ID: 1169137672

View in Genome Browser
Species Human (GRCh38)
Location 20:3207370-3207392
Sequence CCTACTATGTACCAGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169137668_1169137672 6 Left 1169137668 20:3207341-3207363 CCAAGCTAGTTATCTTACATTAC No data
Right 1169137672 20:3207370-3207392 CCTACTATGTACCAGGAGCTGGG No data
1169137666_1169137672 15 Left 1169137666 20:3207332-3207354 CCACTGTGCCCAAGCTAGTTATC No data
Right 1169137672 20:3207370-3207392 CCTACTATGTACCAGGAGCTGGG No data
1169137667_1169137672 7 Left 1169137667 20:3207340-3207362 CCCAAGCTAGTTATCTTACATTA No data
Right 1169137672 20:3207370-3207392 CCTACTATGTACCAGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169137672 Original CRISPR CCTACTATGTACCAGGAGCT GGG Intergenic
No off target data available for this crispr