ID: 1169141593

View in Genome Browser
Species Human (GRCh38)
Location 20:3229988-3230010
Sequence GGTGACGGGGCCGCCCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 5, 3: 9, 4: 217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169141593_1169141600 -8 Left 1169141593 20:3229988-3230010 CCACCTGGGGCGGCCCCGTCACC 0: 1
1: 0
2: 5
3: 9
4: 217
Right 1169141600 20:3230003-3230025 CCGTCACCCTCCAGCGTGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 138
1169141593_1169141598 -9 Left 1169141593 20:3229988-3230010 CCACCTGGGGCGGCCCCGTCACC 0: 1
1: 0
2: 5
3: 9
4: 217
Right 1169141598 20:3230002-3230024 CCCGTCACCCTCCAGCGTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 178
1169141593_1169141604 15 Left 1169141593 20:3229988-3230010 CCACCTGGGGCGGCCCCGTCACC 0: 1
1: 0
2: 5
3: 9
4: 217
Right 1169141604 20:3230026-3230048 CTCTGCCCTCTGCCAGCCCAAGG 0: 1
1: 0
2: 6
3: 89
4: 670

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169141593 Original CRISPR GGTGACGGGGCCGCCCCAGG TGG (reversed) Intronic
900086735 1:902187-902209 GGTGACTTAGCGGCCCCAGGAGG + Intergenic
900488769 1:2935954-2935976 GGAGACGGACCCGCCCCAGTGGG + Intergenic
903205966 1:21782891-21782913 GGAGACGGTGCGGCCCGAGGAGG - Exonic
903789209 1:25881228-25881250 GGATCCGAGGCCGCCCCAGGTGG - Intergenic
904252890 1:29237516-29237538 GGTCCCGGGGCCGCCCGAGGGGG + Intronic
904738223 1:32651328-32651350 GGTGCCGGGGCCGACCCAGGAGG + Intronic
908416994 1:63923032-63923054 TGTGACAGGGCCAACCCAGGAGG - Intronic
908555700 1:65254703-65254725 GGCGGCGGGGCCGTCCCCGGCGG + Intronic
910736599 1:90465216-90465238 GGTGACTGTGCCCCCCAAGGAGG + Intergenic
910759452 1:90719793-90719815 GGTGACTGGGCCCCGCCGGGTGG + Intergenic
915142450 1:153775948-153775970 GGGGACGGTGCCGCCAGAGGTGG + Exonic
915246283 1:154558456-154558478 GGGGCCGGGGGCGGCCCAGGGGG - Exonic
915490442 1:156247438-156247460 GCAGGCGGAGCCGCCCCAGGAGG + Intronic
918064336 1:181089331-181089353 CGTGGAGGGGCCGCGCCAGGCGG + Exonic
920886939 1:209938361-209938383 GCTGACGGGGCCGCCTCCTGTGG + Intronic
922803924 1:228376153-228376175 GGTGGCTGGGCCCTCCCAGGAGG - Exonic
922891549 1:229065839-229065861 GGTGGCAGGGCCGCCTGAGGCGG - Intergenic
923055842 1:230425702-230425724 GGTGGCGGGGCGGCCCCTGGGGG + Intronic
923855089 1:237837798-237837820 AGAGACTGGGCAGCCCCAGGCGG + Intergenic
1063115021 10:3067186-3067208 GATGACGGGAGCGCCACAGGTGG - Intronic
1065100355 10:22325540-22325562 GGGGGCGGGGCAGCCCCACGAGG - Intronic
1067499490 10:46789578-46789600 GGTGACGGGGCCTCCAAAGTTGG + Intergenic
1067595139 10:47550744-47550766 GGTGACGGGGCCTCCAAAGTTGG - Intergenic
1067642248 10:48058827-48058849 GGTGACGGGGCCTCCAAAGTTGG - Intergenic
