ID: 1169139542

View in Genome Browser
Species Human (GRCh38)
Location 20:3219375-3219397
Sequence GGCTCAAGAAAGCCTCCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169139542_1169139546 -1 Left 1169139542 20:3219375-3219397 CCAGCGGGAGGCTTTCTTGAGCC 0: 1
1: 0
2: 1
3: 31
4: 190
Right 1169139546 20:3219397-3219419 CCAGGTGTTCAAGATCAGCCTGG 0: 23
1: 1754
2: 25451
3: 100817
4: 167986

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169139542 Original CRISPR GGCTCAAGAAAGCCTCCCGC TGG (reversed) Intronic
901729807 1:11271237-11271259 AGCTCAAGAGATCCTCCCGCCGG + Intergenic
902867561 1:19289196-19289218 GGCTCAAGACAGCGTCCCCATGG + Exonic
903904294 1:26672854-26672876 GGCTCAAGCAATCCTCCCACTGG + Intergenic
905182845 1:36177421-36177443 GGCTCAAGCAATCCTCCCCTTGG - Intronic
907053220 1:51343849-51343871 GGCTCAAGCGATCCTCCCGCTGG + Intronic
907971984 1:59392096-59392118 GACCCAAGAAGGCCTCCCTCAGG + Intronic
909674464 1:78223777-78223799 GGCTCAAGAAAGCCACACCTAGG + Intergenic
912998038 1:114551530-114551552 GGCTCAAGCAATCCTCCTGCTGG - Intergenic
913398251 1:118396944-118396966 GGCTCTAGAAACCCTCTCACTGG + Intergenic
913501112 1:119473526-119473548 GGCTAAAGGAAGCCTCCATCTGG - Intergenic
916203631 1:162294997-162295019 GGCTCAGGCAGGGCTCCCGCTGG - Intronic
918083855 1:181228541-181228563 GGCTCATAAAAGCCTCCCCCAGG + Intergenic
918191406 1:182178449-182178471 GGCTCAAGCGATCCTCCCACTGG + Intergenic
921710790 1:218371065-218371087 GGCTCAAGTGATCCTCCCACCGG - Intronic
923273518 1:232378101-232378123 GACTCAAGCAATCCTCCCCCCGG - Intergenic
924029564 1:239872584-239872606 GGCTTAAGGAAGCCTGCCTCAGG - Intronic
924159300 1:241213995-241214017 GACTCAAGTAATCCTCCCCCCGG + Intronic
1064550903 10:16499962-16499984 GGCTCAAGCAACCCTCCCAGAGG + Intronic
1066633050 10:37475490-37475512 GGCTCAAGTGACTCTCCCGCAGG - Intergenic
1067317614 10:45182889-45182911 GGCTCAAGTAATTCTCCTGCAGG - Intergenic
1070988954 10:80714741-80714763 GGGTCAAGACAGCCTTCCCCTGG + Intergenic
1071446511 10:85753752-85753774 GTCTCAGGACAGCCTCCCACGGG + Intronic
1071603774 10:86971280-86971302 CACTCAACAAAGCTTCCCGCGGG - Intronic
1072715319 10:97748275-97748297 GGCTCAGGAAGGCCTCCAGCTGG - Exonic
1073316461 10:102584411-102584433 GGCTCAAGAGATCCTCTCACTGG + Intronic
1076098823 10:127757406-127757428 GGCTCCAGCAAGCCTGCCCCAGG - Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1079055568 11:17203770-17203792 GGCTCAAGAGATCCTCCTGCTGG + Intronic
1081430802 11:42974694-42974716 TGCTCTAGAATGCCTCCTGCTGG - Intergenic
1082063746 11:47882146-47882168 GGCTCAAGGGATCCTCCTGCAGG - Intergenic
1084877592 11:72144689-72144711 GACTCAAGGAATCCTCCCACGGG + Intergenic
1088024109 11:105156945-105156967 GCCTCAAGAGATCCTCCCACTGG + Intergenic
