ID: 1169135514

View in Genome Browser
Species Human (GRCh38)
Location 20:3194899-3194921
Sequence GAACCCTGTGGGCTTGCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169135514_1169135523 15 Left 1169135514 20:3194899-3194921 CCCCTAGCAAGCCCACAGGGTTC 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1169135523 20:3194937-3194959 AAGTACCACCTGCTCACTTGAGG 0: 1
1: 0
2: 1
3: 17
4: 157
1169135514_1169135524 16 Left 1169135514 20:3194899-3194921 CCCCTAGCAAGCCCACAGGGTTC 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1169135524 20:3194938-3194960 AGTACCACCTGCTCACTTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169135514 Original CRISPR GAACCCTGTGGGCTTGCTAG GGG (reversed) Intronic
902405749 1:16182442-16182464 GAGCCCTGTGGCCTTCCTGGAGG + Intergenic
903228983 1:21910376-21910398 CAGCCCTGTGGGCTTCCTGGAGG - Intronic
920676377 1:208041239-208041261 GAAGCCTGAGACCTTGCTAGAGG + Intronic
1063991782 10:11573712-11573734 GAAACCTGTTGGATTTCTAGAGG - Intronic
1065038267 10:21663143-21663165 TCACTCTGTGGGCCTGCTAGAGG + Intronic
1074501358 10:114027925-114027947 CAACCCTGTGAGGTTGCAAGGGG + Intergenic
1076090891 10:127684580-127684602 GAGCCCTGTGGGCTTTCCTGTGG - Intergenic
1076776454 10:132700561-132700583 GCACCCTGTGTCCTTGCTGGAGG + Intronic
1077111445 11:863913-863935 GCAGCCTGTGGTCTTGCTGGAGG + Intronic
1077139379 11:1017137-1017159 GGACCCTGTGGCCTTGATCGTGG + Exonic
1077324395 11:1957479-1957501 GAAGCCTGTGGCCCTGCCAGAGG + Intronic
1080649813 11:34213042-34213064 GAATCCTTTGGGCCTGCTGGGGG + Intronic
1086977909 11:93157756-93157778 GAAGCCTTTGGGCTTACTATGGG + Intronic
1090066977 11:123511404-123511426 AAACTCTGTGGGCACGCTAGAGG + Intergenic
1202807376 11_KI270721v1_random:12656-12678 GAAGCCTGTGGCCCTGCCAGAGG + Intergenic
1094263558 12:28528277-28528299 AAGCCCTGTGGGCTTGCTCTAGG - Intronic
1097088726 12:56488372-56488394 GAACCCGGGTGGCTTTCTAGTGG + Exonic
1100382664 12:94076054-94076076 GAAGGCTGTAGGCTTTCTAGTGG + Intergenic
1103347791 12:120263048-120263070 GCACCCTCTGGCCTTGCTACCGG + Intronic
1103931667 12:124453903-124453925 GATCCCTGTGGCCTTCCTGGAGG - Intronic
1104045022 12:125155813-125155835 GAACCCTGGTGTCTTGCTGGTGG + Intergenic
1104388028 12:128367560-128367582 GGTCTCTGTGCGCTTGCTAGGGG - Intronic
1105893104 13:24696183-24696205 CAACACTGTGGGGTGGCTAGAGG + Intronic
1106257193 13:28032371-28032393 CATCCCTGTGGGCTTGCTCCTGG - Intronic
1108953807 13:56124738-56124760 GAACCCTGGAGAGTTGCTAGTGG - Intergenic
1111725019 13:91996274-91996296 GAACCCTGTTGGAGTCCTAGTGG - Intronic
1117975153 14:61289855-61289877 AAATCCTGTGGCCTTGCTGGTGG + Intronic
1121544442 14:94753176-94753198 TCACCCTGTGGGCTGGCTGGCGG + Intergenic
1122388122 14:101362665-101362687 GAGCACTGTGGGCCTGCTGGAGG - Intergenic
1124416277 15:29475409-29475431 GGACCCTGTGAGGTTGCTAAGGG - Intronic
1133321425 16:4916080-4916102 GAACCCTCGTGCCTTGCTAGTGG + Intronic
1137874361 16:51981612-51981634 GAAGACTGTAGGCTGGCTAGTGG - Intergenic
1138419852 16:56892193-56892215 TAGCCCTGTGGGGTGGCTAGGGG + Intronic
1138867117 16:60835237-60835259 GAATTCTGTGGCCTTGATAGGGG + Intergenic
1141506857 16:84483626-84483648 GAGCCCTGTTGGCTTGCTCGGGG - Intronic
1141948932 16:87328335-87328357 GTGCCAGGTGGGCTTGCTAGGGG + Exonic
1142342430 16:89532288-89532310 GAACCCTGAGGGGTGGCCAGGGG + Intronic
1149091608 17:52789631-52789653 GAACCCTGTCAGCTGGCTAAAGG + Intergenic
1160017808 18:75157773-75157795 GAACCCTGTCGGTTTCCTACAGG - Intergenic
1160662662 19:308349-308371 TTACCCTCTGGGCTTGCTGGAGG - Intronic
1160815278 19:1032606-1032628 GAACCCTGTGGACCTGTTCGAGG + Exonic
1160980223 19:1813205-1813227 GAACCCTGCGGGCTTCCTCTTGG - Intergenic
