ID: 1169145977

View in Genome Browser
Species Human (GRCh38)
Location 20:3252601-3252623
Sequence ACTCCTGCTGTTCCAGCTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 612
Summary {0: 1, 1: 1, 2: 3, 3: 43, 4: 564}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169145972_1169145977 18 Left 1169145972 20:3252560-3252582 CCCAGCCTTCCTCTAGGGCTTCA 0: 1
1: 0
2: 0
3: 39
4: 289
Right 1169145977 20:3252601-3252623 ACTCCTGCTGTTCCAGCTCCTGG 0: 1
1: 1
2: 3
3: 43
4: 564
1169145975_1169145977 9 Left 1169145975 20:3252569-3252591 CCTCTAGGGCTTCAGCTCAAAGA 0: 1
1: 0
2: 1
3: 12
4: 170
Right 1169145977 20:3252601-3252623 ACTCCTGCTGTTCCAGCTCCTGG 0: 1
1: 1
2: 3
3: 43
4: 564
1169145973_1169145977 17 Left 1169145973 20:3252561-3252583 CCAGCCTTCCTCTAGGGCTTCAG 0: 1
1: 0
2: 3
3: 31
4: 299
Right 1169145977 20:3252601-3252623 ACTCCTGCTGTTCCAGCTCCTGG 0: 1
1: 1
2: 3
3: 43
4: 564
1169145974_1169145977 13 Left 1169145974 20:3252565-3252587 CCTTCCTCTAGGGCTTCAGCTCA 0: 1
1: 0
2: 2
3: 48
4: 245
Right 1169145977 20:3252601-3252623 ACTCCTGCTGTTCCAGCTCCTGG 0: 1
1: 1
2: 3
3: 43
4: 564

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169145977 Original CRISPR ACTCCTGCTGTTCCAGCTCC TGG Exonic
900366133 1:2312700-2312722 ACAGCTGCTGGTCCTGCTCCAGG + Intergenic
900624441 1:3601776-3601798 GCACCTGCTGTACCTGCTCCAGG - Intronic
900674832 1:3878677-3878699 ACTGCTGCTGTCCCCTCTCCCGG + Intronic
900705255 1:4076392-4076414 ACCCCTGCGGTTCCAGCTCTTGG - Intergenic
901051068 1:6426134-6426156 ACTCCTCCCCTTCCATCTCCAGG - Intronic
901085130 1:6606266-6606288 ACGCCTGTAGTCCCAGCTCCTGG - Intronic
901406475 1:9050329-9050351 ACTCCTGTAGTCCCAGCTACTGG + Intronic
901821915 1:11835773-11835795 ACACATGCTGTTCCCGCACCTGG - Intronic
902261033 1:15225044-15225066 ACTCCTGTAATTCCAGCTACTGG + Intergenic
902315426 1:15615201-15615223 ACACCTGTAGTTCCAGCTGCTGG + Intergenic
902987860 1:20166378-20166400 ACTCCCACTGTTCTAGCGCCTGG + Intronic
903413816 1:23168234-23168256 CCTCCTGCTGCTGCAGCTCCCGG + Intronic
903580005 1:24363801-24363823 GCTCCTGCTGTTCCCTCTGCTGG - Intronic
903811826 1:26038926-26038948 GACCCTGCTCTTCCAGCTCCTGG - Exonic
903929723 1:26855243-26855265 ACACCTTGTCTTCCAGCTCCTGG - Exonic
903936740 1:26900565-26900587 ACTTCGGATCTTCCAGCTCCAGG - Intronic
903969748 1:27110926-27110948 ATTCCTCCTGCTCCAGGTCCTGG - Intronic
904510428 1:31001240-31001262 ACTCCTGTAGTCCCAGCTACTGG + Intronic
904864018 1:33562264-33562286 TCTCCTGCTGATCCTGGTCCAGG - Intronic
904891396 1:33782240-33782262 GCCCCTGTTATTCCAGCTCCTGG - Intronic
905055137 1:35087115-35087137 ACACCTGTAGTTCCAGCTCTTGG - Intronic
905323805 1:37136253-37136275 ATTAGTGCTGTACCAGCTCCAGG + Intergenic
905591861 1:39170960-39170982 ACACCTGCTGTTCTGGCGCCTGG + Intronic
905728416 1:40275623-40275645 ACACCTGTAGTTCCAGCTACTGG + Intronic
905997999 1:42398838-42398860 ACGCCTGTAGTTCCAGCTACTGG + Intronic
906266284 1:44432701-44432723 ACACCTGTCGTTCCAGCTACTGG - Intronic
907948531 1:59157721-59157743 ACTCCTGTAGTCCCAGCTACTGG + Intergenic
908906248 1:69014272-69014294 ACACCTGTAGTTCCAGCTACTGG - Intergenic
909271418 1:73627757-73627779 GCTGCTTCTCTTCCAGCTCCAGG + Intergenic
910361130 1:86414435-86414457 ACTCCTGCTGTGGCAGCTCTTGG - Intergenic
910777310 1:90889916-90889938 ACTTCTGCTGATACAGATCCAGG - Intergenic
910836487 1:91517969-91517991 ACACCTGTAGTTCCAGCTACTGG + Intronic
912920930 1:113866382-113866404 ACTCCTGTAGTCCCAGCTACTGG + Intronic
912978304 1:114349024-114349046 ACTCCTCCCATCCCAGCTCCAGG - Intergenic
913370320 1:118091974-118091996 CAACCTGCTGTACCAGCTCCTGG - Exonic
914857371 1:151362588-151362610 ATTCCAGCTGCTCCAGCTCCAGG + Intergenic
