ID: 1169138701

View in Genome Browser
Species Human (GRCh38)
Location 20:3213970-3213992
Sequence GTCTTTGTGCTGCAGGTACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169138694_1169138701 15 Left 1169138694 20:3213932-3213954 CCAGGTGGGGATGGTGATCATGG 0: 1
1: 0
2: 4
3: 24
4: 195
Right 1169138701 20:3213970-3213992 GTCTTTGTGCTGCAGGTACAGGG 0: 1
1: 0
2: 1
3: 20
4: 168
1169138692_1169138701 25 Left 1169138692 20:3213922-3213944 CCTGGACGTTCCAGGTGGGGATG 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1169138701 20:3213970-3213992 GTCTTTGTGCTGCAGGTACAGGG 0: 1
1: 0
2: 1
3: 20
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169138701 Original CRISPR GTCTTTGTGCTGCAGGTACA GGG Exonic
902150870 1:14442383-14442405 GACTTTTAGCTGCAGGAACAGGG + Intergenic
902725597 1:18334020-18334042 GCTTTTGTGCTGCAAGGACAGGG + Intronic
902759785 1:18573601-18573623 GGCTTTGGGCTTCAGGTAGAGGG - Intergenic
904467090 1:30714570-30714592 TTCTTCATGCAGCAGGTACAGGG - Intronic
907056417 1:51372995-51373017 GTCGTTGATCTTCAGGTACAAGG - Intronic
907271140 1:53291910-53291932 GTCTCTGTGCTGCAGGGACAGGG - Intronic
908390106 1:63676440-63676462 GTCTTTGAGATACAGATACATGG + Intergenic
909743903 1:79068370-79068392 GGTTTTTTGCTGCAGGTCCAGGG - Intergenic
917187889 1:172382175-172382197 TTCTTTGTGCTGCTGTTACCTGG - Intronic
917638603 1:176960617-176960639 GACTTTATTCTGTAGGTACAGGG - Intronic
917834830 1:178933187-178933209 GCTTTTGTGCTGCAGGTTCTGGG - Intergenic
918201154 1:182268381-182268403 GTCGTTGTACTACAGGTACATGG + Intergenic
918547014 1:185696522-185696544 CTCCTTCTGCTGCAGCTACATGG + Intergenic
920077433 1:203347638-203347660 CTCATTGTGTTGGAGGTACAAGG + Exonic
923005843 1:230048987-230049009 GTCTCTGGGCTGCATTTACAGGG + Intergenic
923446824 1:234079096-234079118 GACAGTGTGCTGCTGGTACAGGG + Intronic
1066048780 10:31617287-31617309 GTCTCTGAGCTGCCGCTACAGGG - Intergenic
1066326957 10:34370080-34370102 CTCTTTGTGCTCCAGGTATGCGG - Intronic
1066528327 10:36307317-36307339 GTTTTTGTACTACAGTTACAGGG - Intergenic
1070060982 10:72982244-72982266 GACTTTGTGTTGCAGGGAAAAGG - Intergenic
1075570801 10:123542099-123542121 GTTTTTGTGCTATAGGTAAATGG + Intergenic
1077852422 11:6085767-6085789 GCCTGTGGCCTGCAGGTACAGGG - Intergenic
1077907833 11:6547534-6547556 AGCTCTCTGCTGCAGGTACACGG + Exonic
1079328681 11:19516230-19516252 GTCTTTTTGCTGCAAGTAAAAGG + Intronic
1081572641 11:44301265-44301287 GTGTGTGTGCTGCAGGGTCAGGG + Intronic
1083058022 11:59841928-59841950 GTCTTTGTTCTGCAAGCATATGG - Intronic
1084752783 11:71215012-71215034 CTGGCTGTGCTGCAGGTACATGG + Intronic
1085016033 11:73174614-73174636 GTGATTGTGCTGTAGGTGCATGG + Intergenic
1085701906 11:78752938-78752960 GTTTTTGTGTGGCAGGTACTAGG + Intronic
1088624761 11:111721915-111721937 GAGTCTGTGCTGCAGGTACTGGG - Exonic