1069438542 10:68407322-68407344 GGCGCCCGGGCGGCCCCAGGGGG + Intergenic
1070790946 10:79188988-79189010 GGTGACTGGGACACCCCAGATGG - Intronic
1070886827 10:79907749-79907771 GGTGACGGGGCCTCCAAAGTTGG + Intergenic
1072591812 10:96833323-96833345 GCGGACGGGGGCGCCCCGGGAGG + Intronic
1076909756 10:133381111-133381133 GGTGACGGGACAGCCCGAGGAGG - Intronic
1077014390 11:393382-393404 GGGGGCGGGGCCGCCCCAGGGGG - Intronic
1078771692 11:14358346-14358368 GGTGAAGGCGCGGCCGCAGGCGG + Intronic
1083679157 11:64343345-64343367 GGTGACGGGGCAACCCAAGTGGG - Intronic
1083682778 11:64359017-64359039 GGAGACAGGGCGGCCCCAGCCGG + Intergenic
1083899176 11:65635488-65635510 GGTCAGGGGGCCGGCCCAAGGGG - Intronic
1084264659 11:67998582-67998604 GGTTACAGGGCCGCCCAATGAGG + Intronic
1091550282 12:1530968-1530990 GGCGGCGGGGCCGTCCCCGGGGG - Intronic
1091869179 12:3873176-3873198 CGGGACGGGGCGGGCCCAGGGGG - Intronic
1096465961 12:51848017-51848039 GGTGACGGGGCAGTGACAGGAGG - Intergenic
1097925304 12:65121092-65121114 GGAGGCCGGGCCGCCGCAGGAGG - Exonic
1098747893 12:74263993-74264015 AGTGAAGGTGCCACCCCAGGGGG - Intergenic
1100978106 12:100142885-100142907 GGGGGCGGGGCGGCTCCAGGCGG + Intergenic
1103224795 12:119277432-119277454 GGTGACTGGGCGGCTCCAAGAGG + Intergenic
1103308768 12:119988767-119988789 GGGGGCGGGGCCGCGCCTGGAGG + Intergenic
1105557298 13:21459236-21459258 GGTGACTCGGACGCTCCAGGCGG + Exonic
1112225668 13:97537564-97537586 GGTGACTCGGCTACCCCAGGAGG + Intergenic
1113568836 13:111339130-111339152 GGTGGCGGGGCTGCCCCTCGTGG + Intronic
1113615534 13:111677909-111677931 GGGGACGCAGCCGGCCCAGGAGG + Intergenic
1113621002 13:111762811-111762833 GGGGACGCAGCCGGCCCAGGAGG + Intergenic
1113801482 13:113088767-113088789 GCTGACGGGTCCGTCCCAGAGGG + Intronic
1116958146 14:50944539-50944561 GGGGACGGCACCGCCCGAGGGGG - Exonic
1117918110 14:60699816-60699838 GGTGACGGGGTCTCACCATGTGG + Intergenic
1118494154 14:66291558-66291580 GGAGACCGGGCCACCCCAGAAGG - Intergenic
1118992544 14:70809422-70809444 GGTGACGAGGCCGCCCCCGGGGG - Exonic
1119545396 14:75468051-75468073 GGTGGAGCGGCCTCCCCAGGGGG - Intronic
1121791750 14:96704367-96704389 GGTGAAGAGGGGGCCCCAGGAGG - Intergenic
1122270301 14:100565999-100566021 AGTGTCGGGGCTGCCCCAGTGGG - Intronic
1122852708 14:104545692-104545714 GGGGAGGGGGCCGCTCCAGCTGG - Intronic
1126113316 15:45187830-45187852 GGTGCGGGAGCCGGCCCAGGAGG - Intronic
1129619220 15:77128536-77128558 GGTGATGGTGCCACCCCAGTGGG + Intronic
1132542735 16:518839-518861 GGTCACAGGGCGGCCCCAGCAGG + Intronic
1132581716 16:687767-687789 AGTGACGGGGCTGGCCCATGAGG + Intronic
1133233242 16:4376221-4376243 GGAGACGGGGCGGACCCAGCCGG + Intronic
1133238807 16:4402871-4402893 GGTGAAGGGGCCTCCCGAGCTGG - Intronic