915228482 1:154428752-154428774 ACTCCTCCTATTCCAGGTCTCGG - Intronic
915697393 1:157757833-157757855 ACGCCTGCAGTCCCAGCTACTGG + Intronic
916937422 1:169644025-169644047 ACTCCTATAGTTCCAGCTACTGG + Intergenic
917742281 1:177972436-177972458 ACTCATTCTGGTCCACCTCCTGG - Intronic
917897030 1:179501583-179501605 ACCCCTGTAGTTCCAGCTACTGG + Intronic
919092835 1:192994706-192994728 GCTCCGGCTGCTCCAGCCCCAGG - Intergenic
919679414 1:200419694-200419716 ATTCCTGTAGTTCCAGCTACTGG - Intergenic
919919517 1:202159958-202159980 ACTGCTGCTGTTCCACTCCCAGG + Intronic
920132650 1:203744716-203744738 ACACCTGTTGTCCCAGCTACTGG + Intergenic
920241659 1:204556434-204556456 ACTCCTGTTATTCCAGCACTGGG + Exonic
920308037 1:205031381-205031403 ACTTCAGCTGCTGCAGCTCCAGG + Intergenic
920662830 1:207932429-207932451 ACGCCTGTTGTCCCAGCTACTGG - Intergenic
920926915 1:210349945-210349967 ACTCCTGTAGTCCCAGCTACAGG - Intronic
922104099 1:222498120-222498142 ACGCCTGTAGTTCCAGCTACTGG + Intergenic
922110831 1:222553452-222553474 ACACCTGCAGTTCCAGCTACTGG - Intergenic
1063529236 10:6814878-6814900 ACTCATGCTTTTCTAACTCCAGG - Intergenic
1063945358 10:11170667-11170689 ACTCCTCCTCCTCCACCTCCTGG - Intronic
1064031923 10:11888018-11888040 ACACCTGCAGTCCCAGCTACAGG + Intergenic
1064184107 10:13145818-13145840 ACACCTGCAGTCCCAGCTACTGG + Intergenic
1064400700 10:15018653-15018675 ACTCCTGTAGTCCCAGCTACTGG - Intergenic
1064452189 10:15452740-15452762 ACACCTGTGGTTCCAGCTACCGG + Intergenic
1065371096 10:24987261-24987283 ATTCCTACTGTCCCTGCTCCTGG + Intronic
1066264116 10:33758718-33758740 AGTCCTGCTCTTTCCGCTCCTGG - Intergenic
1066399361 10:35060132-35060154 ACACCTGTTGTTCCAGCAACTGG + Intronic
1067945140 10:50684455-50684477 CTTCCTCCTGCTCCAGCTCCTGG - Intergenic
1068006650 10:51398853-51398875 AAGACTGATGTTCCAGCTCCAGG - Intronic
1069422001 10:68254959-68254981 GCTCTAACTGTTCCAGCTCCCGG + Intergenic
1069425831 10:68287928-68287950 ACGCCTGTAGTTCCAGCTACTGG + Intronic
1069458875 10:68575891-68575913 GCGCCTGCAGTTCCAGCTGCTGG + Intronic
1070177761 10:73986902-73986924 ACACCTGTGGTTCCAGCTACTGG + Intergenic
1070328251 10:75401498-75401520 CCTCCCGCTGCTCCTGCTCCCGG - Exonic
1071303053 10:84272048-84272070 ACTCCTGTTCTCCCAGCCCCTGG - Intergenic
1071516946 10:86304328-86304350 ACTCCTCCTCTTCCTGCCCCTGG + Intronic
1071633557 10:87233550-87233572 CTTCCTCCTGCTCCAGCTCCTGG - Exonic
1071647004 10:87365766-87365788 CTTCCTCCTGCTCCAGCTCCTGG - Exonic
1071839461 10:89454150-89454172 ACTCCTGTGGTTCCAGCTATTGG - Intronic
1072173632 10:92892805-92892827 ACTCCTGATAGTCCGGCTCCAGG - Intronic
1072765245 10:98089599-98089621 ACGCCTGTAGTTCCAGCTACTGG - Intergenic
1073138063 10:101230385-101230407 ACTCCAGCTGTTCCGGATGCGGG + Intergenic
1073240619 10:102055714-102055736 TCTCCTGCTGTTCTTGGTCCTGG - Intronic
1073337742 10:102723056-102723078 ACACCTGCAGTCCCAGCTACTGG - Intronic
1073947110 10:108763908-108763930 ACACCTGCGGTCCCAGCTACTGG - Intergenic
1074386876 10:113023596-113023618 ACACCTGCAGTCCCAGCTACTGG - Intronic
1074513574 10:114142292-114142314 CCTCCTGCTGGTCTAGCTTCTGG + Intronic
1075021804 10:118957618-118957640 CTTCCTGCTCTTCCAGCTTCTGG - Intergenic
1076155849 10:128205113-128205135 ACACCTGCAGTCCCAGCTACTGG - Intergenic
1076675092 10:132143405-132143427 TCTCCAGCTCCTCCAGCTCCTGG - Intronic
1076873913 10:133206681-133206703 TGAGCTGCTGTTCCAGCTCCTGG - Exonic
1076910964 10:133389346-133389368 GCTGCTGCTGTCACAGCTCCCGG + Intronic
1077128936 11:959711-959733 ACCAGTGCTGTTCCAGCTCCAGG - Intronic
1078367223 11:10716794-10716816 ATTCCTGCTGTTCTGCCTCCTGG - Intergenic
1078595372 11:12681907-12681929 CCTCTTTCTGTTCCTGCTCCAGG + Intronic
1079416929 11:20246306-20246328 ATTTCTGCTGTCCCAGGTCCCGG + Intergenic