1089519676 11:119055594-119055616 GTCCTTCTGCTGCAGGCACCTGG - Intronic
1090073855 11:123566846-123566868 GTCATTTTGCTGGAGGTACTGGG + Intronic
1090317308 11:125804372-125804394 TTCTTTGTGAAGCAGATACATGG + Intergenic
1093739433 12:22665698-22665720 GGATTTGAGCTGAAGGTACATGG + Intronic
1094471063 12:30801848-30801870 GTCTTTGTGCTGAATGTTCAAGG - Intergenic
1098088731 12:66878205-66878227 GTGTATGTCCTGCAGGAACATGG - Intergenic
1098289466 12:68943924-68943946 TTCTTTCTGCTACAGGTACAGGG - Intronic
1100597923 12:96087648-96087670 GTGTTGGGCCTGCAGGTACACGG + Intergenic
1100718416 12:97329676-97329698 GTATTTGTCCTGCAGGTTCTTGG + Intergenic
1102559619 12:113753090-113753112 GTCTTTGTCATGCAGGAAGAGGG - Intergenic
1105673334 13:22644013-22644035 CTCTGTTTCCTGCAGGTACAAGG - Intergenic
1106451930 13:29889944-29889966 TTATTTTTGCTGCAGGTGCAGGG + Intergenic
1106559017 13:30833011-30833033 CTCTGTGTGCTGCGGGGACAGGG - Intergenic
1111553590 13:89849771-89849793 TTATTTCTGCTGGAGGTACAAGG + Intergenic
1116713725 14:48401486-48401508 GACTTTATGCTGGATGTACATGG + Intergenic
1120335510 14:83149493-83149515 ATCTATGTGCTGTAGGCACAGGG + Intergenic
1120876612 14:89381497-89381519 TTTTTTGGGCTGCAGGTGCAGGG - Intronic
1120921073 14:89755864-89755886 GTGTTGGTCCTGCCGGTACATGG - Intergenic
1121114330 14:91332790-91332812 CTCTTTGCTCTGCAGTTACAAGG - Intronic
1121261581 14:92570099-92570121 CTCTTTGTGTTGCACGTGCAGGG - Intronic
1122735440 14:103837098-103837120 ATCTTTGTGCTCCAGGCACCTGG - Intronic
1125213861 15:37246686-37246708 GGGTTTGTGCTGGAGGTGCAAGG + Intergenic
1129604900 15:77020054-77020076 GTCTGTGTGATGCAGGCTCAGGG + Intronic
1132978603 16:2722776-2722798 GTCCGTGGGCTCCAGGTACAGGG - Intergenic
1134885419 16:17786614-17786636 GGCTTTCTGCTGCATGTATATGG + Intergenic
1135649992 16:24197623-24197645 CTCTGAGTGCTGCAGGGACAAGG + Intronic
1136612538 16:31375381-31375403 GCCTTTGTGCTGCATGTGCAAGG - Intronic
1139472694 16:67186751-67186773 GCCATTGTGCTGCAGGTAGGTGG - Exonic
1140704922 16:77618926-77618948 TTCTTTCTGCTGTAGGTACCTGG - Intergenic
1141771014 16:86089682-86089704 GAGTTTGTGTTGCAGGAACAGGG - Intergenic
1142537734 17:631414-631436 ATCCTTCTGCTGCAGGTTCAGGG - Intronic
1142642113 17:1290244-1290266 GATTTTGTCCTGCAGGAACAGGG - Intronic
1142977045 17:3651448-3651470 CTGTTTGTGCTTCAGGTTCAAGG - Intronic
1143867417 17:9934237-9934259 GTCTTTGTGTTGCAGCTCCTTGG - Exonic
1145969846 17:28950421-28950443 GTTGTTGTGCTGCAGGAACGCGG - Intronic
1150272324 17:63874351-63874373 GTGTCTCTGCTGCAGGTCCAAGG - Intronic
1150278013 17:63911950-63911972 GTGTCTCTGCTGCAGGTCCAGGG - Intronic
1152356019 17:79807765-79807787 GGCTTTGTGCTGGAGGTTTACGG + Intergenic
1154049221 18:10937546-10937568 GTCTTTGTGCTCCATGTAACAGG + Intronic
1155512807 18:26594550-26594572 GCATTTGTGCTGCAGTTACCTGG - Intronic