1090089100 11:123678667-123678689 GGCTCAAGCAATCTTCCTGCTGG + Intergenic
1090285324 11:125495190-125495212 GGGTAAAGAAAGCCTCCTCCAGG + Intronic
1091272491 11:134327446-134327468 GGCTTAAGAATGTCTCCCACAGG - Intergenic
1093917386 12:24820670-24820692 GGCTCAAAATACCATCCCGCAGG - Intronic
1096265772 12:50121371-50121393 GGCTCAAGCGATCCTCCAGCCGG - Intergenic
1097854691 12:64450378-64450400 GCCTCAAGCAATCCTCCCACTGG + Exonic
1098485051 12:71011011-71011033 GACTCAAGCAATCCTCCTGCCGG + Intergenic
1102290587 12:111696156-111696178 GGCTCAAGCAATCCTGCCTCAGG + Intronic
1102507300 12:113391823-113391845 GGCTCAAGCGATCCTCCCACAGG + Intergenic
1103907279 12:124334366-124334388 AGCTGACGAAGGCCTCCCGCCGG + Intronic
1104004593 12:124883064-124883086 GGCTCAAGAGATCCTTCCACCGG - Intergenic
1105929779 13:25041613-25041635 GGCTCAAGAAATCCTAGCTCTGG - Intergenic
1106506429 13:30374651-30374673 AGCTCAGGAAATCCTCCCTCTGG - Intergenic
1106722642 13:32451780-32451802 GGCTCAAGCAATCCTCCTGCTGG + Intronic
1107339818 13:39394169-39394191 GCCTCAAGCAATCCTCCTGCCGG + Intronic
1110584680 13:77175050-77175072 GGCTCAAGCAATCCTCCCACCGG + Intronic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1115988152 14:39123988-39124010 GGCTCAGGCAATCCTCCTGCTGG + Intronic
1117552055 14:56846454-56846476 GGTTAAAGAAAGCCTCTCCCTGG - Intergenic
1119130515 14:72168329-72168351 GGCTCAGGAAAGGCTCCTTCAGG + Intronic
1119840610 14:77790138-77790160 GGCTCAAGCAATTCTCCTGCTGG + Intergenic
1121506970 14:94485029-94485051 GGCCCAAGAAAGGCTTCCCCAGG - Intergenic
1122790454 14:104182172-104182194 GTCTGCAGAGAGCCTCCCGCCGG + Intergenic
1122969524 14:105146873-105146895 GGCTCAGGAAGGCCTCAGGCAGG - Intronic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1125660572 15:41391508-41391530 GGTTCAAGAGATCCTCCTGCTGG - Intronic
1127224054 15:56912083-56912105 GGCTCAAGCAATCCTCCCCTTGG + Intronic
1128172207 15:65522955-65522977 GGCTCAAGTAATCCTCTGGCCGG + Intergenic
1129603793 15:77014939-77014961 GGCTCAAGTGAGCCTCCCAGAGG + Intronic
1130565269 15:84988697-84988719 GGCTCAAGGAAGCTTTCAGCTGG - Intronic
1133217005 16:4298742-4298764 GGCTCAAGCAATCCTGCCTCAGG + Intergenic
1134266964 16:12700994-12701016 GCCTCAAGTGACCCTCCCGCCGG - Intronic
1135590130 16:23699137-23699159 GGCTCAGGAAATCCTGCTGCAGG + Intronic
1136528050 16:30845808-30845830 GGCTCAAGAGATCCTTCAGCTGG + Intronic
1138644639 16:58415477-58415499 GTCTCAAGCAATCCTCCCACTGG - Intergenic
1139721514 16:68859746-68859768 GGCTCTGGAAAGCCTCCCCCAGG - Intronic
1146138137 17:30341055-30341077 GGCTCAGGAAAGCTCCCAGCAGG - Intergenic
1146894767 17:36533534-36533556 GCCTCAAGAAAGTCTCCACCAGG - Intronic
1147981692 17:44278703-44278725 GGCTCAAGCAATCCACCCGCCGG - Intergenic