1080351185 11:31387101-31387123 ACTCCTACGATTCCAACTCCGGG + Intronic
1080586299 11:33685918-33685940 TCTCCTCCTGTACCAGCTCAAGG + Intergenic
1080814959 11:35746506-35746528 ATGCCTGCTGTTTCAGCTTCTGG - Intronic
1082276735 11:50230524-50230546 ACGCCTGTTGTACCAGCTACTGG - Intergenic
1083203778 11:61135257-61135279 CCTTCTGCTGTCCCAGCTACAGG + Intronic
1083436684 11:62647852-62647874 ACTGCAGCTGTGCCAGGTCCTGG - Exonic
1084050234 11:66594647-66594669 ACTCCTGTAGTCCCAGCTACTGG + Intronic
1084543085 11:69799313-69799335 ACTGCTGCTGGTCCCACTCCAGG - Intergenic
1084571613 11:69963184-69963206 ACTCCTGTAGTCCCAGCTACTGG + Intergenic
1084599708 11:70137548-70137570 CCTCCTGGTGCCCCAGCTCCAGG + Intronic
1085208566 11:74752468-74752490 ACGCCTGTAGTTCCAGCTACTGG + Intronic
1085285879 11:75360472-75360494 ACTCCTGTAGTCCCAGCTACTGG - Intergenic
1086470032 11:87098499-87098521 ACTCCTGTTTTGCCAGCTCATGG + Intronic
1088360806 11:108987143-108987165 GCTCCTACACTTCCAGCTCCAGG - Intergenic
1088480825 11:110295809-110295831 CCTGCTGCTGTTGCAGCTCTCGG - Intronic
1089837399 11:121383244-121383266 ACCCCTGATGATCCACCTCCAGG + Intergenic
1089937776 11:122383422-122383444 GCTCCTGAAGTTCCAGCTACTGG - Intergenic
1090000629 11:122954204-122954226 GCTGCTGCAGCTCCAGCTCCAGG + Intronic
1090922846 11:131222003-131222025 GCTCCTGTAGTTCCAGCTGCTGG + Intergenic
1091321832 11:134657314-134657336 GCTGCTGCTGCTCAAGCTCCGGG - Intergenic
1091683110 12:2540878-2540900 GCTCCTGCTGTTCCAGCTCCTGG - Intronic
1092170443 12:6370803-6370825 CCTCCTGCTGTGCCATTTCCAGG + Intronic
1095888381 12:47212142-47212164 ACTCCTGTGGTCCCAGCTACTGG + Intronic
1096278917 12:50234882-50234904 ACGCCTGCAGTCCCAGCTACCGG + Intronic
1096750301 12:53754431-53754453 ACTCCTGCCGTTTCTGTTCCGGG - Intergenic
1096860657 12:54525495-54525517 ACTCATGCTGCTCCAGGGCCTGG - Intronic
1098787975 12:74783479-74783501 ACACCTGTTGTCCCAGCTACTGG + Intergenic
1099340092 12:81420097-81420119 ACAGTGGCTGTTCCAGCTCCAGG - Intronic
1100343667 12:93705688-93705710 GCTCCATCTGTTCCAGCTCTAGG - Intronic
1100519452 12:95359304-95359326 ACACCTGCAGTACCAGCTACTGG + Intergenic
1101236809 12:102797894-102797916 ACTCCACCTGTTCCACCTCCTGG - Intergenic
1102059015 12:109918397-109918419 ACACCTGTAGTTCCAGCTACTGG - Intronic
1102076273 12:110062744-110062766 ACACCTGTAGTTCCAGCTACTGG - Intronic
1102304281 12:111792649-111792671 AGTGCTGCTGTGCCGGCTCCCGG + Exonic
1102337484 12:112094112-112094134 GCTCCTGCAGTCCCAGCTACTGG + Intronic
1102880407 12:116480826-116480848 TCTCCACCTGTCCCAGCTCCTGG - Intergenic
1102899404 12:116624741-116624763 CCTCCAGCTGCTCCAGCTCCCGG - Intergenic
1103537315 12:121641830-121641852 TTTCCTGTTCTTCCAGCTCCAGG + Exonic
1103582447 12:121925282-121925304 ACTCCTCCTTTTCCTTCTCCTGG - Intronic
1104000135 12:124855010-124855032 CCTCCTGCTGGTGGAGCTCCAGG - Intronic
1104209235 12:126671231-126671253 CCTCCTGCCTTCCCAGCTCCAGG - Intergenic
1104641767 12:130471717-130471739 GCTCCTGCTGCTCCTGCTGCAGG + Intronic
1105014633 12:132778766-132778788 ACGCCTGTAGTTCCAGCTACTGG + Intronic
1105603237 13:21905962-21905984 GCTTCTGCAGCTCCAGCTCCTGG - Intergenic
1107218004 13:37945007-37945029 GCGCCTGCAGTTCCAGCTACGGG + Intergenic
1112950718 13:104993125-104993147 AAGCCTGCTGTCCCAGCTACTGG + Intergenic
1113196536 13:107814361-107814383 ACTCCTTCTCTTCCAGGACCTGG - Intronic
1113368227 13:109698098-109698120 ACTGCAGCTGTCCCAGCTGCCGG - Intergenic
1113529319 13:111009251-111009273 ACACCTGTCGTTCCAGCTACCGG + Intergenic
1115217578 14:31027533-31027555 ACACCTGTAGTCCCAGCTCCTGG + Intronic
1115546720 14:34470716-34470738 ACCCCTGCTTTTCCATCTGCTGG - Intergenic
1115662352 14:35509286-35509308 ACGCCTGCAGTCCCAGCTACTGG + Intergenic
