ID: 1169143556

View in Genome Browser
Species Human (GRCh38)
Location 20:3238931-3238953
Sequence AGCCGCGGGGAGGAGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 611
Summary {0: 1, 1: 0, 2: 2, 3: 76, 4: 532}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169143556_1169143574 22 Left 1169143556 20:3238931-3238953 CCCGCGCCCTCCTCCCCGCGGCT 0: 1
1: 0
2: 2
3: 76
4: 532
Right 1169143574 20:3238976-3238998 CCACCGGCCCCGGCCCGCGCAGG 0: 1
1: 1
2: 12
3: 40
4: 542
1169143556_1169143577 29 Left 1169143556 20:3238931-3238953 CCCGCGCCCTCCTCCCCGCGGCT 0: 1
1: 0
2: 2
3: 76
4: 532
Right 1169143577 20:3238983-3239005 CCCCGGCCCGCGCAGGCAGACGG 0: 1
1: 0
2: 1
3: 14
4: 173
1169143556_1169143569 12 Left 1169143556 20:3238931-3238953 CCCGCGCCCTCCTCCCCGCGGCT 0: 1
1: 0
2: 2
3: 76
4: 532
Right 1169143569 20:3238966-3238988 GCCCTCTCGCCCACCGGCCCCGG 0: 1
1: 0
2: 1
3: 24
4: 266
1169143556_1169143567 6 Left 1169143556 20:3238931-3238953 CCCGCGCCCTCCTCCCCGCGGCT 0: 1
1: 0
2: 2
3: 76
4: 532
Right 1169143567 20:3238960-3238982 CCCGCAGCCCTCTCGCCCACCGG 0: 1
1: 0
2: 0
3: 18
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169143556 Original CRISPR AGCCGCGGGGAGGAGGGCGC GGG (reversed) Intronic
900087377 1:904946-904968 CGCCGCGGGGAGGCGGGTGAGGG + Intergenic
900101635 1:964542-964564 GGCTGCGGGGAGGGGGGCGCGGG + Intronic
900101659 1:964612-964634 TGCTGCGGGGAGGGGGGCGCGGG + Intronic
900101672 1:964650-964672 TGCTGCCGGGAGGGGGGCGCGGG + Intronic
900101686 1:964688-964710 TGCTGCCGGGAGGGGGGCGCGGG + Intronic
900101700 1:964726-964748 TGCTGCCGGGAGGGGGGCGCGGG + Intronic
900101714 1:964764-964786 TGCTGCCGGGAGGGGGGCGCGGG + Intronic
900101728 1:964802-964824 TGCTGCCGGGAGGGGGGCGCGGG + Intronic
900101807 1:965144-965166 AGCGTCGGGGAGGATGGCGGCGG - Exonic
900180437 1:1308765-1308787 GGAGGCGGGAAGGAGGGCGCGGG + Intronic
900227662 1:1540503-1540525 AGGCGCGGGGGGGGGGGCGCCGG + Intergenic
900284391 1:1892028-1892050 AGGACCGGGGAGCAGGGCGCTGG - Intergenic
900382514 1:2391897-2391919 GGCCGCGGGAAGGAGGACGGCGG - Exonic
900433098 1:2612078-2612100 AGCCCCAGGCAGGTGGGCGCTGG - Intronic
900626657 1:3611598-3611620 AGGGGCGGGGCCGAGGGCGCAGG - Intergenic
901080269 1:6580130-6580152 TGCCTGGGTGAGGAGGGCGCGGG + Exonic
901662604 1:10807998-10808020 AGCTGCGGGGAGGCTGGGGCTGG - Intergenic
901663577 1:10814006-10814028 ACCCGTGGCGGGGAGGGCGCTGG - Intergenic
901673085 1:10867241-10867263 AGGCGCGGGCGGGCGGGCGCCGG + Intergenic
901761598 1:11475298-11475320 AGCTTCAGGGAGGAAGGCGCTGG + Intergenic
902585659 1:17437774-17437796 CGCCGCGGGGAGGGGGCGGCCGG - Intronic
902983306 1:20140421-20140443 AGCCCTGGGGGGCAGGGCGCAGG + Intronic
903063862 1:20687566-20687588 TGCCTCGGGCAGGAGGCCGCTGG - Exonic
903792586 1:25905564-25905586 AGGCGCGGGGAGGAAGGGGGCGG - Intronic
903897838 1:26620540-26620562 ATCCGCGGAGAGAAGGGCGGGGG + Intergenic
904045062 1:27603769-27603791 AGCGGGAGGGAGGAGGGCGGAGG - Intronic
904080999 1:27872559-27872581 AGCCGCGGGGACCATGGAGCCGG + Exonic
904534321 1:31189126-31189148 AGCCACGGGGAGGAGAGCGAAGG + Intronic
904642966 1:31944495-31944517 AGGGGCGGGGCGGAGGGGGCAGG + Intronic
905016404 1:34781640-34781662 GGCGGCGCGGAGGAGGGAGCAGG - Exonic
905137104 1:35808279-35808301 CGCCGCGGAGACGCGGGCGCTGG - Exonic
905213854 1:36393025-36393047 ACCCCAGGGGAGGAGGGCCCAGG + Intronic
905325587 1:37149488-37149510 AGCAGCGGGGAAGAGGTGGCAGG + Intergenic
905369281 1:37474633-37474655 AGGCGCGGCGGGGAGGGTGCGGG + Intronic
907517445 1:55001537-55001559 AGCCACGGGGAGGAGGCTGAGGG - Intronic
908501206 1:64745194-64745216 GGCGGCGGCGAGGGGGGCGCGGG + Exonic
908605473 1:65792998-65793020 AGCCCCGGGAAGGGGCGCGCGGG - Intronic
909433503 1:75615824-75615846 CGGCGAGGGGAGGAGGGAGCGGG + Intergenic
909957943 1:81801779-81801801 AGCGACGGGCGGGAGGGCGCCGG - Intronic
910388028 1:86705278-86705300 AGCCCCGGGGTGGAGGCCACAGG - Intronic
910676624 1:89821829-89821851 AGGCGCGGGGGGCGGGGCGCGGG - Intronic
911618355 1:100038606-100038628 CGCCGCGGGGAGGAATGTGCGGG + Intronic
912335653 1:108859944-108859966 AGGCAGGGGGAGGAGGGCGGAGG - Intronic
914845634 1:151282312-151282334 GGCCGCGGGGAGGGCGGCGGTGG + Exonic
915099459 1:153488760-153488782 AGACTCAGGGAGGAGGGTGCTGG - Intergenic
915458004 1:156053483-156053505 GGCCCCGGAGAGGAGGGCGGGGG - Intronic
915616557 1:157043895-157043917 AGCTGCTGGGAGAAGGGCCCTGG - Intronic
916963887 1:169915405-169915427 AGCCGGGGGGGTGAGGTCGCTGG - Intergenic
918511159 1:185316331-185316353 AAGCGCGGGGAGAAGGGGGCGGG - Intronic
918511221 1:185316557-185316579 ACCCGCCGGAAGGAGGGCGCGGG - Intronic
919997564 1:202767350-202767372 AGCCACTGTGAGGAGGGCCCTGG - Intronic
921152618 1:212414315-212414337 TCTCGCCGGGAGGAGGGCGCGGG + Intronic
921604420 1:217137744-217137766 AGGCGCGCGGGGGAGGGCGAGGG - Intronic
922416579 1:225427911-225427933 CGCCGCGGGGAGCTGGGAGCAGG + Intronic
922669104 1:227495232-227495254 AGGCTGGGGGAGGTGGGCGCGGG - Intergenic
922670493 1:227506070-227506092 AGGCTGGGGGAGGTGGGCGCGGG + Intergenic
923055881 1:230425889-230425911 GGGCGCGCGGAGGAGGGCGCCGG - Intergenic
923674131 1:236065274-236065296 GGCCGCGAGGGGGAGGGCGAGGG + Intergenic
924242796 1:242056966-242056988 AGGCTGGGGGAGGTGGGCGCGGG + Intergenic
924383441 1:243483275-243483297 TGCTGCGGGGACGAGGGCGCCGG - Intronic
924502903 1:244653298-244653320 GGCCGCGGGGAGGAGGATGGGGG + Exonic
924778405 1:247126827-247126849 AGCCGCGGGGCTGCGGGCGCGGG - Intronic