1149641550 17:58206114-58206136 GGCCCGGGAAAGCCTCCCGCAGG - Exonic
1151692065 17:75692798-75692820 GGCTCAAGGAAGCCTCTCTCTGG - Intronic
1152071401 17:78135513-78135535 GGCTCAAGCGATCCTCCCGCCGG + Intronic
1152769590 17:82158947-82158969 GGCTCAAGCAACCCTCCCACTGG + Intronic
1153027428 18:684294-684316 GGCTCAAGAAATCCACAGGCTGG - Intronic
1155130468 18:22929613-22929635 ATCTCAAGTGAGCCTCCCGCGGG + Intronic
1157957908 18:52119542-52119564 GACTCAAGCAATCCTCCTGCAGG + Intergenic
1160490013 18:79329084-79329106 GCCTCAGGAAAGCCGCACGCAGG - Intronic
1160868847 19:1267950-1267972 GGCTCAAGACCCCCTCCCCCAGG - Intronic
1161067173 19:2244355-2244377 TGCTCACGAAGGCCTCCCGCTGG + Intronic
1161687500 19:5710490-5710512 GGCTCAAGCGATCCTCCCACAGG + Intronic
1161940964 19:7403766-7403788 GGCTCAAGAGATCCTCCTGCTGG + Intronic
1163423832 19:17229966-17229988 GGCTCAAGATCTCTTCCCGCAGG + Intergenic
1165462047 19:35949685-35949707 GGCTCAAGCAATCCTCCCTGAGG - Intergenic
1166322287 19:42025877-42025899 GGCTCAAGCAATCCTCCTGACGG - Intronic
1166363626 19:42267791-42267813 GGCAAAAGAAAGCCTCCCTGCGG + Intergenic
925599006 2:5589141-5589163 GGCACTACAAAGCCTCACGCTGG - Intergenic
926907143 2:17816527-17816549 GGCTGAGGAAAGTCTCGCGCAGG - Exonic
928939015 2:36708463-36708485 GGCTCAAGTAAGCCTCTAGGGGG + Intronic
931509543 2:62975650-62975672 GGCTCAAGTCATCCTCCCACTGG - Intronic
942178682 2:173358294-173358316 GGCTCAAGTGATCCTCCCACCGG - Intronic
942594202 2:177576927-177576949 GGCTCAAGCAATCCTGCCACTGG - Intergenic
945237086 2:207641033-207641055 GCCTCAAGCAATCCTCCTGCTGG + Intergenic
947425952 2:229983077-229983099 GGCTCAAACAATCCTCCTGCCGG + Intronic
947621005 2:231591077-231591099 AGCTCAAGAAATCCTCCTCCTGG + Intergenic
949072190 2:242032278-242032300 GGCGCAAGGAAGCCTCCAGGAGG - Intergenic
1169139542 20:3219375-3219397 GGCTCAAGAAAGCCTCCCGCTGG - Intronic
1171369095 20:24649121-24649143 GGGCCAAGGAAGCCTCCCCCAGG + Intronic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1173291165 20:41716450-41716472 GGCTCCAGGAAGCCCCCCTCGGG + Intergenic
1174025452 20:47570207-47570229 GGCTCAAGCAATCCGCCTGCTGG - Intronic
1175109033 20:56633099-56633121 GGCTCAAGTAATTCTCCAGCAGG - Intronic
1175546472 20:59781315-59781337 GCCTCAAGAAGGCCTCTCGATGG + Intronic
1175651469 20:60728124-60728146 GGCTAGAGAAAGCCTCCCTTAGG - Intergenic
1177220013 21:18180374-18180396 GGCTCAAGCAATCCTCCTGCTGG + Intronic
1177520564 21:22217160-22217182 GGCTAAAAAATGCCTCCCCCAGG - Intergenic
1178474979 21:32930302-32930324 GGTTCAAGCAATCCTCCTGCTGG + Intergenic
1178546878 21:33499996-33500018 GGCTCAAGCAGTCCTCCTGCAGG + Intergenic
1178942816 21:36921556-36921578 GGCTCAGGAAAGCCTCATGGTGG + Intronic