1117139640 14:52775753-52775775 ACACCTGTAGTTCCAGCTACTGG + Exonic
1117354374 14:54909593-54909615 ACTCCTGTAGTCCCAGCTACTGG - Intergenic
1118089360 14:62456013-62456035 ACGCCTGCATTTCCAGCTACTGG + Intergenic
1118187001 14:63546682-63546704 GCTCCTGTTGTCCCAGCTACTGG + Intergenic
1118258449 14:64225394-64225416 CCTCCTGCTGCTGCTGCTCCTGG + Exonic
1118761238 14:68881409-68881431 GCTCCTGCTGTTCCGCCTCCTGG + Intronic
1118776716 14:68978382-68978404 ACTCCAGCTGGTCCTTCTCCAGG + Intronic
1120687867 14:87559374-87559396 ACACCTGCTGTTCCCACTCTAGG - Intergenic
1122074681 14:99228529-99228551 CCTCCTGCAGTCCCAGCCCCAGG + Intronic
1122696781 14:103558121-103558143 ACTACTGCAGGTCCAACTCCTGG - Intronic
1122702519 14:103599381-103599403 ACACCTGTGGTCCCAGCTCCTGG + Intronic
1122792166 14:104188631-104188653 ACTCCTGTTGTTCCTGCTCCGGG + Intergenic
1122961170 14:105094133-105094155 ACAGCTGCTGTGCCAGCTCCCGG - Intergenic
1123851512 15:24361986-24362008 GCCCCAGCTGCTCCAGCTCCAGG - Intergenic
1124168167 15:27347816-27347838 ACTCCTGCAGCTTCTGCTCCAGG + Intronic
1124241820 15:28034646-28034668 ACTCCTGTAGTCCCAGCTACTGG + Intronic
1124574541 15:30896209-30896231 ACGCCTGCAATTCCAGCACCCGG + Intergenic
1125165809 15:36703089-36703111 ACGCCTGTTGTCCCAGCTACTGG + Intronic
1125821162 15:42633014-42633036 ACACCTGTAGTTCCAGCTGCTGG + Intronic
1127447689 15:59081896-59081918 ACTCCTGTGGTCCCAGCTACTGG + Intronic
1128179387 15:65588160-65588182 ACACCTGCAGTTCCAGCTACTGG + Intronic
1128295262 15:66513437-66513459 ACACCTGAAGTTCCAGCTACTGG + Intronic
1128488937 15:68126567-68126589 ACGCCTGCAATCCCAGCTCCTGG - Intronic
1129268292 15:74406442-74406464 ACTCCAGCAGTTCCCGATCCTGG - Intergenic
1129515112 15:76152531-76152553 CCTCCTCCCGGTCCAGCTCCTGG + Intronic
1129598637 15:76984165-76984187 CCTCCTGCTGTGCTAGCTCCTGG + Intergenic
1129858466 15:78841819-78841841 ACACCTGTAGTTCCAGCTACTGG - Intronic
1131184348 15:90262513-90262535 TCTCCTGCTGTTCCTGCTTAAGG - Intronic
1131420782 15:92302914-92302936 ACTCCAGCTGATCCAGCTATTGG - Intergenic
1131425083 15:92339422-92339444 GCTCCTTGTGTGCCAGCTCCTGG - Intergenic
1132175205 15:99708670-99708692 ACTCCTGCATTTCCAGTGCCTGG - Intronic
1132598893 16:765241-765263 CCTCCTGCTGGTCCTGGTCCAGG - Exonic
1132660546 16:1059108-1059130 ACACCTGCAGTCCCAGCTACTGG - Intergenic
1132664136 16:1073955-1073977 ACCCCTGCTGCTGCTGCTCCAGG + Intergenic
1132924601 16:2422466-2422488 ACACCTGCTGGTCTTGCTCCAGG - Intergenic
1134027555 16:10965878-10965900 CCTGTCGCTGTTCCAGCTCCAGG + Intronic
1135164264 16:20124784-20124806 GCACGTGCTGTTCCTGCTCCTGG + Intergenic
1135188322 16:20333905-20333927 ACGCCTGTAGTTCCAGCTACTGG + Intronic
1135999851 16:27284076-27284098 ACGCCTGTGGTTCCAGCTACTGG + Intronic
1136033890 16:27524015-27524037 AGTCCTCTTGTCCCAGCTCCAGG + Intronic
1136090079 16:27912388-27912410 GCACCTGCAGTTCCAGCTACTGG + Intronic
1136689866 16:32021394-32021416 GCACCTGCAGTTCCAGCTACTGG - Intergenic
1136790452 16:32964958-32964980 GCACCTGCAGTTCCAGCTACTGG - Intergenic
1136879362 16:33888974-33888996 GCACCTGCAGTTCCAGCTACTGG + Intergenic
1137603569 16:49772532-49772554 ACCCCTGTTGTCCCAGCTTCGGG + Intronic
1137783341 16:51115997-51116019 GCTGCTGCTGCTACAGCTCCAGG + Intergenic
1138402743 16:56760819-56760841 ACTCCTGTAGTCCCAGCTACAGG + Intronic
1139139272 16:64241520-64241542 ACACATGCTGTTCCAGGTACTGG - Intergenic
1139849225 16:69940683-69940705 ACACCTGGGGTGCCAGCTCCTGG - Exonic
1140210253 16:72963820-72963842 CCTGCTGTTGCTCCAGCTCCCGG + Intronic
1140293611 16:73687263-73687285 ACACCTGTAGTTCCAGCTACTGG + Intergenic
1140457800 16:75114908-75114930 AGTCCTCCTGGTTCAGCTCCAGG + Exonic