924783253 1:247171593-247171615 AGCCGCGGGGCTGCGGGCGCGGG + Intronic
1062764353 10:49331-49353 AGGCGGAGGGAGGTGGGCGCGGG - Exonic
1063463572 10:6229392-6229414 AGCCGCAGAGAGGAGGCGGCCGG - Intronic
1063636465 10:7787733-7787755 GGACGCGGGGCTGAGGGCGCGGG - Intronic
1064354361 10:14604176-14604198 GGGCGCGGGGAGGCGGGCGGCGG - Intronic
1064581304 10:16795862-16795884 AGCCCCTGGGAAGAGGGTGCCGG - Intronic
1065099888 10:22321849-22321871 AGGCGCGGGGCGGGCGGCGCGGG - Intronic
1065844683 10:29735437-29735459 CGCCTCGGGGAGGAGCGGGCCGG - Intronic
1066220748 10:33335085-33335107 CTCCGCGGGAAGGAAGGCGCTGG + Intronic
1066685286 10:37976186-37976208 AGCCGCAGGGACGTGGGCTCTGG - Intronic
1067739003 10:48880872-48880894 AGGCCCGGGGAGGTGGGGGCAGG + Intronic
1068544937 10:58334929-58334951 GGGCGCGGCGGGGAGGGCGCAGG + Intergenic
1069372694 10:67764373-67764395 AGCGGCGGGGCTGAGGGCTCAGG - Intergenic
1070328232 10:75401440-75401462 AGCAGCGGGGGGGAGGGCTCCGG + Exonic
1070764264 10:79047507-79047529 AGCAGAAGGGAGGAGGGCTCAGG - Intergenic
1072591585 10:96832612-96832634 AGCCCCGGGGAGGCGCGCGGAGG - Intronic
1072766116 10:98096498-98096520 AGCCCCGGGCAGGAGGCCGTCGG - Intergenic
1073217361 10:101843831-101843853 AGCCGCGGGGAGGGGGCGGGAGG - Intronic
1074104159 10:110376312-110376334 AGCCCTGGGGAGGAGGGCAAGGG - Intergenic
1074938962 10:118216204-118216226 AGTCAGGGGGAGGAGGGGGCAGG - Intergenic
1077048144 11:555185-555207 AGGGGCGGGGAGGAGAGCGGAGG + Intronic
1077081575 11:726791-726813 GGCGGGGGAGAGGAGGGCGCAGG - Intronic
1077484259 11:2831689-2831711 GGCAGCGGGGAGAAGGGTGCTGG - Intronic
1077556414 11:3228157-3228179 AGCCCCGGGGTGGGGGCCGCTGG + Exonic
1078088864 11:8251474-8251496 AGCAGCGGGGAGGCTGGCTCAGG + Intronic
1078390386 11:10931451-10931473 TGACGCGGGGAGGAGGCGGCCGG + Intergenic
1079251595 11:18791465-18791487 AGCCGGAAGGTGGAGGGCGCGGG - Intronic
1080406899 11:31987569-31987591 AGCCCCGGGGTGGCGGGCGCGGG + Intronic
1080503653 11:32892781-32892803 GGCCGCGGGGCGGAGGGGGGCGG + Intergenic
1080791409 11:35525576-35525598 AGCCGCGGCAAGGATGGAGCTGG - Exonic
1081709939 11:45210055-45210077 AGCAGCGCGGGGGAGGGGGCTGG + Intronic
1081899635 11:46617113-46617135 AGCCGCGGAGAGGTGGGTGACGG - Exonic
1083171089 11:60924490-60924512 AGCCGCGGGGCGGGCGGCGGCGG + Exonic
1083309064 11:61775327-61775349 AGCCACAGGGTGGAGGGCGGGGG - Intronic
1083617975 11:64035821-64035843 GGCGGCGGCGAGCAGGGCGCGGG - Intronic
1083639939 11:64140085-64140107 AGGGGTGGGGTGGAGGGCGCTGG - Intronic
1084165420 11:67372992-67373014 GGCGGCGGAGAGGAGGGCGGAGG - Intronic
1084174366 11:67415822-67415844 AGTCGCGGGGACGAGGACCCCGG + Intronic
1084307709 11:68297821-68297843 AAACTCGGGGAGGAGGGCGGAGG - Intergenic
1084310307 11:68312798-68312820 CGCCGCGGGTAGGTGGGCGCAGG + Exonic
1085044016 11:73343110-73343132 AGCCGCTGGGGCGGGGGCGCCGG - Intronic
1085666254 11:78417746-78417768 GGTCGCGCGGACGAGGGCGCGGG + Exonic
1086518822 11:87646238-87646260 AGCGGAGGGGAGGAGGGGGAGGG - Intergenic
1087175295 11:95090176-95090198 CGCCGCCGGGCGCAGGGCGCGGG - Exonic
1088716379 11:112553311-112553333 AGCAGGGGGGAAGAGGGGGCGGG + Intergenic
1089326981 11:117664051-117664073 AGCAGCCGGGAGGAGGGGCCGGG + Intronic
1089729644 11:120512051-120512073 GGGAGCGGGGAGGAGGGCGCGGG - Intronic
1091238563 11:134037387-134037409 CGCCGCGGAGGGGAGGGCGGTGG + Intergenic
1091322673 11:134663143-134663165 TGCAGCAGGGAGGTGGGCGCAGG + Intergenic
1092285672 12:7128124-7128146 AGCAGCGGGGAGGAGGGGAATGG - Intronic
1092538106 12:9405049-9405071 AGCCCCGGGGGGAAAGGCGCTGG - Intergenic
1094470278 12:30796235-30796257 GGCCGCGGGGCGGCGGGGGCGGG - Intergenic
1095498558 12:42811678-42811700 AGCCTGAGGGAGGAGGGCACCGG + Intergenic
1096271172 12:50167358-50167380 ACCCGCGGGGAGGCGGCCCCAGG + Exonic
1096466300 12:51848954-51848976 AGCCCAGGGGAGGTGGGGGCGGG - Intergenic
1096634331 12:52948996-52949018 CGGCCCGGGGCGGAGGGCGCGGG + Exonic
1097186109 12:57197393-57197415 GGCAGCGGGGAGGAGGGCCTGGG - Intronic
1097191201 12:57220389-57220411 AGGCGCGGGGCGGGGGGCGGGGG + Intronic
1097218146 12:57430498-57430520 GGGCGCGGGGCGGAGGGCGGCGG - Intronic
1100450662 12:94702703-94702725 AGCCAAGGTGAGGAGGGCTCGGG - Intergenic
1100963074 12:99984747-99984769 CGCGGCGGGGAGGAGCGCGGCGG + Intergenic
1102124493 12:110469088-110469110 AGCCCCGTGGAGGAGGGCTGCGG + Intronic
1102471390 12:113161782-113161804 GGGGGCGGGGAGGAGGGGGCGGG - Intronic
1103563219 12:121803479-121803501 AGCTCCGGGGAGGGGGTCGCGGG + Intergenic
1103595442 12:122022249-122022271 AGCCGCGGGGCGCAGCGCCCCGG + Intronic
1103741652 12:123095499-123095521 AGGCGGGGGGAGGAGGGGGCAGG - Intronic
1104493328 12:129213617-129213639 AGCCTTGTGGAGGAGGGCGAAGG + Intronic
1104866979 12:131961512-131961534 AGCCCCGGGGAGCAGCACGCCGG - Exonic
1104885528 12:132104880-132104902 AGCCCCGGGGAGCAGCACGCCGG - Exonic
1104987244 12:132603972-132603994 AGCCGCGGGGAGGGGGACCCAGG - Intronic
1105014182 12:132776184-132776206 AGCAGCAGGGAGGAAGGAGCTGG - Intronic
1105014213 12:132776343-132776365 AGCAGCAGGGAGGAAGGAGCTGG - Intronic
1105014230 12:132776420-132776442 AGCAGCAGGGAGGAAGGAGCTGG - Intronic
1105014264 12:132776578-132776600 AGCAGCAGGGAGGAAGGAGCTGG - Intronic
1105322786 13:19344743-19344765 AGCCCCGGGAAGGTGGGCGCGGG - Intergenic
1105413869 13:20192899-20192921 AGTCGGGGAGAGGAGCGCGCGGG + Intergenic
1105446500 13:20461971-20461993 AGCCTGGGGGAGGAGGAGGCGGG + Intronic
1105874827 13:24541972-24541994 AGCCCCGGGAAGGTGGGCGCGGG + Intergenic