1159597172 18:70393727-70393749 TTCTTTGTGCTGCAGGGCAAGGG + Intergenic
1160039356 18:75332047-75332069 CTCTTTGTCCTGTAAGTACATGG - Intergenic
1163815954 19:19464682-19464704 ATGTGTGTGCTGCAGGTACAGGG + Intronic
1165897895 19:39154546-39154568 GTCTTTGTAATACAGGCACACGG - Intronic
1167224850 19:48230871-48230893 TTCATGGTGCTGCAGGTCCAGGG + Exonic
1167236588 19:48319360-48319382 GACTTTGTCCTGCAGGTACTGGG - Intronic
926964551 2:18395930-18395952 GGCTTTGTGCAGCTGGTGCAGGG + Intergenic
929251621 2:39763191-39763213 GTCTTTGTCTTGGTGGTACAAGG - Intronic
930576445 2:53155953-53155975 CTCTTTGTTCTGCAGACACATGG + Intergenic
935333525 2:101994799-101994821 GTGTTTGTGCTGCCGGTCCATGG + Intronic
937814508 2:126236688-126236710 GTGCTGGTGCTGCAGGTCCAAGG - Intergenic
937884101 2:126888465-126888487 GGCTTTGTGCTGCAGAGGCAAGG - Intergenic
937902774 2:127034642-127034664 GCCTTTGTGCTGCAGGTCAGTGG - Intergenic
938390068 2:130898138-130898160 ATCTTTGTGCTCAAGGCACAGGG - Intronic
939760421 2:146170122-146170144 GTCTTTGTGCTGTAATCACATGG - Intergenic
942596679 2:177598125-177598147 ATCTGTGCACTGCAGGTACAAGG + Intergenic
943436049 2:187867069-187867091 GTCTTGGTGCTGGAGACACAGGG - Intergenic
944129346 2:196330143-196330165 TCTATTGTGCTGCAGGTACATGG + Intronic
944771741 2:202921599-202921621 TTCTATGTGCTGGAGATACAAGG - Intronic
947135937 2:226976726-226976748 TTCTAAGTGCTGCAGGCACAAGG + Intronic
948602261 2:239114054-239114076 GTCTAGGTGCTCCAGGTACAAGG + Intronic
948951051 2:241252003-241252025 GGCATTCTGCTGCAGGTCCAAGG - Intronic
1169026253 20:2374047-2374069 GTCTCTGTGCTTCCGGGACAGGG - Intergenic
1169138701 20:3213970-3213992 GTCTTTGTGCTGCAGGTACAGGG + Exonic
1169252438 20:4071022-4071044 GGCTATGTGCTGGAGGTAGAGGG + Intronic
1170466872 20:16630159-16630181 GTCTTTGTACTGGAGGTCAATGG + Intergenic
1173737218 20:45370752-45370774 GTCCCTGGGCTGCCGGTACAAGG - Intronic
1177035071 21:16032925-16032947 GTCTCTGGACTCCAGGTACAGGG - Intergenic
1179816023 21:43906904-43906926 GTCTCTGTGCTGCACTTACGAGG - Intronic
1180173935 21:46078444-46078466 TTTTTGGTGCTGCAGGTGCAGGG - Intergenic
1181167354 22:20990955-20990977 GAGTGTGAGCTGCAGGTACAGGG + Intronic
1182465544 22:30514014-30514036 ATCTTTGTGCTGCAGGCTCAGGG - Intergenic
1183168645 22:36167227-36167249 ATCTATGTGCTGCATGTAAAAGG + Intergenic
1183211373 22:36453484-36453506 GTCTTTCTCCTGCAGGCACTGGG + Intergenic
1183320082 22:37159880-37159902 GGCTTTGGGCTGCAGATGCAGGG - Intronic
1183796862 22:40126185-40126207 GCCTCTGTGCAGCAGGAACAGGG - Intronic
1184161003 22:42697381-42697403 GTCTTTCTTCTGCAGGGAGAGGG + Intronic
1184761902 22:46549652-46549674 GCCTTTGTACTGCAGGCACTGGG + Intergenic
1184762435 22:46552127-46552149 GTCTGTGTGAAGCAGCTACATGG + Intergenic