1140604023 16:76512670-76512692 ACTCCTGCTGTTCCATCTTGTGG - Intronic
1141972778 16:87494153-87494175 ACGCCTGTGGTTCCAGCTACTGG + Intergenic
1142272026 16:89094766-89094788 ACACCTGCACTTCCAGCTACTGG + Intronic
1203092656 16_KI270728v1_random:1226410-1226432 GCACCTGCAGTTCCAGCTACTGG - Intergenic
1142694137 17:1623973-1623995 TCCGCTGCTGTTCTAGCTCCTGG + Intronic
1142837465 17:2598120-2598142 ACACCTGTAGTTCCAGCTACTGG + Intronic
1143189382 17:5030634-5030656 ACACCTGTAGTTCCAGCTACTGG - Intergenic
1144678660 17:17178045-17178067 ACTCCTGTAGTCCCAGCTACTGG - Intronic
1144860770 17:18300265-18300287 ACGCCTGTAGTTCCAGCTACTGG + Intronic
1145063012 17:19744274-19744296 ACGCCTGTTGTCCCAGCTACTGG + Intronic
1146000657 17:29128399-29128421 CCTTCTGCTGTGGCAGCTCCCGG + Intronic
1146327731 17:31901567-31901589 GCTCCAGCTGTTCCAATTCCGGG + Exonic
1147152719 17:38527540-38527562 GCACCTGCGGTTCCAGCTACTGG - Intergenic
1147469765 17:40648251-40648273 ACTCCCGCTGAGCCCGCTCCTGG + Exonic
1147550450 17:41438175-41438197 ACTCCTGGTTTTGCCGCTCCAGG + Exonic
1147618115 17:41842994-41843016 ATGCCTGCAGTTCCAGCTACTGG + Intronic
1147742676 17:42677710-42677732 ACGCCTGTAGTCCCAGCTCCTGG - Intergenic
1148131952 17:45267415-45267437 GCTGCTGCAGTTCCTGCTCCGGG + Exonic
1148149724 17:45389474-45389496 ACTGAGGCTGTCCCAGCTCCAGG + Intergenic
1148178367 17:45586090-45586112 TATCCTGCTGTTCCAGCGCGTGG + Intergenic
1148260412 17:46177902-46177924 ACGCCTGTAGTTCCAGCTACTGG - Intronic
1148270794 17:46260377-46260399 TATCCTGCTGTTCCAGCGCGTGG - Intergenic
1148570643 17:48665647-48665669 ACGCCTGCAGTCCCAGCTACTGG - Intergenic
1148642474 17:49198704-49198726 ACACCTGTAGTCCCAGCTCCTGG - Intergenic
1148861140 17:50604868-50604890 GCTCCAGCTGTTTCAGCTGCAGG + Intronic
1149028952 17:52062600-52062622 ATTCAAGCTGCTCCAGCTCCAGG + Intronic
1149650069 17:58271164-58271186 ACTCCTGTGGATGCAGCTCCTGG - Intronic
1149941372 17:60871288-60871310 ATGCCTGCAGTTCCAGCTACAGG - Intronic
1150071672 17:62156210-62156232 ACACCTGCAGTCCCAGCTACTGG - Intergenic
1150550180 17:66203050-66203072 ACACCTGTTGTCCCAGCTACTGG + Intergenic
1151165812 17:72202843-72202865 ACTCCTGCTGCTGCTGCTGCTGG + Intergenic
1151345439 17:73498547-73498569 TCTCCTGCTGTTCCTTCACCAGG + Intronic
1151598354 17:75091374-75091396 CCTCCTCCTGGCCCAGCTCCAGG - Intronic
1151731506 17:75914202-75914224 GCTCCTGCCGCTCCTGCTCCAGG + Exonic
1151974669 17:77477638-77477660 GCTCCTGCTCTGCGAGCTCCTGG - Intronic
1152840975 17:82568062-82568084 ACTCCTGCCCCTCCAGCCCCCGG + Exonic
1152855610 17:82663440-82663462 GCTCCTGCGGTTCCAGCTCTGGG - Intronic
1153488958 18:5629249-5629271 TCTCCTCCAGCTCCAGCTCCCGG - Intronic
1154139026 18:11807030-11807052 ACGCCTGTAGTTCCAGCTACTGG + Intronic
1154416632 18:14178920-14178942 CCTCCTCCTGCTCCTGCTCCTGG + Intergenic
1154935287 18:21048674-21048696 ACGCCTGTGGTTCCAGCTACTGG - Intronic
1155041462 18:22068711-22068733 ACACCTGTGGTTCCAGCTACTGG + Intergenic
1155294847 18:24375654-24375676 ACACCTGCACTTCCAGATCCTGG + Intronic
1155846341 18:30712496-30712518 ACTCCAGCTGTTCCAGTCTCAGG - Intergenic
1155946552 18:31858964-31858986 ACGCCTGTGGTTCCAGCTACTGG + Intronic
1157722930 18:49939270-49939292 ACGCCTGCAGTCCCAGCTACTGG - Intronic
1158480998 18:57821752-57821774 ACTGCTGCTGCTCCTGGTCCAGG - Intergenic
1158843929 18:61420626-61420648 ACCACTGCAGTTCCAGCCCCAGG - Intronic
1160036865 18:75309781-75309803 ACTTCTGCCTTTCCAGCTTCTGG + Intergenic
1160735554 19:660758-660780 ACTCCTGGAGTCCCAGCTACTGG - Intronic
1160828199 19:1090379-1090401 ACTCCTCCTGTCCCAGCACTAGG + Intronic
1160845476 19:1164238-1164260 GCTCAAGCTGTTCCTGCTCCTGG - Intronic
1160939195 19:1612210-1612232 GCACCTGCTGCTCCAGCCCCAGG + Intronic