1106510473 13:30408511-30408533 AGGCGCGAGGAGGAGGGGGCGGG + Intergenic
1106602561 13:31200226-31200248 CGGCGCGGGGAGGGAGGCGCAGG + Intronic
1107307376 13:39037683-39037705 GGCGGCGGGGAGGGAGGCGCCGG + Exonic
1108029250 13:46211860-46211882 AGGCGAGGCGAGGCGGGCGCCGG - Intronic
1108063182 13:46553102-46553124 AGCAGCCGGGGGGAGGGCGCAGG + Intergenic
1108310751 13:49187600-49187622 AGCCACTGTGAGGAGGGCCCTGG - Intronic
1110450861 13:75636287-75636309 CACCGCGGGGAGGACGGCGGCGG + Intronic
1110775659 13:79405845-79405867 CGGCGCGCGGAGGAGGGGGCGGG - Exonic
1111518298 13:89363478-89363500 GTCCGCGGGCAGGTGGGCGCCGG + Intergenic
1113908308 13:113830470-113830492 AGCCACGGGGAGGAGGGGCCCGG - Intronic
1113908336 13:113830545-113830567 AGCCACGGGGAGGAGGGGCCCGG - Intronic
1113908364 13:113830620-113830642 AGCCATGGGGAGGAGGGGCCCGG - Intronic
1113908392 13:113830695-113830717 AGCCATGGGGAGGAGGGGCCCGG - Intronic
1113908419 13:113830771-113830793 AGCCATGGGGAGGAGGGGCCCGG - Intronic
1113962198 13:114132358-114132380 TGCGGAGGGGAGGCGGGCGCGGG + Intronic
1114323471 14:21566645-21566667 GGCCGCGGGGCGGAGGGGGTGGG + Intergenic
1114493647 14:23118543-23118565 AGCCCCGGGCAGGAGGGAGGAGG + Intronic
1114620611 14:24094190-24094212 AGCCCCGGGGCCGAGGGAGCTGG + Exonic
1114668936 14:24398831-24398853 GGCGGGGGGGAGGAGGGGGCGGG - Exonic
1115320645 14:32076756-32076778 AGCAGAGGGGAGGAGGGAGCGGG + Intronic
1115850334 14:37585163-37585185 AGCGGAGGGGAGGAGGGGGTTGG - Intergenic
1117690348 14:58299200-58299222 ACCCGCGTGGGGGAGGGGGCGGG - Intronic
1118744356 14:68763115-68763137 AGCAGCCGGGAGGTGGGAGCTGG + Intergenic
1119003924 14:70907614-70907636 AGCGGCGGGGCGGAGGACGGCGG - Exonic
1119219365 14:72893588-72893610 AGCGGCGGGGCGGGGGCCGCGGG + Intronic
1121050485 14:90816436-90816458 AGGGGCGGGGAGGCGGGCGGCGG + Intronic
1121120714 14:91374118-91374140 GGCTGCGGGGAGGAAGGCTCTGG + Intronic
1121447424 14:93987910-93987932 AGCCTCAGGGAGGACAGCGCGGG + Intergenic
1121547589 14:94773080-94773102 AGCCGCGCGGAGGCAGGCCCCGG + Intergenic
1122065995 14:99174893-99174915 GGCTGCGGGGACGCGGGCGCGGG - Exonic
1122082395 14:99274636-99274658 TGCCGCGAGGTGGAGCGCGCCGG - Intergenic
1122414383 14:101541875-101541897 TGCAGCTGGGAGGAGGGGGCTGG - Intergenic
1122445064 14:101761935-101761957 GGCCGCGGGACGGAGGGAGCAGG + Intronic
1122529815 14:102417866-102417888 AGCCGTGGGGAGGCTGGCACGGG + Intronic
1122905694 14:104800590-104800612 CGCCCCGGCGGGGAGGGCGCGGG - Intronic
1122913131 14:104843487-104843509 AGCGGCCAGGAGGAGGCCGCCGG - Intergenic
1123004442 14:105314656-105314678 CGGCGCGGGTCGGAGGGCGCCGG + Exonic
1123024041 14:105415228-105415250 AGCCGCGCGGGCGGGGGCGCGGG + Intronic
1125582744 15:40798335-40798357 AGCTGGGGGGAGGAGGGAACAGG + Intronic
1125589325 15:40844577-40844599 GGCCGGGGCGAGGCGGGCGCGGG - Exonic
1125689610 15:41585496-41585518 GGCCGCGGGGAGGAGCGCGGCGG + Intergenic
1127606497 15:60592421-60592443 AGCCGCGGTGCGGAGAGCGCAGG + Intronic
1127884767 15:63189555-63189577 AGAGGCGGGGAGGGGGCCGCGGG - Exonic
1128153231 15:65376602-65376624 GGACGGGGGGAGGGGGGCGCGGG - Intronic
1128208098 15:65870227-65870249 AACCGCGGGGCGGAGGGTGGGGG - Intronic
1128374510 15:67065683-67065705 AGCCGGGAGGAGGAGGGTGGCGG + Intronic
1128758016 15:70196394-70196416 AGGCCAGGGGAGGAGGGGGCCGG - Intergenic
1129198563 15:73985289-73985311 AGCCCTGGGGAGGAGAGCGGGGG - Intronic
1129450283 15:75647701-75647723 AGCCGCGCGGAGGAGTAGGCGGG + Intronic
1129644615 15:77419467-77419489 AGCCGCGGCGCGAAGGGAGCAGG + Intronic
1129985931 15:79919796-79919818 AGCCGCGGGGAGGGGGGGCGGGG - Intronic
1130485432 15:84395907-84395929 AGCCGGGGAGGGGAGGGCGTAGG + Intergenic
1130994238 15:88895229-88895251 CGGCGCGGGGATGCGGGCGCCGG - Intronic
1130997786 15:88913319-88913341 TGCTGCGGGGACGCGGGCGCTGG + Exonic
1131111335 15:89766946-89766968 AGCCGCAGGGTGCAGGGCACAGG + Intronic
1132241878 15:100264245-100264267 AGCCTGGGGGAGGAGGGGGGAGG + Intronic
1132642823 16:985393-985415 AGCCGCGGGGAGGGACTCGCAGG + Exonic
1132661048 16:1061659-1061681 AGCCCCGGGGAGGAGCTGGCTGG + Intergenic
1132833956 16:1943229-1943251 AGGGGCGGGGAGGTGGACGCGGG - Exonic
1132897834 16:2237312-2237334 GGCCGCAGGGAGGGGCGCGCGGG + Intronic
1133119226 16:3596090-3596112 AGCCGCGGGGAGGGGAGGCCCGG + Intronic
1133277677 16:4648397-4648419 AGCCCCCGGGAGGAGGACCCGGG - Intronic
1133277731 16:4648540-4648562 AGCCCCCGGGAGGAGGACCCGGG - Intronic
1133277786 16:4648682-4648704 AGCCCCCGGGAGGAGGACCCGGG - Intronic
1133277874 16:4648931-4648953 AGCCCCGGAGAGGAGGACCCGGG - Intronic
1134110913 16:11514988-11515010 AGAGGCGGGGAGGAGGGCGTGGG + Intronic
1136419550 16:30123226-30123248 CGCCGTGGGGAGGAGGGCGGTGG - Exonic
1137426339 16:48384716-48384738 CGCCGCGGGGAGGAGGGGGAGGG + Intronic
1138619066 16:58197703-58197725 GGCCGCGGGCAGCAGGGCCCGGG - Exonic
1139364802 16:66426978-66427000 AGATGCGGGGCGGGGGGCGCGGG - Intergenic
1139754569 16:69132325-69132347 AGCCGAGGGGCGGGGAGCGCGGG - Intronic
1139780612 16:69348459-69348481 TGCGGGGGGGAGGGGGGCGCGGG + Intronic
1141531233 16:84648457-84648479 GGCCGCGGGGAGGCGGGGCCGGG - Intergenic
1141605634 16:85151905-85151927 AGCCGGGGAGAGGAGGGCGGGGG - Intergenic
1141774492 16:86113653-86113675 AGGTGCGGGGAGGAGGAAGCAGG + Intergenic
1142155468 16:88530974-88530996 GGCCGCAGAGGGGAGGGCGCGGG + Intronic
1142206240 16:88784579-88784601 CGCTGCGGAGAGGAGGCCGCCGG - Intronic
1142852604 17:2711517-2711539 GGCCGCTGGGCGGGGGGCGCCGG - Intronic