1136466805 16:30449937-30449959 GGTGACAGGGCGCCCCCTGGAGG - Intergenic
1137614561 16:49838910-49838932 GGTCCCGGGGCCGCCCCCGCGGG + Intronic
1138237472 16:55396938-55396960 GGTGACATGGCTGCCCCATGAGG - Intronic
1141829244 16:86500499-86500521 GCTGGTGGGGCCTCCCCAGGAGG + Intergenic
1142156276 16:88534125-88534147 GGGGGCGCGGCCGGCCCAGGGGG - Exonic
1142248924 16:88982351-88982373 CGTGAAGGGGCCAGCCCAGGGGG + Intergenic
1142858881 17:2749354-2749376 GGCGCCGGAGCGGCCCCAGGGGG - Intergenic
1143503746 17:7352857-7352879 GGTCACGGGGCCCCCAAAGGAGG - Exonic
1144733174 17:17540287-17540309 GAGGAGGGGGCTGCCCCAGGTGG + Intronic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147965724 17:44193358-44193380 GAACACGGGGCCACCCCAGGAGG + Exonic
1148021797 17:44558211-44558233 GGTGCCGGGGGCACCCCGGGTGG + Exonic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1149994008 17:61397407-61397429 GGGGAGGGGGCCGGCCTAGGTGG + Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150210278 17:63437958-63437980 GGTGGCGGGGCCGCCGTGGGAGG - Intronic
1151540963 17:74764336-74764358 GGGGACAGGGCCTCCCCAGTGGG - Intronic
1153457505 18:5296190-5296212 GACTACGGGGCCGCCCCCGGAGG + Intronic
1153474948 18:5489066-5489088 CGTGCCGGAGCCGCCCAAGGAGG - Exonic
1158922284 18:62206487-62206509 GGTGATGGGGGAGCCCAAGGTGG + Intronic
1159040329 18:63318530-63318552 GGTGCGGGGGCGGCCCCCGGGGG + Exonic
1159942610 18:74420083-74420105 GGTGTGGGGGCAGCCCCTGGAGG - Intergenic
1160384730 18:78488249-78488271 AGTGGAGAGGCCGCCCCAGGAGG - Intergenic
1160496454 18:79378866-79378888 GGTGACGGGGCCCACCCTGATGG - Intergenic
1160500811 18:79400461-79400483 GCCGCCGCGGCCGCCCCAGGTGG + Intronic
1160613968 18:80109731-80109753 GGAGCGGGGGCCGCCCCGGGAGG + Intronic
1160897030 19:1407881-1407903 CTTGACGGGGCGGCCCCGGGGGG - Intronic
1160989987 19:1856579-1856601 GGTCGCGGGTCCGCCCCAGCTGG + Intronic
1161021233 19:2012719-2012741 GGTGAGGGGTCTGCCCCCGGGGG - Intronic
1161102336 19:2427361-2427383 GGCGACAGGGCCACCCCTGGGGG - Intronic
1161284857 19:3463780-3463802 GCTGACGGGGGCGCTCCAGACGG - Intronic
1161333821 19:3700405-3700427 GGCGGCGGGGGCGCCCGAGGGGG + Exonic
1161480659 19:4508735-4508757 GGGGACGGGGCAGCAGCAGGGGG + Intronic
1161776057 19:6262775-6262797 GGAGACAGGGGAGCCCCAGGTGG + Intronic
1161904843 19:7149040-7149062 GGTGACGCAGCTACCCCAGGCGG - Intronic
1162026175 19:7895271-7895293 GGGGAGGGGGCCACCCGAGGAGG + Intronic
1162033247 19:7926173-7926195 GGGGGCGGGGCCGCCGCGGGGGG + Intergenic
1162896248 19:13766129-13766151 GGTGAGAGGGCCTCCTCAGGGGG + Exonic
1163266770 19:16226754-16226776 GGTGACGGGGGCCTCCCAGCTGG - Intronic
1163368431 19:16888974-16888996 GGAGACCGGGCTGCCCCACGTGG - Exonic