1161142615 19:2657205-2657227 ACACCTGTAGTTCCAGCTACTGG + Intronic
1161146649 19:2682855-2682877 ACTCCTACAGTTGCAGCTGCAGG - Intronic
1161534514 19:4810802-4810824 CCACCTGCTGTCCCAGCTACTGG - Intergenic
1161595839 19:5150642-5150664 ACTCCTGGTGCCGCAGCTCCTGG + Intronic
1161721913 19:5907657-5907679 ACGCCTGCAGTCCCAGCTACTGG + Intronic
1161735703 19:5991000-5991022 ACTCCTGTAGTCCCAGCTACTGG - Intergenic
1162947176 19:14051121-14051143 GCGCCTGCGGTCCCAGCTCCTGG + Intronic
1162956177 19:14099550-14099572 ATTCCTGTAGTCCCAGCTCCTGG - Intronic
1163046408 19:14645843-14645865 ACACCTGTAGTTCCAGCTGCTGG + Intronic
1163172807 19:15544256-15544278 ACTCCAGCTCCTCCAGCTCCCGG - Exonic
1163366181 19:16877278-16877300 CTTCCTGCTCTTCCAGCTTCCGG + Intronic
1163418451 19:17201107-17201129 ACACCTGTAGTCCCAGCTCCTGG + Intronic
1165026237 19:32964296-32964318 ACTCCTGTAGTCCCAGCTACTGG - Intronic
1165576449 19:36823715-36823737 AATCCCTCTGTTCCAGGTCCAGG + Exonic
1165596098 19:37012167-37012189 ACTCCTGGTGGTCCAGCCCTGGG + Intronic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1165712921 19:38024915-38024937 ACTCCAGCTGGGCCAGCTCTGGG - Intronic
1165934617 19:39381630-39381652 ACTTCTGCTCTCCCATCTCCAGG - Intronic
1166299121 19:41904244-41904266 GCTGCTGCTGCTCCAGCGCCAGG + Exonic
1166317872 19:41998873-41998895 ACTCGTGCTCCGCCAGCTCCCGG + Exonic
1166560470 19:43729429-43729451 CCTCCTGCTGGCCCAGCTCAGGG - Exonic
1166762634 19:45234536-45234558 CCTCCTCCTGTACCAGCACCTGG + Intronic
1166816156 19:45547498-45547520 ACTCTTGCTGTTCCAGGAACAGG + Intronic
1166887225 19:45969378-45969400 ACACCTGTAGTTCCAGCTACTGG + Intronic
1167152905 19:47719780-47719802 CCTCCCGCTGTCCCAGGTCCAGG - Intronic
1167584829 19:50368363-50368385 ACTCCTGTAGTCCCAGCTACTGG + Intronic
1168631119 19:57956923-57956945 CCTCCTGCTGCCCCAGCTCCTGG + Intergenic
1168666775 19:58210291-58210313 CCTCCTGCTTTCTCAGCTCCCGG - Intronic
924969037 2:107426-107448 ACACCTGTAGTTCCAGCTACTGG - Intergenic
926141511 2:10371103-10371125 ACCCCTGCTGCTCCAGGCCCTGG - Intronic
926173658 2:10569995-10570017 CCTCCAGCTGTTCCAACCCCTGG - Intergenic
928962638 2:36943675-36943697 ACTCCTGTAGTCCCAGCTACTGG + Intronic
929239850 2:39643023-39643045 ACACCTGTGGTTCCAGCTACTGG + Intergenic
929622376 2:43368521-43368543 ACACCTGCAGTTCCAGCTACTGG - Intronic
929692783 2:44088176-44088198 ACGCCTGCTCTTCCAGCGCCAGG + Intergenic
929951654 2:46414824-46414846 ATGCCTGCAGTTCCAGCTACTGG + Intergenic
929959990 2:46489240-46489262 GCACCTGCTGTCCCAGCTACTGG + Intergenic
930133041 2:47872448-47872470 ACTCCTGTAGTCCCAGCTGCTGG - Intronic
931132234 2:59349534-59349556 ACACCTGTAGTTCCAGCTACTGG + Intergenic
931359377 2:61565134-61565156 ACACCTGTTGTCCCAGCTCCTGG - Intergenic
932192317 2:69751379-69751401 ACTCCTGTAGTCCCAGCTACTGG + Intronic
932781567 2:74561770-74561792 ACACCAGCAGGTCCAGCTCCTGG - Intronic
933889886 2:86757930-86757952 TCTCCTCTTGTTCCAACTCCAGG - Intronic
934616792 2:95776316-95776338 ACCCCTGCTATTCCATTTCCAGG - Intergenic
934837515 2:97604337-97604359 ACCCCTGCTATTCCATTTCCAGG + Intergenic
934887365 2:98036731-98036753 GTCCCTGCTGTCCCAGCTCCAGG + Intergenic
935283068 2:101535961-101535983 ACTCCTGTAGTCCCAGCTGCTGG - Intergenic
935294547 2:101637830-101637852 ACACCTGCGGTCCCAGCTACTGG - Intergenic
935442871 2:103122703-103122725 ACCCAGGCTGCTCCAGCTCCAGG + Intergenic
935659238 2:105451457-105451479 ACTCCTGAGGTCCCAGCTACTGG + Intergenic
935666271 2:105515846-105515868 CCTGCTGCTGTTCCTGCTCTGGG - Intergenic
935804781 2:106734733-106734755 CCTGCTGCAGTTCCAGCTTCGGG + Intergenic
935892482 2:107694276-107694298 ACGCCTGTAGTTCCAGCTACTGG - Intergenic
935902875 2:107811290-107811312 TCCCCAGCTGCTCCAGCTCCTGG + Intergenic