1143151419 17:4809408-4809430 ACCCTCGGGGAGGAGGGCCAGGG + Intronic
1143178234 17:4968605-4968627 AGGCGTGGGGAGGAGGGAGGAGG + Exonic
1143411862 17:6713876-6713898 GCCCGCGGTGCGGAGGGCGCGGG - Intergenic
1143452405 17:7043643-7043665 TGGCGCGGGGCGGAGGGAGCCGG + Exonic
1143476831 17:7207965-7207987 AGCCGTGGGGAGGGGGATGCTGG - Intronic
1143483356 17:7239302-7239324 GGCTCCGGGGAGGGGGGCGCCGG - Exonic
1143508614 17:7383368-7383390 AGGGGCAGGGAGGGGGGCGCAGG + Intronic
1143591428 17:7887734-7887756 AGGCGGGGGCCGGAGGGCGCAGG - Intronic
1143880067 17:10023131-10023153 AGAGGTGGGGAGGAGGGCACTGG + Intronic
1144495290 17:15741778-15741800 AGCCCTGGGGAGGAGGTCCCTGG - Intronic
1144638935 17:16927105-16927127 AGCCCTGGGGAGGAGGGCCCTGG + Intergenic
1144756518 17:17682984-17683006 AACCGCGGGGAAGGCGGCGCGGG - Intronic
1144816511 17:18039247-18039269 AGGCGCGGCGTGGAGGGGGCGGG - Intergenic
1144956989 17:19023640-19023662 AGCCGCGGGGTGGGGGGTGGGGG - Intronic
1145208001 17:20994875-20994897 AGCCCAGGGGAGGAGGGCCCTGG - Intergenic
1146022635 17:29292894-29292916 GGCCGCGGTGCGGGGGGCGCCGG + Intronic
1146057813 17:29589743-29589765 GGGCGCGGGCAGGAGGGGGCGGG + Intronic
1146197373 17:30824827-30824849 AGCCGCGGGGCGGGCGGCGCTGG - Intergenic
1147156004 17:38544766-38544788 GGCCGGTGGGAGGAGGGGGCTGG + Intronic
1147407025 17:40219559-40219581 AGTCGCGGGGAGGGGGGCTCGGG + Intronic
1147423112 17:40332244-40332266 GGCTGGGGGGAGGAGGGAGCCGG + Intronic
1147793631 17:43027849-43027871 AGCAGCGGGGAGGAGAGGGCTGG - Intronic
1148021651 17:44557591-44557613 AGCCGCAGCGAGGAGGCGGCGGG + Exonic
1148782597 17:50130087-50130109 GGCGGCGGGGAGGAGGCGGCTGG + Intergenic
1148872809 17:50668676-50668698 AGCCCTGTGGAGGAGGGCGGAGG - Intronic
1150225597 17:63523088-63523110 GGCGGCGGGGAGGGGGCCGCTGG - Intergenic
1151370742 17:73644882-73644904 AGCCGCGGGGCGGCGGGGGAGGG + Intergenic
1151756115 17:76076234-76076256 TGCCGCGGGAGGGAGGGCGGAGG - Intronic
1151821940 17:76501342-76501364 GGCCGCAGGGAGGTGAGCGCGGG - Exonic
1151945925 17:77319866-77319888 AGCCTCGGGGCGGCGGGGGCTGG + Intronic
1151974486 17:77476566-77476588 GCCTGCGGGGAGGAGGGAGCTGG + Intronic
1151995685 17:77607565-77607587 AGCCGCGGAGAGGTGAGCTCAGG + Intergenic
1152174964 17:78781762-78781784 GGCCGAGGGGTGGAGGTCGCTGG - Intronic
1152362635 17:79839615-79839637 GGACGCGGAGGGGAGGGCGCCGG + Intergenic
1152551557 17:81032912-81032934 AGCCGCCGGGCGGAGGGAGCAGG + Intergenic
1152551983 17:81034731-81034753 AGGTGCGGGGAGGAGAGCGGGGG - Intergenic
1152617832 17:81346025-81346047 GGCCGCGGGGCGCGGGGCGCTGG - Intergenic
1152617897 17:81346186-81346208 AGAGGCGGGGAGCACGGCGCTGG - Intergenic
1152654826 17:81514649-81514671 AGCCGCGGGGAGGGGCGGGGAGG + Intronic
1152718371 17:81910824-81910846 AGCCCCGCGGAGGAGGACCCGGG + Intronic
1152745057 17:82034696-82034718 GGCAGGGTGGAGGAGGGCGCGGG + Intergenic
1152853055 17:82648732-82648754 CGGGGCGGGGAGGAGGGGGCGGG + Intergenic
1152853402 17:82649983-82650005 AGCCATGGGGAGGAAGGAGCTGG + Intergenic
1153515278 18:5895739-5895761 GGCCGCGGGGCAGGGGGCGCGGG + Intronic
1153805164 18:8704859-8704881 GGCCTCGGGGAGGCGGGCGGTGG + Intergenic
1153872625 18:9334734-9334756 AGGAGCCGGGAGGAGGGCGGCGG + Intergenic
1154139589 18:11811208-11811230 AGCCGTGGGGAGGGCTGCGCTGG - Intronic
1154356414 18:13625681-13625703 TGGCGGGGGGAGGAGGGCGCCGG - Intronic
1154356458 18:13625781-13625803 GGCTGAGGGGAGGAGGGTGCTGG - Intronic
1154356466 18:13625802-13625824 TGGCGGGGGGAGGAGGGCGCCGG - Intronic
1156473957 18:37394234-37394256 AGGGGCGGGGCGGAGGGCGCGGG + Intronic
1156501996 18:37566082-37566104 GCGCGCGCGGAGGAGGGCGCGGG + Intergenic
1157496718 18:48161845-48161867 GGCCGCGGGGAGGGGCGCCCGGG - Intronic
1157763577 18:50281991-50282013 TTCGGCGGGGAGGAGGGAGCGGG - Intergenic
1159910161 18:74138364-74138386 AGGCGGGGGGAGGAGGCAGCAGG - Intronic
1159937706 18:74382186-74382208 ACCCGTGGGGAGGAGGGCGTTGG - Intergenic
1160307061 18:77749869-77749891 AGCCGCGGGGACGAAGGTTCGGG - Intergenic
1160512303 18:79459369-79459391 AGCCACCTGGAGGAGGCCGCGGG + Intronic
1160538399 18:79607428-79607450 AGGCCCAGAGAGGAGGGCGCTGG + Intergenic
1160766029 19:808468-808490 GGCCCCGGGGTGGAGGGGGCAGG + Intronic
1160838526 19:1136086-1136108 AGTCCCGGGGAGGAGGCCACGGG + Intronic
1160844903 19:1161901-1161923 AGCCGCGGGGGGGGGGGGGGGGG + Intronic
1160894169 19:1395027-1395049 AGCAGTGGGGAGCAGGGCCCGGG - Intronic
1161026173 19:2038424-2038446 ACCCGCGGGGAGGGGGCAGCAGG + Exonic
1161241135 19:3224622-3224644 CGCGGGCGGGAGGAGGGCGCGGG + Intergenic
1161304086 19:3557416-3557438 AGCCCGGGGGTGGGGGGCGCGGG - Exonic
1161614559 19:5262804-5262826 GGTCGCGGGGAGGAGGGAGAGGG + Intronic
1161802735 19:6424820-6424842 AGCCGCTGGGAGGACGACGAGGG + Intergenic
1161965005 19:7542935-7542957 AGCCGAGGGGAGCTGGGCACAGG + Intronic
1162237697 19:9321712-9321734 GGCAGGGGGGAGGAGGGCGGGGG - Intergenic
1162385163 19:10356663-10356685 AGCTGTGGGCAGGAGGGCTCGGG + Exonic
1162435389 19:10654828-10654850 AGCCGCGGGGAGGCGGCAGCCGG - Intronic
1162770450 19:12946104-12946126 AGGGGCAGGGAGGACGGCGCGGG + Intronic
1162914070 19:13865167-13865189 CGGCGCGGGGAGGAGGGAGGGGG + Intronic
1162927784 19:13938704-13938726 AGCAGAGGGGAGGTGGGTGCCGG - Intronic
1163442480 19:17328812-17328834 GGCGGCGGGGCGCAGGGCGCCGG + Exonic
1163609216 19:18292364-18292386 GGCCGCGGGGATGGGGGCGGGGG + Intergenic
1163655661 19:18543514-18543536 GGGGGCGGGGAGGGGGGCGCAGG - Exonic
