ID: 1169143736

View in Genome Browser
Species Human (GRCh38)
Location 20:3239556-3239578
Sequence ACGCGGGGGAAGCCCTCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169143736_1169143752 24 Left 1169143736 20:3239556-3239578 CCCCGGGAGGGCTTCCCCCGCGT No data
Right 1169143752 20:3239603-3239625 CTGTCTCCTCCTTTCGACCGGGG No data
1169143736_1169143743 -6 Left 1169143736 20:3239556-3239578 CCCCGGGAGGGCTTCCCCCGCGT No data
Right 1169143743 20:3239573-3239595 CCGCGTCCGCTTTAAGTACGCGG No data
1169143736_1169143749 22 Left 1169143736 20:3239556-3239578 CCCCGGGAGGGCTTCCCCCGCGT No data
Right 1169143749 20:3239601-3239623 CCCTGTCTCCTCCTTTCGACCGG No data
1169143736_1169143751 23 Left 1169143736 20:3239556-3239578 CCCCGGGAGGGCTTCCCCCGCGT No data
Right 1169143751 20:3239602-3239624 CCTGTCTCCTCCTTTCGACCGGG No data
1169143736_1169143744 -2 Left 1169143736 20:3239556-3239578 CCCCGGGAGGGCTTCCCCCGCGT No data
Right 1169143744 20:3239577-3239599 GTCCGCTTTAAGTACGCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169143736 Original CRISPR ACGCGGGGGAAGCCCTCCCG GGG (reversed) Intergenic