936486403 2:112929458-112929480 GCTCCCCCAGTTCCAGCTCCAGG - Intergenic
936531139 2:113277820-113277842 ACTCCTCCTGGCCCAGCACCGGG - Intronic
937343196 2:121104967-121104989 CCTCCTGCTGCTCCTTCTCCGGG - Intergenic
937444340 2:121944276-121944298 ACTAATACTGTTCCAGCCCCAGG + Intergenic
937997716 2:127707826-127707848 ACACCTGTAGTTCCAGCTACTGG + Intronic
938293698 2:130163741-130163763 ATTCCTGCTGTTGCCGTTCCTGG - Intronic
938838658 2:135136197-135136219 ACACCTGTAGTTCCAGCTACTGG + Intronic
938868076 2:135445315-135445337 ACTCCTGTAGTTCCAGCTAATGG + Intronic
939870620 2:147522318-147522340 ACTCCTACTGTTAAAACTCCAGG + Intergenic
940750044 2:157615499-157615521 ACACCTGTAGTTCCAGCTACTGG - Intronic
941012533 2:160317507-160317529 ACGCCTCCTCTTCCAGCTCATGG + Intronic
941821163 2:169844618-169844640 ACACCTGTAGTTCCAGCTACTGG - Intronic
941942332 2:171053784-171053806 CCTCCTTCTTTTCCAGGTCCTGG + Exonic
942943266 2:181644852-181644874 TTTCTTGCTGTTCCAGCTGCTGG - Intronic
944553413 2:200865701-200865723 ACGCCTGCAGTCCCAGCTACTGG - Intergenic
945446175 2:209941111-209941133 TCTCCGTTTGTTCCAGCTCCAGG - Intronic
945897028 2:215495023-215495045 ATTCCTGTTGTTCCACATCCTGG - Intergenic
946389070 2:219404761-219404783 TCTCCTGGTCTTCCAGCTGCTGG - Intergenic
946708490 2:222482838-222482860 TCTCCTGATGTTCCAGAACCTGG - Intronic
946860564 2:223996948-223996970 ACACCTGTAGTTCCAGCTACCGG + Intronic
947536681 2:230944054-230944076 ACTCTTGCTGGTCCTCCTCCTGG - Intronic
947830439 2:233136672-233136694 ACTGCTGTATTTCCAGCTCCTGG - Intronic
947946663 2:234109467-234109489 CCTCCAGCTGCTCCAGCTCCTGG + Intergenic
947946691 2:234109602-234109624 CCTCCAGCTGTTCCAGCTCCTGG + Intergenic
947982315 2:234420952-234420974 ACTCCTGTAGTTCCAGCTACAGG + Intergenic
948237148 2:236399840-236399862 ACACCTGCAGTCCCAGCTACTGG - Intronic
1169145977 20:3252601-3252623 ACTCCTGCTGTTCCAGCTCCTGG + Exonic
1169684797 20:8259487-8259509 ACTCCTGTGGTCCCAGCTACTGG + Intronic
1169944999 20:10978900-10978922 GCTCCTCCTCTTCCTGCTCCAGG + Intergenic
1170277353 20:14606516-14606538 ACTCCTGCTTTTCAGGCTCAGGG - Intronic
1172109456 20:32536699-32536721 AGTCAGGCTGTCCCAGCTCCGGG - Intronic
1172311381 20:33920956-33920978 ACTCCTGTAGTCCCAGCTTCTGG - Intergenic
1172507457 20:35473996-35474018 CCTCCTGCTGTTCCTCCTTCTGG - Exonic
1172969756 20:38864876-38864898 ATTTCTGCAGCTCCAGCTCCAGG - Intronic
1173858336 20:46265854-46265876 TCTCTTCCTGTTCCACCTCCTGG + Intronic
1173889703 20:46496776-46496798 CCTCCAGCTCTTTCAGCTCCTGG + Intergenic
1174212088 20:48887821-48887843 GCTCCTGTAGTTCCAGTTCCTGG + Intergenic
1174263044 20:49311301-49311323 GCTCCTGCTGTTCTTGCTGCTGG - Intergenic
1174912147 20:54618888-54618910 ATGCCTGCAGTTCTAGCTCCTGG + Intronic
1175874870 20:62224569-62224591 ACTCCTGCTGTTCTCCTTCCTGG - Intergenic
1175959244 20:62626642-62626664 CCTCCTGCTCTTCCAGCCCACGG + Intergenic
1176030425 20:63008752-63008774 CCTCCTGCTCCCCCAGCTCCGGG - Intergenic
1176090686 20:63317218-63317240 ACACCTGCAGTCCCAGCTACTGG + Intronic
1176136019 20:63522370-63522392 GGTCCTGCTTGTCCAGCTCCAGG - Intergenic
1176856701 21:13980340-13980362 CCTCCTCCTGCTCCTGCTCCTGG - Intergenic
1177226253 21:18260685-18260707 ACACCTGCAGTCCCAGCTACTGG + Intronic
1178338040 21:31761341-31761363 ACACCTGTAGTCCCAGCTCCTGG - Intergenic
1178548831 21:33517590-33517612 ATTTCTGCTGTTTCACCTCCTGG + Exonic
1178958670 21:37044631-37044653 ACTCCTGCTGTCCAGGCTCGTGG - Intergenic
1179396724 21:41046942-41046964 ACTGCTGCTGGTCCAGCGGCTGG - Intergenic
1179621337 21:42618175-42618197 ACTCCTGCTCTGCCACCCCCAGG + Intergenic
1179786264 21:43731931-43731953 ACACCTGCCTTCCCAGCTCCAGG - Intronic
1180198827 21:46212919-46212941 ACTCCTCCTGGACCAGGTCCCGG - Intronic