1163698436 19:18775457-18775479 GGTGGCGGGGAGGCCCCAGGTGG + Intronic
1163843960 19:19628287-19628309 GGAGGCGGGGCTCCCCCAGGTGG - Intronic
1164805999 19:31117400-31117422 GGTGACGGGGCCGGGTGAGGTGG + Intergenic
1165423200 19:35732427-35732449 GGAGATGGGGCCGGGCCAGGGGG - Exonic
1165624323 19:37271701-37271723 GGTGGCGGCGCAGCCCGAGGCGG + Intergenic
1165625407 19:37276766-37276788 GGTGGCGGCGCAGCCCGAGGCGG + Intergenic
1165625940 19:37279291-37279313 GGTGGCGGCGCAGCCCGAGGCGG + Intergenic
1165626484 19:37281818-37281840 GGTGGCGGCGCAGCCCGAGGCGG + Intergenic
1165627023 19:37284343-37284365 GGTGGCGGCGCAGCCCGAGGCGG + Intergenic
1165627566 19:37286867-37286889 GGTGGCGGCGCAGCCCGAGGCGG + Intergenic
1165628101 19:37289391-37289413 GGTGGCGGCGCAGCCCGAGGCGG + Intergenic
1165628643 19:37291917-37291939 GGTGGCGGCGCAGCCCGAGGCGG + Intergenic
1165629183 19:37294442-37294464 GGTGGCGGCGCAGCCCGAGGCGG + Intergenic
1165629726 19:37296968-37296990 GGTGGCGGCGCAGCCCGAGGCGG + Intergenic
1165630268 19:37299495-37299517 GGTGGCGGCGCAGCCCGAGGCGG + Intergenic
1165630807 19:37302033-37302055 GGTGGCGGCGCAGCCCGAGGCGG + Intergenic
1165749919 19:38253393-38253415 GGGGAAGGGGCCGCCCCAGCTGG - Intronic
1166669439 19:44701202-44701224 GGTTAGGCGGCTGCCCCAGGAGG + Intronic
1167265503 19:48480979-48481001 GGGGCCTGGGCCGCCCCAGGAGG + Intronic
1167795206 19:51704268-51704290 AGTGACGGGCCCGCCCCCGCGGG + Intergenic
1168144849 19:54415364-54415386 GGGGACGGTGCTGCCCCTGGTGG - Intronic
1168588587 19:57614485-57614507 GGTGATGGGCCCGGCGCAGGTGG + Exonic
1168692555 19:58385802-58385824 AGAGACAGGGCGGCCCCAGGTGG + Intergenic
1168715531 19:58525016-58525038 GGTGACTGGGCCTCCTCAGCTGG + Intronic
925058870 2:875920-875942 GGTGACGGGGGAGCCCCAGCAGG + Intergenic
925291692 2:2752228-2752250 GGTGTCGGGGCTGCCACAGGTGG + Intergenic
926109437 2:10172634-10172656 GGCGAAGGGGCCGACCCAGCAGG - Intronic
928944529 2:36760804-36760826 TGGGAAGGGGCTGCCCCAGGGGG - Intronic
932412799 2:71557286-71557308 GGAGAAGGGGATGCCCCAGGTGG + Intronic
932737448 2:74264207-74264229 GGTGGCGGTGCCTCCTCAGGAGG + Exonic
932816377 2:74865385-74865407 GGTGGCGAGGCTGCCCCTGGTGG - Intronic
934662477 2:96150471-96150493 GGTCACAGGGGAGCCCCAGGAGG - Intergenic
934933264 2:98445303-98445325 GAAGACGCGGCCGCCCCAGCAGG + Intronic
937224873 2:120363065-120363087 GGAGACGGGGCTGCCCGCGGGGG - Intergenic
938776468 2:134545536-134545558 GGTGAGGGGGCAGTGCCAGGAGG - Intronic
943571531 2:189580843-189580865 GGGGACGGGGCGGCCCCAGTCGG - Exonic
946219994 2:218217657-218217679 GGTGTAGGGGCTGCCCCAGCGGG + Intronic
947650294 2:231780973-231780995 GGGGCGGGGGCCGCGCCAGGTGG - Intronic
948668426 2:239551000-239551022 GATGACGCAGCCTCCCCAGGTGG - Intergenic
