCTCTCGG - Intergenic
1013396488 6:109746300-109746322 TACAACAGGCTGTTAGCTCAAGG - Intronic
1015789553 6:136952572-136952594 GACAAAAGGGTGTGATCTCATGG - Intergenic
1017145068 6:151227398-151227420 GGCCAGGGGCTGTCATCTCAAGG + Intergenic
1018897257 6:168028399-168028421 GGCAACGGGCTGTCAGATAAAGG - Intronic
1019054723 6:169214859-169214881 GGCAACGGGCTGTGAACTGAAGG - Intergenic
1021010194 7:15453380-15453402 GGCAAGAGGCAGTCATCTATTGG - Intronic
1021234317 7:18123708-18123730 GGCAACAGGGTGTCTTCCAAGGG + Intronic
1022804553 7:33808635-33808657 GGCAACACACAGTCAGCTCAAGG - Intergenic
1024474900 7:49799434-49799456 GGCACCTGGCTGGCATCTGAGGG + Intronic
1026890982 7:73982338-73982360 GGCTACAGGCTGGAATCTCCAGG - Intergenic
1026929386 7:74215455-74215477 GGCCACAGACTGTCACCTCCAGG + Intronic
1029368469 7:100131992-100132014 GGCAACACGGTGACACCTCATGG - Intergenic
1032514607 7:132497396-132497418 GTAAACACGATGTCATCTCAAGG - Intronic
1033225612 7:139559913-139559935 GGCAAAAGGCTGTGAGCTGAGGG + Intergenic
1035689556 8:1550968-1550990 GCCAACAGGCAGTCAACTAATGG + Intronic
1037099442 8:15025328-15025350 AGTTTCAGGCTGTCATCTCAAGG + Intronic
1039408995 8:37336206-37336228 TGCAACAGGCTCTTATTTCAAGG + Intergenic
1042003541 8:64154774-64154796 GGCAAAAGGGTGTGATCTAATGG + Intergenic
1043520764 8:81042899-81042921 TGCAACTGGCTCTCATCTCACGG + Intronic
1045288689 8:100813292-100813314 GGCAAAAGGGTGTGATCTAATGG - Intergenic
1047493962 8:125396641-125396663 GGCCACAAGCTTTCATCTCCAGG - Intergenic
1047933200 8:129750628-129750650 GCAAACAGGCTGTCATTCCAAGG - Intronic
1048899309 8:139022462-139022484 GGCACCTGGCTGTGATCTCCTGG - Intergenic
1050355799 9:4781657-4781679 GTCCACAGCCTGTCATCTCATGG + Intergenic
1050452630 9:5799413-5799435 GGCACAAGGCTGTCATCTAGTGG - Intronic
1051162058 9:14220093-14220115 AGCAACAGGCTGTGGTCTGATGG + Intronic
1051590665 9:18774136-18774158 GGAAGGAGGCTGTCATCTCCAGG - Intronic
1053129405 9:35606383-35606405 GGCAACAGGATCTCCTCTCAGGG + Intronic
1056862853 9:90203156-90203178 GGCAGCAGGCTGACTTCTGAAGG + Intergenic
1058836243 9:108860818-108860840 GGCAGCAAGGTGTCATCCCAAGG - Intergenic
1059076296 9:111197129-111197151 GGCAACAGGCTGGAATCTGCAGG + Intergenic
1059658049 9:116374367-116374389 GGAAAAAGGCTGACATCTGAGGG + Intronic
1059907931 9:119009311-119009333 GGCAATATGCTGCCAACTCACGG - Intergenic
1060300663 9:122372923-122372945 GCCAACAGACTGTCATCCAAGGG + Intronic
1060301417 9:122376545-122376567 GGTGAAATGCTGTCATCTCAGGG - Intronic
1061291800 9:129654753-129654775 GGGACCAGGCTCTCAGCTCACGG - Intergenic
1187287228 X:17917186-17917208 GGTAACAGGCAGTCTTCTAATGG - Intergenic
1189515377 X:41708542-41708564 GGCACCGGGCTTTCATCTTAAGG + Intronic
1189901834 X:45714331-45714353 GACAACAGTCTCTCCTCTCAGGG + Intergenic
1190869651 X:54414303-54414325 GCCAATAGGCTGTGCTCTCAAGG + Intergenic
1196750964 X:119116892-119116914 GGCCACAGCTTGTCATCTCTGGG + Intronic
1197123189 X:122914856-122914878 GGCACCAGGCTGGCTTCTCCTGG - Intergenic
1197267128 X:124386686-124386708 GGCAACAGGGAGTCATCGAAGGG + Intronic
1199587872 X:149435562-149435584 GGCAATAAGCTGACATCTGATGG - Intergenic
1200323881 X:155217147-155217169 GGCAACGGGCTGTCATCAGAAGG + Intronic