1180123521 21:45769973-45769995 GGCTAAACAAAACCTCCTGCAGG - Intronic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG + Intergenic
1183421090 22:37711867-37711889 GGCTCAAGAAGGCTTAGCGCTGG - Intronic
1184126614 22:42491815-42491837 GCCTCAAGAAATCCTCCCACCGG - Intergenic
950089001 3:10281626-10281648 TACTCAAGAAAGTCTCCAGCTGG - Intronic
950581989 3:13868376-13868398 GGCTCAAGCAATCCTTCCACTGG - Intronic
952627021 3:35418067-35418089 GGTTCAAGAAAGGCTGCCTCAGG + Intergenic
953860132 3:46537222-46537244 GGCTCAAGCGATCCTCCCACAGG + Intronic
955225887 3:57060202-57060224 GGCTCAAGAGATCCTCCCACAGG - Intronic
957431885 3:80121101-80121123 GGCTCAAATGATCCTCCCGCTGG - Intergenic
959358366 3:105360124-105360146 GGCTCAAGAGAGCCTCCCAAAGG + Intergenic
961172946 3:124811870-124811892 GGGTCAAGAAAGCCTGCACCCGG - Intronic
961221198 3:125201539-125201561 GGCTCAAGCAATCCTCCCATGGG - Intronic
962964107 3:140337694-140337716 GGCTCAAGAAATCCTACTGAAGG - Intronic
963798216 3:149652388-149652410 GCCTCAAGCAATCCTCCCACCGG - Intronic
964107909 3:153058659-153058681 GGCTCAAGTGATCCTCCTGCTGG + Intergenic
964620378 3:158715316-158715338 CACTCTAGAAAGCCTCCCGCAGG - Intronic
965490249 3:169326115-169326137 AGCTCAAGGAAGCCTCTCGGTGG + Intronic
966604415 3:181808181-181808203 GGCTCAAGCGGTCCTCCCGCTGG + Intergenic
967186168 3:186946476-186946498 GGTTCAAGTGATCCTCCCGCCGG + Intronic
968086119 3:195874700-195874722 GGCACAAGAAACTCTCCCTCGGG + Intronic
968589174 4:1449174-1449196 GGCTTAACAAAGCCTCTCCCAGG - Intergenic
969305438 4:6323702-6323724 GGCTGAAGCAATCCTCCCACCGG - Intronic
969623768 4:8292262-8292284 GGCTCCAGGAAGCCTCAGGCGGG + Intronic
970394086 4:15647948-15647970 GGCTCAAGTGATCCTCCTGCTGG + Intronic
972516615 4:39815502-39815524 GGCTCAAGAAAGCCTGATGCAGG + Intergenic
975231782 4:71943977-71943999 AGCTCAAGAAAGCTTGCCGTAGG + Intergenic
976709229 4:88051226-88051248 GGCTCAAGAAGGCCTGCAGTGGG - Intronic
977245256 4:94623442-94623464 GGCTCAAGAAAGCTTCACAAAGG - Intronic
981004273 4:139859321-139859343 GGCTAAAGCAATCCTCCTGCCGG + Intronic
982650188 4:158078784-158078806 AGCTCAAGCAATCCTCCCACTGG + Intergenic
984873552 4:184348142-184348164 GGGGCCCGAAAGCCTCCCGCTGG - Intergenic
985211102 4:187595551-187595573 GGCTCAAGTAATCCTCCTCCTGG - Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985706703 5:1405743-1405765 TGCTCACGCAAGCCTCCCTCTGG - Intronic
992782862 5:80143735-80143757 GGGTCAAGATGGCCTCCTGCTGG - Exonic
997479855 5:134176878-134176900 GGCTCTCGTCAGCCTCCCGCCGG - Exonic
1000242743 5:159423681-159423703 AGGTAAGGAAAGCCTCCCGCAGG + Intergenic
1001089752 5:168728685-168728707 GGCTCAAGCAGTCCTCCCACTGG - Intronic
1001169749 5:169407898-169407920 GGCTCAAGCAATCCTCCCTTGGG - Intergenic