1169141593 20:3229988-3230010 GGTGACGGGGCCGCCCCAGGTGG - Intronic
1174317460 20:49713754-49713776 GGTGGCGGCGGCGGCCCAGGAGG - Exonic
1176084516 20:63289926-63289948 GATGCCAGGGCCTCCCCAGGAGG - Intergenic
1176367859 21:6044620-6044642 GGTGAGGGGCCAGCCACAGGTGG - Intergenic
1176369110 21:6051978-6052000 GGGGACGTGGAAGCCCCAGGAGG + Intergenic
1177041765 21:16121329-16121351 GGTCATGGGGCAGCACCAGGAGG + Intergenic
1178431483 21:32522126-32522148 GGTGAGGCTGCAGCCCCAGGGGG - Intergenic
1178872178 21:36385734-36385756 GGGGAGGGGCCCGCCCCGGGAGG - Intronic
1179754409 21:43486563-43486585 GGGGACGTGGAAGCCCCAGGAGG - Intergenic
1179755660 21:43493922-43493944 GGTGAGGGGCCAGCCACAGGTGG + Intergenic
1180212198 21:46301802-46301824 GGTCACGGGGCCATTCCAGGGGG - Exonic
1183180448 22:36256482-36256504 GGGGACAGGGCAGCACCAGGAGG + Intronic
1183484636 22:38082460-38082482 AGAGGCGGGGCCGGCCCAGGGGG - Intronic
1184276287 22:43411446-43411468 GGTGCCCCGGCGGCCCCAGGAGG + Exonic
1184599881 22:45537146-45537168 GGTGATGGGGCCACCCCAGGTGG - Intronic
1184645466 22:45892486-45892508 GCTGCGGGGGCCGCCTCAGGAGG + Intergenic
1185254888 22:49826795-49826817 GGAGACGGGGCCGCACCCCGCGG + Intronic
963005623 3:140724078-140724100 GGTGACATGCCCGCCCCATGAGG + Intergenic
966261580 3:177984857-177984879 GGTGCCGGGGAGGCCCCAAGAGG - Intergenic
968048075 3:195635259-195635281 GGTGCCGGGGCGGTGCCAGGTGG - Intergenic
968099327 3:195954361-195954383 GGTGCCGGGGCGGTGCCAGGTGG + Intergenic
968232348 3:197011349-197011371 GGTGACCTGGAGGCCCCAGGAGG - Intronic
968306536 3:197654662-197654684 GGTGCCGGGGCGGTGCCAGGTGG + Intergenic
968510094 4:991808-991830 GGCGAGGGGTCCGCCCCAAGGGG - Intronic
968520550 4:1032954-1032976 GGTGTCGGGGGCTCCCCTGGTGG + Intergenic
968975384 4:3819709-3819731 GGTGACGCTGCCTCCCCAGCGGG - Intergenic
969379212 4:6783077-6783099 GGAGACCGGGCCGCCGCCGGGGG + Intronic
969467441 4:7366150-7366172 GATGACGGGGCCTGCCAAGGAGG - Intronic
969506892 4:7593660-7593682 GGGGTGGGGGCGGCCCCAGGCGG + Intronic
969536716 4:7760794-7760816 GGTGAGGGGGCCGACCCCTGCGG - Exonic
969657481 4:8506617-8506639 GGTGATGGCTCTGCCCCAGGGGG + Intergenic
969873033 4:10116498-10116520 CGTGGCGGGGCCGCCCTCGGTGG - Intronic
983930763 4:173450851-173450873 GGTCACTGGGCCTCCCCAGAGGG + Intergenic
985487579 5:160164-160186 GGTGCCGAGGCCGCCACATGCGG - Intronic
986710006 5:10481687-10481709 GGTGACGTGGGGGGCCCAGGTGG + Intergenic
986743753 5:10726560-10726582 GGTGCCGGCCCCGGCCCAGGAGG + Intronic
991769308 5:70025695-70025717 GTGGACACGGCCGCCCCAGGAGG + Intronic
991848603 5:70901113-70901135 GTGGACACGGCCGCCCCAGGAGG + Intronic
997353580 5:133248114-133248136 GGAGACAGAGCCGCCACAGGAGG - Intronic
1004043957 6:12009177-12009199 GGCCGCGGGGCCGCGCCAGGGGG + Intronic