1163842249 19:19618583-19618605 CGCCGCGGGGCGGGGGGCGATGG + Exonic
1165093461 19:33398132-33398154 GGCCACGGGGAGCAGGGCGGCGG - Intronic
1165096172 19:33411064-33411086 ACCCGAGGGGCGGAGGCCGCAGG + Intronic
1165915366 19:39255342-39255364 AGGTGCAGGGAGGTGGGCGCGGG - Intergenic
1165940777 19:39413714-39413736 AGCCGTGGGCGGGAGGCCGCGGG - Intronic
1166126317 19:40717215-40717237 AGGCGCCGCGAGGAGGGCGGCGG + Exonic
1166314219 19:41979689-41979711 AGTGTCGGGGAGGAGGGGGCGGG + Intronic
1166759494 19:45215814-45215836 AGCCCAGGGCAGGGGGGCGCAGG - Intronic
1167034700 19:46988219-46988241 TGCAGCGGGGAGGAGGGGACCGG + Intronic
1167649701 19:50722662-50722684 AGCTCCGGGGATGAGGGGGCTGG - Intergenic
1167671306 19:50855241-50855263 AGCAGCTGGGAGCAGGGAGCTGG - Intronic
1168056801 19:53868879-53868901 AGCCGCGGAGGGGGGCGCGCAGG - Intronic
1168307218 19:55442319-55442341 GGCCGCGGGGGCGAGGGCCCCGG - Exonic
1168333845 19:55585868-55585890 AGCCGGGAGGAGGGGGGCGGGGG + Intergenic
1168353808 19:55690267-55690289 GGCCACAGGGAGGAGGGTGCAGG + Intronic
1168405513 19:56108335-56108357 AGGGGCGGGGTGGAGGGAGCCGG - Intronic
1168553255 19:57317556-57317578 GGCCGCGGGGAGGAGGATGGGGG - Intergenic
925157520 2:1658825-1658847 AGCCGCGGGGAGATGGGGGGTGG - Intronic
925169604 2:1743170-1743192 AGCCGCGGGGCGGAGGGATGGGG + Intronic
925204416 2:1994268-1994290 ACTCGCTGGGAGGAGGGAGCAGG - Intronic
925204433 2:1994321-1994343 ACTCGCTGGGAGGAGGGAGCAGG - Intronic
925204451 2:1994374-1994396 ACTCGCTGGGAGGAGGGAGCAGG - Intronic
925204468 2:1994427-1994449 ACTCGCTGGGAGGAGGGGGCAGG - Intronic
925348823 2:3187731-3187753 GGCCGTGGGGAGGGGTGCGCAGG - Intergenic
925959643 2:9003409-9003431 AGCGGCGGGTAGGGGGGCACCGG + Intronic
926089871 2:10043188-10043210 GGCGGCGGGGCGGAGGGGGCGGG - Intronic
926282993 2:11465705-11465727 CGGCGCGGGGAGGAGGGGGCCGG + Intronic
927667391 2:25042141-25042163 GGCCGCGGGCAGGACGGAGCCGG - Exonic
927881445 2:26692666-26692688 GGCCGGGCGGAGGAGGGCGGTGG + Intergenic
927900621 2:26815766-26815788 GGCCGCCGGGTGGGGGGCGCCGG + Intergenic
929033680 2:37671725-37671747 TGGGGCGGGGCGGAGGGCGCGGG + Exonic
929526369 2:42706978-42707000 AGCGGGGAGGAGGAGGGGGCTGG - Intronic
929548716 2:42875375-42875397 CGCCGGGAGGAGGAGGGAGCTGG - Intergenic
929689308 2:44061382-44061404 AGCAACGGGGAGGAAGACGCAGG - Intergenic
929966707 2:46542495-46542517 GGCCGCGCGGAGGGGCGCGCAGG - Intronic
930033902 2:47073933-47073955 AGCCGCAGGGAGGGAGGGGCTGG + Exonic
930730694 2:54725001-54725023 AGCCTCGGCGAGGACGGCCCCGG + Exonic
932450610 2:71808264-71808286 AGCCGTGGGGAGGACAGGGCGGG + Intergenic
934519896 2:95013520-95013542 AGCCTGGGAGAGGAGGACGCAGG - Intergenic
935866460 2:107392545-107392567 AGCCGCGGGGTGGGGGACTCAGG - Intergenic
937854707 2:126663814-126663836 AGCCGAGGGAAGGAGGCCCCCGG - Intronic
937952742 2:127401132-127401154 AGCCGCTGGGAGGAAGGCCGAGG + Intergenic
938296446 2:130182273-130182295 GGCCGCGGGGATGGCGGCGCAGG + Exonic
939153948 2:138502196-138502218 AGGCGCGAGCAGGAGGCCGCCGG - Intronic
941911715 2:170770872-170770894 GGGCGCGGCGAGGAGGGCCCGGG - Intergenic
941951304 2:171160198-171160220 AGCCCCGGGGCGGGGGGGGCGGG + Intronic
942678231 2:178450841-178450863 AGCCGCGGAGGCGTGGGCGCCGG + Intronic
945033709 2:205686571-205686593 AGCGGCTGGGTGGCGGGCGCCGG + Intronic
945189034 2:207166948-207166970 AGGCGCGGGAGGGAGGGCGGCGG - Intronic
946843198 2:223837632-223837654 GGCAGCGGGGAGGAGCGTGCAGG - Intronic
946843201 2:223837646-223837668 GGGCGCGGGGAGGAGGCAGCGGG - Intronic
946843206 2:223837660-223837682 GGGAGCGGGGAGGAGGGCGCGGG - Intronic
947754361 2:232550883-232550905 ACTGGCGGGGAGGAGGGGGCTGG + Intronic
948963337 2:241356669-241356691 TGCCGCGTGGAGGAGGCCGGTGG + Intronic
1169091709 20:2864912-2864934 AGCCTGGGTGAGGAGGGCGAGGG + Intronic
1169143556 20:3238931-3238953 AGCCGCGGGGAGGAGGGCGCGGG - Intronic
1169146347 20:3255029-3255051 AGCCTCAGTGAGGAGGGCACAGG - Intronic
1169213294 20:3779206-3779228 AGGCGCAGGAAGCAGGGCGCCGG - Exonic
1169345139 20:4823289-4823311 AGGCGCGGGGCGCGGGGCGCGGG - Intronic
1171175844 20:23050333-23050355 AGCCATGGGGCAGAGGGCGCTGG - Intergenic
1171249583 20:23637879-23637901 GGACGCGGGGAGTGGGGCGCAGG + Exonic
1172101184 20:32484479-32484501 GGGGGCGGGGAGGAGGGCGGAGG - Intronic
1172284644 20:33732143-33732165 GGCCGCGGGGCGGAGGGCGCCGG + Intronic
1172284753 20:33732443-33732465 AGCTGCGGGCAGGAGGGCCTCGG + Intronic
1172618755 20:36306560-36306582 AGCCGAGGGACGGAGCGCGCCGG - Intronic
1173489178 20:43465613-43465635 GGTGGCGGGGAGGAGGGGGCAGG + Intergenic
1173930142 20:46811340-46811362 GGCGGCGGGGCGGAGGGCGGGGG - Intergenic
1174406901 20:50308817-50308839 TGGCGGGGGGAGGAGGGGGCAGG - Intergenic
1175892184 20:62320823-62320845 AATGGCGGGGAGGAGGGCGCCGG + Exonic
1175910621 20:62403631-62403653 GGCGGCGGGGAGGAGGCTGCAGG + Intronic
1175929564 20:62487349-62487371 AGCCGCGGGGAGGGAGGAGTGGG + Intergenic
1176048198 20:63103317-63103339 AGGAGTGGGGAGGAGGGAGCGGG + Intergenic
1176048210 20:63103348-63103370 AGGAGTGGGGAGGAGGGAGCGGG + Intergenic
1176048216 20:63103362-63103384 GGGAGCGGGGAGGAGGGAGCGGG + Intergenic
1176048227 20:63103390-63103412 AGGAGTGGGGAGGAGGGAGCGGG + Intergenic
1176048239 20:63103421-63103443 AGGAGTGGGGAGGAGGGAGCGGG + Intergenic
1176217241 20:63954024-63954046 GGCTGGGGGGAGGAGGGAGCAGG + Intronic
1178278191 21:31257980-31258002 AGAGGAGGGGAGGAGGGAGCTGG - Intronic
1178600730 21:33992336-33992358 AGGGGCGGGGAGGAAAGCGCTGG - Intergenic