952091090 3:29887228-29887250 GTCTTTCTGCTGATGGTACAGGG - Intronic
953805889 3:46066971-46066993 GACTCTGTACTGCAGGTATATGG - Intergenic
954157652 3:48695488-48695510 GTCTTTCTGCTGAAGGAGCAGGG - Intronic
955254329 3:57314317-57314339 TTCTTTGTGCTGCAAGTAATGGG - Intronic
955277252 3:57557811-57557833 AACTTTGTGCTGAAGATACAAGG - Intronic
956872473 3:73431428-73431450 CTCTTTGTGCTGCTGTTACGAGG + Intronic
963539487 3:146567120-146567142 GTGTTGGGCCTGCAGGTACATGG - Intergenic
965352223 3:167627649-167627671 GTCTTTCTTCTGCAGGTTCTAGG - Intronic
966286502 3:178302291-178302313 GGCTGTGTGCTGTAGGTATATGG - Intergenic
966641512 3:182196213-182196235 CTGTTTGTACTGCACGTACAAGG + Intergenic
966895738 3:184443732-184443754 GTCTTTGGTCAGCAGGTGCAGGG + Intronic
968049446 3:195644132-195644154 GTCGTTGAGCTGGAGGTCCAGGG + Intergenic
968305172 3:197645800-197645822 GTCGTTGAGCTGGAGGTCCAGGG - Intergenic
968974823 4:3816560-3816582 GCCTTTGTGCTGCAGGTAGCAGG + Intergenic
970758136 4:19450953-19450975 GTGTTGGGCCTGCAGGTACACGG - Intergenic
974003858 4:56536297-56536319 GTTTTTGCTCTGCAGGCACATGG + Intronic
976149086 4:82075238-82075260 CTCATTATGCTGCAGGTACTAGG - Intergenic
980134962 4:128849927-128849949 GCTTTTGTGCTGTAGGTACACGG + Intronic
980164102 4:129203430-129203452 GTAGCTGTGCTGCAGGTAGATGG + Intergenic
980535998 4:134124479-134124501 CTCTTTGTTCTTCAGGTACATGG + Intergenic
983197396 4:164822719-164822741 GTGTTTGTGAAGCAGGTTCATGG + Intergenic
983646102 4:169993177-169993199 GTCTTTGACCTGCAGGTAGATGG - Intronic
985506109 5:281396-281418 GTCGTTGAGCTGGAGGTCCAGGG + Intronic
985531003 5:433838-433860 GTCTTTTCTCTGCAGGGACAGGG + Exonic
986597700 5:9440823-9440845 GCCTTTATCCTGCAGATACATGG + Intronic
987266685 5:16263061-16263083 GGCTGTGTGCTACAGGTAGAGGG - Intergenic
988065789 5:26228078-26228100 GTCGTTGAGCTGGAGGTCCATGG - Intergenic
988354168 5:30151452-30151474 GTCTTAATTCTGCAGGCACATGG - Intergenic
988849535 5:35165305-35165327 GTCTCTGTTATGCAGCTACATGG - Intronic
992133177 5:73715720-73715742 CACTTTGTTCTGCAGGTACCTGG - Intronic
992988653 5:82260228-82260250 GTCTCTGTTCTGCAGGTATCAGG + Intronic
995423540 5:111993324-111993346 AGCTGTGTGCTGCAAGTACAAGG + Intronic
998862393 5:146457491-146457513 GTTTTTGTGCAGCAGATATAAGG + Intronic
999369580 5:151045795-151045817 GCCTTTGTGCTGCTGGTCCCGGG + Intronic
1000948476 5:167451384-167451406 GTCTTCGTGCTTCAGTTACCTGG + Intronic
1002114630 5:176949707-176949729 GTCTCTGCGCTGCAGGTAACTGG - Intronic
1002154532 5:177266062-177266084 GTCTTTGTACTGCCGGTCCTCGG + Intronic
1002925070 6:1601356-1601378 GCCTTTGTGCTGAAGGAAGAAGG + Intergenic
1003666440 6:8116029-8116051 GTCTTTGGGGAGCAGGGACAGGG - Intergenic
1007274847 6:40665795-40665817 GTCTTTGAGCTGCACACACAGGG - Intergenic
1007394552 6:41570131-41570153 GTCTTTGGTCTGCAGGTCCAGGG + Intronic