1006193207 6:32222035-32222057 GGATTGGGGGCCGCCCCAGGAGG - Intronic
1006402098 6:33823790-33823812 GGTGACAGCGCTGGCCCAGGTGG + Intergenic
1019016888 6:168886411-168886433 ACTGGCGGGGCCTCCCCAGGTGG + Intergenic
1019143354 6:169962007-169962029 GGCGCCGGCGCAGCCCCAGGAGG + Intergenic
1019537524 7:1537076-1537098 GTAGCCGGGGGCGCCCCAGGAGG - Intronic
1019726867 7:2607659-2607681 GCTGACGGGGATGCCCCAGCAGG + Intronic
1023743649 7:43302602-43302624 CGGTACGGGGCCGCCCCGGGAGG + Intronic
1026873063 7:73865058-73865080 GGTGTCAGGGCTGGCCCAGGAGG + Exonic
1027054863 7:75042999-75043021 CGGGACGGGGCCGCCCAAGCAGG + Exonic
1027223997 7:76232746-76232768 GGAGACGGGGCTGGACCAGGAGG + Intronic
1033174178 7:139109622-139109644 CGAGAGGGGGCCACCCCAGGCGG - Exonic
1034224964 7:149474957-149474979 GGTGAAGGGCCGGCCCCCGGGGG + Exonic
1036016155 8:4787194-4787216 GGTCGCGGGGCCCCGCCAGGGGG + Intronic
1036156948 8:6350908-6350930 GCTGAGGGGACCACCCCAGGGGG + Intergenic
1038065260 8:23957211-23957233 GGTAATGGTGCAGCCCCAGGAGG - Intergenic
1040038827 8:42896724-42896746 GGTGGCGGGGGCGCGCCCGGCGG + Intronic
1040483817 8:47851770-47851792 GGAGAGGGGGCTGCCACAGGAGG + Intronic
1048009201 8:130443145-130443167 GGGGACGGGGCCCGCCCTGGGGG - Intronic
1048454484 8:134565647-134565669 GCTCATGGGGCCTCCCCAGGTGG - Intronic
1049311990 8:141938245-141938267 GGAGCCGGGGCCACCCCCGGAGG - Intergenic
1049616454 8:143577703-143577725 GGTGTCCGGGCCGCTCCTGGTGG - Exonic
1049828672 8:144686023-144686045 GGCGACGGGGCGGGGCCAGGCGG - Intergenic
1056163523 9:83921214-83921236 GGGGTCGGGGCCGCCGCGGGTGG - Intronic
1056243287 9:84669936-84669958 GTAGCCGAGGCCGCCCCAGGGGG - Intronic
1056747721 9:89318685-89318707 GGTGACGGGGCTGGTCCAGCGGG + Intronic
1056764236 9:89435094-89435116 GGGGAAGGGGCCGGCCAAGGCGG + Intronic
1059438428 9:114289735-114289757 GGTGAGGGGGGCGCACCCGGGGG - Intronic
1059470878 9:114504406-114504428 GCTGTCGGGGCCGCCCCAGGCGG + Exonic
1060667127 9:125438719-125438741 GGTGTCGGGGGCCCCCTAGGAGG - Exonic
1061301211 9:129705939-129705961 GGTGCCGGGGAGGCCCCAAGAGG - Intronic
1062290798 9:135793523-135793545 GGGGTCAGGGCTGCCCCAGGTGG + Intergenic
1062357236 9:136170713-136170735 GGGGACTGGGCTGCGCCAGGTGG - Intergenic
1190560670 X:51682560-51682582 GGGGACGGGGCGGGCCCCGGCGG + Intergenic
1190563621 X:51710761-51710783 GGGGACGGGGCGGGCCCCGGCGG - Intergenic
1196776219 X:119340202-119340224 GGAGACGGGGGCGGCCCATGAGG - Intergenic
1197767219 X:130067041-130067063 GGTGACGGGGGCCCCCATGGAGG - Exonic
1198051872 X:132958312-132958334 TGTCCCGGGGCCGCCGCAGGCGG - Exonic
1200233544 X:154458000-154458022 GGTTCCGGGGTCGCCCGAGGCGG + Intergenic
1200787714 Y:7274318-7274340 GGCGCCCGGGCCGGCCCAGGCGG + Intergenic