1178958305 21:37042635-37042657 TCCCTCGGGGAGGAGGGCCCTGG - Intergenic
1179191038 21:39121741-39121763 AGCCCCTGGGAGGAGGGCTCAGG - Intergenic
1179491032 21:41741740-41741762 GGCCGTGGAGAGGAGGGTGCGGG - Exonic
1179496212 21:41772736-41772758 GGGCCTGGGGAGGAGGGCGCTGG - Intergenic
1179590758 21:42406323-42406345 AGCCACGGGGAGGAAGACGGCGG + Exonic
1179716439 21:43291108-43291130 GGCCGCCGGGAGGAAGGCGGTGG - Intergenic
1180614885 22:17120655-17120677 AGCCGCTCGGCGGGGGGCGCGGG - Exonic
1180622577 22:17171779-17171801 AGCCGCGGGGCGGCGGGACCGGG + Intergenic
1180673520 22:17571385-17571407 AGCTGCAGGGAGGAGCGTGCTGG - Intronic
1180842390 22:18965400-18965422 AGCCCCGGGGAGGTGGGCCTTGG - Intergenic
1181514282 22:23402430-23402452 GGCTGCGGGGAGACGGGCGCCGG - Intergenic
1181572011 22:23772858-23772880 AGCCCCGGGGCGGATGGCTCCGG + Exonic
1181811288 22:25405187-25405209 CGCCGCAGGTAGGTGGGCGCGGG - Intronic
1182109171 22:27710765-27710787 AGCTGTGGGGAGGAGGGCGATGG - Intergenic
1183235098 22:36610911-36610933 AGCCACGGGGAGTAGGGAGGTGG - Intronic
1183356440 22:37362270-37362292 AGACGGGGGGAGGAGGAGGCAGG - Intergenic
1183455680 22:37921986-37922008 AGCCCCAGGGAGCAGGGTGCTGG - Exonic
1183679587 22:39319845-39319867 AGCCGCGGAGAGGTGGGCTAAGG + Intronic
1184092490 22:42299843-42299865 AGCGGAGGGGAGGAGGGAGGAGG + Intronic
1184109023 22:42384408-42384430 AGATGAGGGGAGGAGGGTGCTGG - Exonic
1184303319 22:43576975-43576997 AGCAGCTGGGAGGAGGGATCAGG + Intronic
1184347906 22:43924418-43924440 AGCGACGGGGAGTAGGGAGCGGG + Intronic
1184596052 22:45514896-45514918 AGCAGTGGGCAGGAGGGCGTGGG + Intronic
1184620299 22:45671812-45671834 CGCCGCGGGGGAGGGGGCGCCGG - Exonic
1184644065 22:45886568-45886590 AGGGGCGGGAAGGAGGGTGCTGG - Intergenic
1184820382 22:46905537-46905559 GGCCCCGGGGAGGAGGGCACGGG + Intronic
1184827647 22:46963834-46963856 AGCAGTGGGGAGGCAGGCGCAGG + Intronic
1184871418 22:47241176-47241198 TGTCGCGGGGTGGAGGGAGCGGG - Intergenic
1185330796 22:50251302-50251324 AGCGACCGGGAGCAGGGCGCGGG - Exonic
950668891 3:14513536-14513558 AGCCCCTGGGAGAAGGGCACTGG + Intronic
952590959 3:34953319-34953341 AGACGGGGGCAGGAGGGAGCAGG - Intergenic
952908915 3:38165729-38165751 AGCCACGGGTCGGACGGCGCCGG - Exonic
953614450 3:44477646-44477668 AGCCGCCGGGAGGTAGGCGCGGG - Intronic
953947764 3:47163983-47164005 AGGGGAGGGGAGGAGGCCGCAGG + Intergenic
954581035 3:51703065-51703087 AGCTGCAAGGAGGAGGGTGCTGG - Intronic
954689537 3:52388397-52388419 TGCTGTGGGGCGGAGGGCGCAGG - Exonic
955691421 3:61594250-61594272 CTCCTCCGGGAGGAGGGCGCCGG + Intronic
959049685 3:101512980-101513002 AGCCGCGGGGGCGAGGGCGGGGG - Intronic
960058625 3:113296046-113296068 AGCAGCGGGGAGGATGGTGGGGG - Intronic
960955512 3:123027907-123027929 AGGCGCGCGGAGGAGCGCGAGGG + Intronic
961013219 3:123449198-123449220 AGCCCCGGGGGGGAGGGTCCTGG + Exonic
961449302 3:126995285-126995307 AGGAGCTGGGAGCAGGGCGCAGG - Intronic
961539750 3:127591254-127591276 CGCCGCGTGGAGCAGGGCGCTGG - Intronic
962753641 3:138452129-138452151 AGCCGCGGGGAGGACGAGGCTGG - Intronic
963603124 3:147393835-147393857 TGCCTCGGGGAGGGAGGCGCGGG - Intronic
964790585 3:160450350-160450372 AGCTGAGCGGCGGAGGGCGCAGG - Intronic
964801551 3:160564783-160564805 CGCCGCGGGAAGGAGGGCGGTGG - Intronic
965520373 3:169663797-169663819 AGCCGCGGGGAGGGCGGCGGGGG + Intergenic
965590471 3:170357116-170357138 CGCAGCGGGGAAGAGGGGGCAGG - Intergenic
966594188 3:181711761-181711783 AGGCCGGGGGAGGAGGGGGCAGG - Intergenic
966734690 3:183179471-183179493 AGCACCGAGGAGGAGCGCGCTGG - Exonic
966762291 3:183428712-183428734 AGCCGCGGAGAGAAGGGGGCTGG + Intronic
966915766 3:184583485-184583507 GGCCGCGCGGAGGAGGCCGCGGG + Intronic
967811628 3:193765765-193765787 AGCCACAGTGAGGAGGGCTCAGG + Intergenic
968630509 4:1648483-1648505 AGCCGCGGTCAGGAGGGCTCTGG + Intronic
968659624 4:1793669-1793691 CGCGGCGGGGAGGAGGCGGCCGG + Intronic
968879835 4:3293177-3293199 GGCCGGGAGGCGGAGGGCGCGGG - Intronic
969214584 4:5711574-5711596 AGCGGCGGGGCGGGGAGCGCGGG + Intronic
969361208 4:6664810-6664832 AGCCGCTGGGCGCAGGGAGCGGG - Intergenic
969410636 4:7025723-7025745 AGGCCCAGAGAGGAGGGCGCGGG + Intronic
969466759 4:7361895-7361917 AGCGGTGGGGGGGAGGACGCGGG + Intronic
969491143 4:7499887-7499909 GGCCGTGAGGAGGAGGGTGCTGG + Intronic
969714777 4:8863203-8863225 AGGCGGGTGGAGGAGGGCGCCGG + Intronic
971244146 4:24913124-24913146 GGTCGCGGGGCTGAGGGCGCGGG - Intronic
972396546 4:38663790-38663812 GACTCCGGGGAGGAGGGCGCGGG + Intergenic
976629372 4:87220698-87220720 AGCCGCGGGGGCGAGGCCGTGGG - Intronic
977809813 4:101346463-101346485 AGCCGCGGGGAGGTGGCGGCGGG - Intronic
978073143 4:104495099-104495121 CGCCGAGGTGAGGAGGACGCAGG + Intergenic
980908830 4:138975700-138975722 AGGGGCGGGGGGGGGGGCGCTGG - Intergenic
981782705 4:148444994-148445016 TGACCCGGGGAGGGGGGCGCAGG - Intergenic
982217348 4:153094003-153094025 AGCCGTGGGGAGGGAGGCGCAGG - Intergenic
985111976 4:186555468-186555490 CGCGGCGTGGAGGAGCGCGCGGG - Exonic
985420844 4:189783914-189783936 AGCTGCAGGGAGGCGGGCTCTGG - Intergenic
985531042 5:434015-434037 AGCCGCGGGGCATGGGGCGCAGG - Exonic
985664812 5:1176584-1176606 AGCTGCGGGGTCGGGGGCGCAGG + Intergenic
985949558 5:3213141-3213163 AGGAGCGCTGAGGAGGGCGCAGG - Intergenic
985995743 5:3596043-3596065 AGGCGCGGGGAGGGAGGCGGAGG - Exonic
987295883 5:16550932-16550954 AGCCGCAGGGAGGAGGATACGGG + Intronic
987595147 5:19988330-19988352 AGCCGCGGAGAGGAGAGCCAGGG - Intronic