1166094829 19:40531972-40531994 GAGCCCTGTGGGCTCATTAGGGG + Intronic
928693395 2:33824156-33824178 GCATCCTGGGGGCTTCCTAGTGG + Intergenic
940046427 2:149415409-149415431 GAAGGCAGGGGGCTTGCTAGGGG + Intronic
947194817 2:227551980-227552002 GAATCCTGTGGGCATGCTCATGG - Exonic
1169075756 20:2759077-2759099 CATCCCTGTGGGGCTGCTAGCGG - Intronic
1169075850 20:2759426-2759448 GAAGCCTGTGGGGCTGCTAGCGG - Exonic
1169135514 20:3194899-3194921 GAACCCTGTGGGCTTGCTAGGGG - Intronic
1174460359 20:50678180-50678202 GATCCCAGCGGGCTTCCTAGAGG + Intronic
1178193499 21:30315056-30315078 GAAACCTGTGGGATCCCTAGAGG + Intergenic
1178259952 21:31089504-31089526 GAACCCTTGTGGCTTGCTTGTGG - Intergenic
1181763775 22:25076681-25076703 AAGGCCTGTGGCCTTGCTAGGGG + Intronic
1181992219 22:26845941-26845963 TAACCCTGTGAGATTGCTAATGG - Intergenic
1182425828 22:30271673-30271695 GAACCCTGGGGCATTGCTGGTGG + Intergenic
1182486766 22:30643768-30643790 AAACCCTGTCTGCTTGCTATTGG - Intronic
1183828037 22:40403890-40403912 GAATCCTGTGGGTTTGCTGATGG + Intronic
949799311 3:7885519-7885541 AAAACCTCTGGTCTTGCTAGAGG + Intergenic
953102919 3:39847516-39847538 GGAGCATATGGGCTTGCTAGTGG - Intronic
953911295 3:46894334-46894356 GAACCCTAAGGGCTTGTCAGGGG - Intronic
955339299 3:58112479-58112501 GAACCCATTGGGCTTCCTATAGG - Intronic
962453865 3:135547253-135547275 GAATACGGTGGGGTTGCTAGAGG + Intergenic
967200123 3:187065607-187065629 GTACCCTGTGGGCCTGAGAGAGG + Intronic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
974540503 4:63227103-63227125 GAATCTTGTGGGATTGCTAAAGG + Intergenic
977848216 4:101791093-101791115 GAACCCTCTGGGCTGCCTGGCGG - Intronic
981271109 4:142847343-142847365 TTCCCCTGTGGGCTTGTTAGGGG - Intronic
982854134 4:160360514-160360536 GAACCCTTTGAGCTTGCTTCAGG + Intergenic
986167102 5:5283478-5283500 GAGTCCTGTGGGCTTTCTGGGGG - Intronic
986452717 5:7882174-7882196 GAACCCTGTGGGATTGGCTGAGG - Intronic
995637835 5:114215449-114215471 GAACCCTTTGAGCTTGTTTGTGG + Intergenic
997073449 5:130643704-130643726 GAAACCTGTGCGCTTGAGAGAGG - Intergenic
997382764 5:133449370-133449392 GAACCCTTTGGGGTTGTGAGAGG + Intronic
998514214 5:142737996-142738018 AAATCCTGTGGGCTTCCTAGTGG - Intergenic
999322087 5:150621780-150621802 GGGCCCTGTGGGCAGGCTAGAGG + Intronic
1000259244 5:159570518-159570540 GAACTCTCTGGCATTGCTAGTGG - Intergenic
1001937709 5:175717142-175717164 GAAGGCTGTGGTCTTCCTAGAGG + Intergenic
1002412120 5:179089229-179089251 GAACCCAGTGGGGTTCCTGGAGG + Intergenic
1008050188 6:46893221-46893243 CAACCCTCTTGGCTTGCTTGAGG + Intronic
1024210951 7:47203556-47203578 GAATGCTATGGGCTTGCCAGGGG - Intergenic
1024262096 7:47580979-47581001 GAAGCCTGGGGGCTTCCCAGGGG + Intronic
1024430721 7:49285235-49285257 GAACCTGGTGGGGTTCCTAGAGG - Intergenic
1033082334 7:138310101-138310123 TATCCCTGTGGGCTTCCTTGAGG - Intergenic
1035319664 7:158020515-158020537 GGTCACTGTGGGCTTGATAGTGG + Intronic
1035566403 8:644005-644027 GAGTCCTGTGGGCTTGGTGGGGG + Intronic
1049604093 8:143521105-143521127 GAACCCTCTGGGCTGGGCAGGGG - Intronic
1051358662 9:16262932-16262954 AAACCCGGTGGGCTTGCTATGGG - Intronic
1061964642 9:134006116-134006138 GAAACCTCTGGGCCTGTTAGAGG + Intergenic
1186543995 X:10429993-10430015 GAAAGCTGTGTGCTTGCTAGGGG - Intergenic
1188370957 X:29369150-29369172 GAACCCTGTGGCCTTGGCTGTGG + Intronic
1189259495 X:39668393-39668415 CAACCCTGTGGGCTGCCTATGGG + Intergenic
1189510391 X:41656085-41656107 GAACCCTGTGTGCTCCCTCGAGG + Intronic
1190565895 X:51730084-51730106 GAACCTGGTGGGATTCCTAGTGG + Intergenic
1195958469 X:110360213-110360235 CATCCCTGTGGGCTTGTCAGTGG - Intronic
1200294025 X:154899783-154899805 GAATCCTTTGAGCTTGCAAGAGG + Intronic