1005215178 6:23518395-23518417 GGCTCAAGCAATCCTCCCACTGG + Intergenic
1008308463 6:49934855-49934877 GGCTCAAGAAAGCCTCTAGCAGG + Intergenic
1010249229 6:73691287-73691309 GCCCCAGGAAAGCCTCCAGCTGG + Intergenic
1014643706 6:123946996-123947018 AGCTCAATAAAGACTCCAGCAGG - Intronic
1020060178 7:5145503-5145525 GGCTCAATGAATCCTCCTGCTGG + Intergenic
1022510380 7:30931611-30931633 GGGCCCAGAAATCCTCCCGCAGG - Intergenic
1024587197 7:50852103-50852125 GGCTGAGGGAAGCCTCCTGCAGG + Intergenic
1024683238 7:51716684-51716706 GGCTCAAGCAATCCTCCCACTGG - Intergenic
1026359443 7:69590297-69590319 GGCTCAAGCAATCCTCCCTCTGG - Intergenic
1026834555 7:73629499-73629521 GGCTCAAGCAATCCTCCCCTTGG - Intergenic
1026874371 7:73871070-73871092 GGCTGGAGAAAGCCTCCCGAGGG - Intergenic
1027131724 7:75596003-75596025 GGCTCAAGCAGTCCTCCCGCTGG - Intronic
1029449426 7:100632644-100632666 GGCTCAAGCGATCCTCCCACCGG + Intronic
1029838484 7:103338032-103338054 GGCTCAAGCAATCCTCCACCTGG - Intronic
1029985159 7:104916291-104916313 GGCTCAAAAAATCCTCCTGTTGG - Intergenic
1030057986 7:105600244-105600266 GGCTCAAAGAATCCACCCGCTGG + Intronic
1030619248 7:111771377-111771399 GGCACAAGAAAGCTGCCCGACGG + Intronic
1033593501 7:142835696-142835718 GGCTCAAGACTGCCTCACTCTGG + Intergenic
1033722899 7:144080753-144080775 GGCTGAAGAAATGCTCCCGGTGG + Intergenic
1039063858 8:33592969-33592991 GGCTTAAGAAATCCTCCTGCTGG + Intronic
1039517167 8:38143874-38143896 GGCTCAAGAATGCCATGCGCTGG - Exonic
1040434879 8:47380515-47380537 GGCTCAAGAAAGGCACCTGCCGG - Intronic
1040911290 8:52521647-52521669 GGCTCAAGCAATCCTCCCCTGGG - Intergenic
1042484087 8:69332581-69332603 GGCACAAGGAAGCCTCCAGGAGG - Intergenic
1045754821 8:105530191-105530213 GGCTACAGAAAGTCTCCCACTGG - Intronic
1046756536 8:117978392-117978414 GGCTGAAGAAAGCCTGCAGATGG - Intronic
1047287712 8:123502519-123502541 GGCTCAAGCAATCCTCCCCTGGG + Exonic
1048439803 8:134451446-134451468 GGCTCATGGAAGCCTCCTTCTGG - Intergenic
1049708734 8:144054348-144054370 GGCCCAGGAAGGCCTCCCGAGGG - Intronic
1050739696 9:8805697-8805719 GGTTCAAGAAATTCTCCTGCTGG + Intronic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1056405152 9:86266820-86266842 GGCTCAAGCGATCCTCCCACAGG + Intronic
1057212023 9:93205564-93205586 GGCTCCAGACAGCCGGCCGCGGG - Intronic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1186102144 X:6168564-6168586 GGCTCTAGAAGTCCTCCTGCTGG + Intronic
1190280061 X:48923542-48923564 GGCTCCAGAAAGCCCCTCTCAGG + Intronic
1200204636 X:154307052-154307074 GTCTCAAGAGATCCTCCTGCTGG - Intronic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic
1201494922 Y:14582666-14582688 GGCCCTAGAAATCCTCCTGCTGG - Intronic
1202047788 Y:20751807-20751829 GGCTCAAGGAATCCTCTTGCTGG - Intergenic