990347394 5:54883968-54883990 GCGAGCGGGGAGGAGGGCGCTGG - Intergenic
992320928 5:75612341-75612363 ACACGCGGGGCGGAGGGCGGGGG - Intronic
992403476 5:76432925-76432947 AGCTGAGGGAAGGAGGGAGCAGG - Intronic
992644027 5:78795396-78795418 AGCTTTGGGGAGGAGGGGGCTGG + Intronic
992769599 5:80035200-80035222 GGCCGCAGGGAGAAAGGCGCGGG - Intronic
993116095 5:83722019-83722041 AGCAGCCGGGAGGAGGGAGCGGG + Intergenic
993116213 5:83722421-83722443 AGCCGCCGGGACGGGGGCTCTGG + Intergenic
996329430 5:122312307-122312329 CGCCGCGGGGAGGCGGGAGGCGG + Intronic
999768168 5:154756025-154756047 AGCGACGGGGAGGAGGGCGGCGG + Intronic
1000319071 5:160119327-160119349 TCCCCCGGGGAGGGGGGCGCCGG - Exonic
1001424756 5:171615948-171615970 AGCGGGAGGGAGGAGGGCGCAGG - Intergenic
1001816449 5:174673227-174673249 GGCCGCGGGGAGGGGGGCAGAGG - Intergenic
1001997721 5:176175263-176175285 AGCCCCGGGGCGGAGGGGGGCGG + Intergenic
1002449758 5:179311973-179311995 AGCAGTGGGGAGGAGGGAGAAGG + Intronic
1002512776 5:179733421-179733443 GGCCACGGTGAGTAGGGCGCGGG + Exonic
1002645286 5:180649680-180649702 GGACGGGGGGAGGGGGGCGCGGG - Intergenic
1002784712 6:392390-392412 AGCGGAGGCGGGGAGGGCGCGGG - Intronic
1002927180 6:1611328-1611350 GGCGGCGGGGCGGAGGGCGCGGG - Exonic
1004167865 6:13272626-13272648 CGCTGCAGGGAGGAGGGCGGGGG + Intronic
1004396346 6:15248834-15248856 CGGCGGGGGGAGGAGGGAGCTGG + Intronic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1005683018 6:28225446-28225468 AGCCGCTGGGAAGTGGGAGCCGG + Intronic
1006136081 6:31897256-31897278 TGCAGCCGGGAGGAGGGGGCGGG - Intronic
1006512128 6:34527176-34527198 CGCCGCGGGGCGGGGGGCGGGGG + Intronic
1006642716 6:35497102-35497124 GGCTGCGGGAAGGAGGGGGCGGG + Intergenic
1006932857 6:37697945-37697967 AGACGCGAGGAGGAGGGAGGAGG - Exonic
1006938171 6:37732921-37732943 AGCGGCGGGGCGGGGGGAGCGGG - Intergenic
1010033030 6:71289292-71289314 AGCCGCGGCGCGGAGGGGTCGGG - Intronic
1010198509 6:73263243-73263265 AGCAGGCGGGAGGAGGGCTCTGG - Intronic
1012237772 6:96837863-96837885 AGGCGCGGGGTGCAGGGCGCAGG - Intergenic
1014246809 6:119078500-119078522 AGCCGCGGGGACAACGGCGCGGG + Exonic
1016433137 6:144008419-144008441 CGCGGCCGCGAGGAGGGCGCTGG + Intronic
1017077329 6:150631319-150631341 AGACCTGGGGAGGAGGGTGCTGG - Intronic
1017103220 6:150866124-150866146 CGCCGTGGGGAGCGGGGCGCGGG + Intronic
1017146532 6:151240321-151240343 AACCGGGGGGAGGGGGGCGGAGG + Intronic
1017146699 6:151240992-151241014 AGCCGCCGTGGGCAGGGCGCGGG - Intronic
1017834882 6:158168224-158168246 AGCCGCCGGGTGGAGGGTCCCGG - Exonic
1018068636 6:160141869-160141891 AGGAGCTGGGAGGAGGGGGCTGG - Intronic
1018137085 6:160789172-160789194 AGCCCTGGGGAGGGGGGCGGGGG + Intergenic
1018664564 6:166123215-166123237 AGCCGCGGGAAAGAAGGCCCTGG + Intergenic
1018688166 6:166319398-166319420 TGCAGGGAGGAGGAGGGCGCTGG + Intergenic
1018723549 6:166592308-166592330 ACCTGCGGGGAAGAGGGCCCCGG + Intronic
1019291776 7:254064-254086 GGGCGCGGGAAGGAGGGGGCAGG + Intronic
1019301428 7:306017-306039 AGGCCCGGGCTGGAGGGCGCAGG - Intergenic
1019427312 7:983701-983723 AGCAGAGGGGAGGAGGGCCTGGG + Intronic
1019517584 7:1446611-1446633 AGGAGCGGGGAGGAGGAGGCCGG + Intronic
1019568614 7:1697336-1697358 ATCCCCGTGGAGGAGGGGGCAGG - Intronic
1019598508 7:1869501-1869523 AGGCGCTGGGAAGAGGGCCCTGG - Intronic
1019613532 7:1948570-1948592 AGGCCAGGGGAGGAGGGAGCTGG + Intronic
1019642366 7:2110896-2110918 AGCCGAGGAGATGACGGCGCGGG + Intronic
1020011242 7:4807049-4807071 AGCAGAGGGGTGGAGGGCGCGGG - Intronic
1022350920 7:29565736-29565758 AGCACCTGGGAGGAGGGCGCTGG - Intronic
1022943216 7:35258465-35258487 GGCCGCGGGGAGGAGCGAGAGGG - Intergenic
1025078763 7:55964743-55964765 CGCCGCGAGGCGGAGGGCGCGGG + Intronic
1025098541 7:56116335-56116357 AGACGCGGGCAGGTGGCCGCCGG - Exonic
1025174007 7:56787666-56787688 GGTCGCGGGGAGGAGGTGGCGGG - Intergenic
1025698094 7:63790289-63790311 GGTCGCGGGGAGGAGGTGGCGGG + Intergenic
1025829808 7:65038759-65038781 GGCCGCGGGGCGGAGGTGGCGGG + Intergenic
1025917063 7:65873759-65873781 GGCCGCGGGGCGGAGGTGGCGGG + Intronic
1025976758 7:66376642-66376664 GGCCGCCGGGAGGCGGGAGCTGG + Intronic
1028752224 7:94394362-94394384 AGGGGCGGGGAGGCGGGCTCCGG + Intergenic
1029168883 7:98617233-98617255 AGCTGAGGGGCGGAGGGGGCCGG - Intergenic
1029408964 7:100396831-100396853 AACCGCAGGGAGGAGGGAGTAGG + Intronic
1029461093 7:100694187-100694209 AGCAGCGGGGGAGGGGGCGCTGG + Intergenic
1031043468 7:116862656-116862678 AGTCGCGGGGGCGACGGCGCGGG + Intronic
1032194961 7:129783177-129783199 AGTCGCGCGGACGAGGGTGCAGG - Intergenic
1032396391 7:131592978-131593000 GGAGGAGGGGAGGAGGGCGCCGG + Intergenic
1033197506 7:139340410-139340432 AGGCGCGGGGACTACGGCGCAGG + Intronic
1033339230 7:140479112-140479134 GGGCGCGGGGAGGGGGCCGCGGG - Intronic
1034263744 7:149772091-149772113 AGCTGAGAGGAGGAGGGCGGGGG - Intronic
1034306447 7:150048342-150048364 GGGCGCGGGGAGGAGGCCGGTGG - Intergenic
1034441067 7:151086368-151086390 GGCGGCGGGGAGGGGGGCTCGGG + Intronic
1034522594 7:151632238-151632260 CGCCGCCGGGAGGAGGGGCCTGG + Intronic
1034800399 7:154052300-154052322 GGGCGCGGGGAGGAGGCCGGTGG + Intronic
1035254803 7:157619419-157619441 AGCCTGGGGGAGGAGAGGGCGGG - Intronic
1035264724 7:157684703-157684725 AGGGGCGGGGAGGGGCGCGCAGG - Intronic
1035377173 7:158413133-158413155 AGCCATGTTGAGGAGGGCGCTGG - Intronic
1035424334 7:158757645-158757667 AGCCGCGGGGTGCCTGGCGCGGG - Intronic