1010171136 6:72977230-72977252 CTCTTTGTGTCCCAGGTACATGG - Intronic
1013072372 6:106740886-106740908 CTGTTTGTGCTAGAGGTACAGGG - Intergenic
1013322686 6:109009828-109009850 GTCTTCGGGCTTCAGGGACAGGG + Intronic
1013612920 6:111811934-111811956 TCCTTTGTGCTGCAGTTTCAAGG - Intronic
1015556605 6:134468747-134468769 GTCCTTGTGCTTCTGGTATATGG - Intergenic
1016683609 6:146857357-146857379 CTCTCTGTCCTGCAGGTGCACGG + Intergenic
1017315664 6:153028300-153028322 GTCAATGTGCAGCAGGTCCAAGG - Intronic
1017678242 6:156837187-156837209 GTCTTTGTTCTGCAAGAACCTGG + Intronic
1018418033 6:163618206-163618228 GTCATTCTTCTGCAGGAACATGG - Intergenic
1019449943 7:1092312-1092334 GTCGGTGTGCTGCAGGTGCACGG - Exonic
1019515355 7:1437601-1437623 GTGTCTGTGCGGCAGGTCCAAGG - Exonic
1019669704 7:2270816-2270838 GTCTTCCTGCAGCAGGGACAAGG + Intronic
1023639815 7:42246224-42246246 GTCTTTCTACTCCAGGCACATGG - Intergenic
1030548164 7:110924459-110924481 GTCCTCTTGCTGCAGGTACCAGG + Intronic
1034524485 7:151648556-151648578 GCCTTTGTGTTGCAGCTACTAGG - Intronic
1036991729 8:13605645-13605667 CTCTCTGTACTCCAGGTACATGG + Intergenic
1037577510 8:20221802-20221824 GCCCTTGTGTTGCAGGGACATGG + Intronic
1037846036 8:22283119-22283141 GACGGTGTGCTGAAGGTACAGGG - Exonic
1040571288 8:48613704-48613726 CTCTTTCTGCTGCAAGCACAGGG + Intergenic
1041773937 8:61503502-61503524 GTCTTTCTGCTGCAGGACCTGGG - Exonic
1042188058 8:66156618-66156640 GCCTTTGAGCTACAGGAACAAGG - Intronic
1047080174 8:121451699-121451721 GTATTTGTACTTCAGGCACATGG + Intergenic
1048561905 8:135548328-135548350 GTCTCTGTGATGCTGGTACAAGG - Intronic
1048701811 8:137099636-137099658 CTCTTTGTGCCCCAGGTTCAAGG + Intergenic
1049836963 8:144742300-144742322 GTCTTTGGGCTGAAGGGAAATGG + Intronic
1051279998 9:15432946-15432968 GTCTTTCTGGTGCAGGAACCTGG + Intronic
1051648725 9:19298083-19298105 GTCTTTGTGGTGAAGGAAAAGGG - Exonic
1061922669 9:133790803-133790825 CTCTTTGTGCTGCTGGCACCGGG + Intronic
1062035493 9:134380837-134380859 GGCTTTGAGCTGCAGGCAGACGG + Intronic
1185746030 X:2574211-2574233 GTCTCTGTGCTACAGGAACATGG - Intergenic
1187625221 X:21104517-21104539 TTCCTTTTGCTTCAGGTACACGG - Intergenic
1190875610 X:54458208-54458230 GTCTTTACCCTGCAGGCACAGGG - Intronic
1193058713 X:77181934-77181956 GTGTTAATCCTGCAGGTACATGG + Intergenic
1193434693 X:81458336-81458358 GGCTTTGTAGTGCATGTACATGG + Intergenic
1193723629 X:85016430-85016452 GTCTTTGTGTTTCAGCTACTTGG + Intronic
1196393250 X:115232200-115232222 AACTTTGTCCTGCAGGTAGAAGG + Intronic
1197175554 X:123482107-123482129 GTCTTTGTGTTGCTGGAACAAGG - Intronic
1198502998 X:137271143-137271165 GCCTGAGTGCTGCAGGCACAGGG + Intergenic
1199685218 X:150259344-150259366 GTCTTTGTGAAGCACATACAGGG + Intergenic
1201612876 Y:15862517-15862539 GTTTGTCTGGTGCAGGTACAGGG + Intergenic