1035609980 8:955410-955432 AGCAGTGGGGAGGAGGGAGGAGG - Intergenic
1035717199 8:1763645-1763667 AGGGGCGGGGCGGCGGGCGCGGG - Intronic
1035775391 8:2183650-2183672 AGCTGTGGGGAGGTGGACGCAGG + Intergenic
1036033410 8:4994807-4994829 AGATGCGGGGAGGGGGGCGCGGG + Exonic
1038204959 8:25457903-25457925 GGGCGCGGGGACGGGGGCGCGGG - Intronic
1038761083 8:30384660-30384682 AGCCGCTGGAAGGAGGGGACGGG - Exonic
1039885975 8:41654080-41654102 AGCGGCGGGGCGGACGGGGCCGG + Intronic
1040386431 8:46917847-46917869 AGGCGCGGGGAGCAGGAGGCCGG + Intergenic
1041108691 8:54466388-54466410 ACCCGAGGGCAGGAGGGTGCGGG - Intergenic
1042722518 8:71841695-71841717 CCCCGCGCGGAGGAGCGCGCAGG - Exonic
1042903008 8:73746902-73746924 AGCGCCGGGGAGGCGGGCGGAGG - Exonic
1043388418 8:79768919-79768941 GGCCGCCGGGGGGAGGGGGCGGG - Intergenic
1043456151 8:80414352-80414374 AGCTGAGAGGAGGAGGGGGCTGG + Intergenic
1043954321 8:86343020-86343042 AGCCCGGGGGCGGACGGCGCCGG - Intronic
1045488744 8:102654528-102654550 TGCCGGCGGGAGGAGGGCGGCGG - Intronic
1045562966 8:103283578-103283600 AGGGGAGGGGAGGAGGGGGCAGG - Intergenic
1045674096 8:104589076-104589098 AGCCGGAGGGAGGAGGGAGGAGG - Intergenic
1047104809 8:121720447-121720469 TGCAGCGGGGAGGCGGGCCCAGG - Intergenic
1047334417 8:123922165-123922187 AGCTGCTGGGAGCAGGGCACCGG - Intronic
1048980913 8:139703145-139703167 AGCAGCGGGGAGGCGGGGGGCGG + Intergenic
1049266912 8:141672534-141672556 ATCCTCGGGGAGGAGTGGGCAGG + Intergenic
1049377925 8:142297898-142297920 AGGCGCGGGACGGAGGGCGGCGG - Intronic
1049420378 8:142513813-142513835 AGCTGCGGGGAAGTGGGCACAGG + Intronic
1049532362 8:143160734-143160756 AGGGGCGGGGAGGAGGGGGAGGG - Intergenic
1049574691 8:143384706-143384728 AGCCAGGGGGAGGGGGGCGGAGG + Intergenic
1049643876 8:143727574-143727596 GGCCGAGGGGAGCAGGTCGCCGG + Exonic
1049675647 8:143887709-143887731 AGCCCCTGGGAGGAAGGGGCTGG + Intergenic
1049897107 9:118444-118466 GGGTGCGAGGAGGAGGGCGCTGG - Intergenic
1050151272 9:2621763-2621785 AGCAGCGGGGAGGGGGCCGGAGG - Intergenic
1051170216 9:14313940-14313962 AAAGGCGGGGAGGGGGGCGCGGG + Intronic
1051641711 9:19230372-19230394 AGACGCAGGGAGGAGGGGGGCGG - Intergenic
1052804940 9:33004707-33004729 AGCCGCGAGGTGGAGGTTGCAGG - Intronic
1053142736 9:35691143-35691165 AGCCGCCGGGAGGAGGGGGAAGG + Intergenic
1053550986 9:39078955-39078977 AGCGGCGGAGATGGGGGCGCAGG + Intronic
1053815095 9:41899034-41899056 AGCGGCGGAGATGGGGGCGCAGG + Intronic
1054615501 9:67288407-67288429 AGCGGCGGAGATGGGGGCGCAGG - Intergenic
1056153983 9:83817351-83817373 AGCCGCTGGGCAGAGGGCACGGG - Intronic
1056356512 9:85805736-85805758 AGCCGCTGGGCAGAGGGCACGGG + Intergenic
1056687354 9:88777664-88777686 TGCCGTGGGGAGGAGTGCGGAGG - Intergenic
1056858635 9:90158833-90158855 AGGAGCAGGGAGGAGGGCTCTGG - Intergenic
1057186246 9:93058890-93058912 AGCCGAGGGGAGGGGGTCGCGGG + Intronic
1057226824 9:93296966-93296988 AGCCAAGGGGAGGAGGCCGAGGG - Intronic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057470932 9:95355595-95355617 AGAATCGGGGAGGAGGGGGCTGG + Intergenic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1058254859 9:102749216-102749238 AGCCGGGGGGCGGGGGGCGGGGG + Intergenic
1059269032 9:113060832-113060854 AGGGGTGGGGAGGAGGGCGCAGG - Intergenic
1059270168 9:113066281-113066303 AGGGGTGGGGAGGAGGGCGCAGG - Intergenic
1059271304 9:113071731-113071753 AGGGGTGGGGAGGAGGGCGCAGG - Intergenic
1059272435 9:113077175-113077197 AGGGGTGGGGAGGAGGGCGCAGG - Intergenic
1059273570 9:113082617-113082639 AGGGGTGGGGAGGAGGGCGCAGG - Intergenic
1059274706 9:113088063-113088085 AGGGGTGGGGAGGAGGGCGCAGG - Intergenic
1059889671 9:118787184-118787206 AGGATCGGGGAGGAGGGCACAGG + Intergenic
1061095992 9:128456947-128456969 AGCCGCGGGGATGCTGGGGCGGG - Intronic
1061472047 9:130834998-130835020 AGCCCCGGCGGGGAGGGTGCAGG - Intronic
1061478416 9:130884388-130884410 ACCGGCGAGGAGGAGGGCGGTGG + Exonic
1062305987 9:135907397-135907419 AGGCGGCGGCAGGAGGGCGCGGG + Intergenic
1062344641 9:136109218-136109240 GGCCCAGGGGAGGAGGGCGCCGG - Intergenic
1062499093 9:136844727-136844749 ACCGGCGGCGAGGCGGGCGCGGG - Exonic
1062565088 9:137160809-137160831 AGCCCCGGGGGGGTGGGGGCTGG - Intronic
1062682479 9:137789181-137789203 TTCCCCGGGGAGGAGGGCTCGGG - Intronic
1062696195 9:137877609-137877631 AGCCCCGGGGTGGGAGGCGCGGG + Intergenic
1185465548 X:352393-352415 AGCCACGGGGAGGAGGCCTGGGG - Intronic
1185747616 X:2584642-2584664 AGGCGCGGGGGCGAGCGCGCGGG + Intergenic
1185778993 X:2829392-2829414 AGGCTTGGGGAGGGGGGCGCGGG + Intronic
1186107929 X:6226772-6226794 AGCCGCGGAGTGGAGGGCGCAGG + Intronic
1187172922 X:16869756-16869778 CGCCCCGGGGCCGAGGGCGCCGG + Exonic
1189262585 X:39689042-39689064 AGCCGCGGGGAGGGCGCGGCAGG + Intergenic
1190113235 X:47608723-47608745 AGCCTGGGGGAGGAGGCCACCGG - Intronic
1191676083 X:63793906-63793928 AGCCAAGGGGAGAAGGGCACCGG + Intergenic
1192209951 X:69121689-69121711 AGCCTCAAGGAGGAGGGAGCTGG - Intergenic
1195346458 X:103954821-103954843 AGCTGTGGGGAGCAGGGAGCAGG - Intronic
1195360990 X:104084015-104084037 AGCTGTGGGGAGCAGGGAGCAGG + Intergenic
1196424980 X:115561120-115561142 GGCCGAGGGGCGGAGGGGGCTGG + Intergenic
1197775174 X:130114223-130114245 AGCCGTGGGCTGCAGGGCGCTGG - Intergenic
1199793397 X:151175394-151175416 ATCCGCGGTGTGGAGGGCGAGGG + Intergenic
1199976443 X:152897595-152897617 AGGGGCGGGGAGGGGGGCGGGGG - Intergenic
1200128683 X:153829983-153830005 AGGCGCGGTGCGGCGGGCGCGGG - Intronic