1180628611 22:17211387-17211409 CCACCTGCTGTGCCAGCACCTGG - Intronic
1181670248 22:24422545-24422567 CCTCTTGTTCTTCCAGCTCCTGG - Intronic
1182370514 22:29807112-29807134 AGGCCTGTAGTTCCAGCTCCTGG + Intronic
1182461973 22:30489739-30489761 ATGCCTGGTGTTCCAGCTTCAGG - Exonic
1182578301 22:31288676-31288698 TCTCCTGCTGTCCCAGCCACAGG + Intronic
1182967964 22:34540676-34540698 ACTCCTACATTTCCATCTCCAGG + Intergenic
1183375399 22:37461955-37461977 CCTCCTGCTGTTTCGGGTCCTGG + Intergenic
1183739445 22:39661954-39661976 ACTCCTTCCAGTCCAGCTCCCGG + Exonic
1183924847 22:41198337-41198359 ACTCCTGTAGTCCCAGCTACTGG + Intergenic
1184138696 22:42564922-42564944 ACTCCTGTAGTCCCAGCTACTGG - Intronic
1184161570 22:42700377-42700399 GCTCCTGGAGTTCCAGTTCCTGG - Intronic
1184257067 22:43293340-43293362 ACTCAAGCTACTCCAGCTCCCGG - Intronic
1184538270 22:45102195-45102217 ACTCCTGAAGTTCCAGCCTCAGG - Intergenic
1184978208 22:48078136-48078158 GCTTCTGCTTTTCCAGCTTCTGG + Intergenic
1184983489 22:48113433-48113455 ACACCTTCTGTTCCCCCTCCTGG + Intergenic
1185092799 22:48785366-48785388 GCTCCTGCTGTCCATGCTCCAGG - Intronic
1185108328 22:48886685-48886707 GCTCCTGCTGCACTAGCTCCTGG - Intergenic
1185132757 22:49049136-49049158 CCTCATGCTGTTCCAGGTGCTGG + Intergenic
949149273 3:745173-745195 ATGCCTGCAGTTCCAGCTACTGG + Intergenic
949925525 3:9037966-9037988 ATCCCTGCTTCTCCAGCTCCTGG + Intronic
949936439 3:9119662-9119684 AGTGATGCTATTCCAGCTCCAGG + Intronic
949967682 3:9372451-9372473 ACTCCTGTGGTCCCAGCTACTGG + Intronic
950085726 3:10256277-10256299 AATCCTTCTGTCTCAGCTCCTGG + Intronic
950813404 3:15672632-15672654 CCTGCTGCTGTTCCTGCTGCTGG + Intronic
950871497 3:16233620-16233642 AAACCTGCTTTTCCAGCACCAGG + Intergenic
950894271 3:16433954-16433976 AGCCCTGCTGGTACAGCTCCAGG + Exonic
953385384 3:42503029-42503051 ACTGATGCTGTGCCTGCTCCGGG - Intronic
953784166 3:45897822-45897844 TCTCCTCCTGCTGCAGCTCCAGG - Intronic
953989656 3:47474668-47474690 ACACCTGCTGTCCCAGCTACTGG + Intronic
954635624 3:52069320-52069342 GCACCTGCTGTTCCTGCTGCTGG - Intergenic
954881468 3:53838583-53838605 ACAACTGCTGTTCCCTCTCCAGG + Intronic
955350679 3:58190923-58190945 ACTCCTGTAGTCCCAGCTACTGG - Intergenic
955506761 3:59640257-59640279 TCTGTTGCGGTTCCAGCTCCTGG - Intergenic
956664588 3:71630624-71630646 ACACCTGTTGTTCCAGCTACTGG - Intergenic
957893660 3:86390880-86390902 ACGCCTGCAGTCCCAGCTACTGG - Intergenic
958107955 3:89102515-89102537 ACTCCTGTAGTCCCAGCTACTGG + Intergenic
958597919 3:96254002-96254024 ACGCCTGCAGTCCCAGCTGCTGG - Intergenic
959525465 3:107371872-107371894 ACACCTGCAGTCCCAGCTACTGG + Intergenic
960120262 3:113942038-113942060 ACACCTGAAGTTCCAGCTACGGG - Intronic
960687416 3:120307916-120307938 GCTGCTGCTGCTCCTGCTCCAGG - Intergenic
960754452 3:120995272-120995294 ACTCCTGCGATCCCAGCTACTGG - Intronic
961196636 3:125007389-125007411 ACGCCTGCAGTTACAGCACCTGG + Intronic
961434894 3:126910148-126910170 ACTCCTGTAGTCCCAGCTACTGG + Intronic
961500026 3:127325827-127325849 ATTCCTGCTGCTCCAGCTGATGG - Intergenic
961824821 3:129593442-129593464 ACCCATGCTGTTCCCTCTCCAGG + Intronic
961870500 3:129984304-129984326 ACTCCTGCAGGACCAGCACCTGG + Intergenic
962023774 3:131526824-131526846 GCTCTTGCTGTTCCAGCCGCTGG - Intergenic
962189002 3:133290492-133290514 ACTCCTGTAATTCCAGCTACTGG + Intronic
964812583 3:160681896-160681918 AGCCCTGCAGTTCTAGCTCCCGG + Intergenic
966393955 3:179482027-179482049 ACACCTGTTGTCCCAGCTACTGG - Intergenic
966931332 3:184677675-184677697 CCTCCAGCTGAGCCAGCTCCAGG + Intronic
967645950 3:191924043-191924065 ACACCTGTAGTTCCAGCTACTGG + Intergenic
968122690 3:196136840-196136862 ACGCCTGTAGTTCCAGCTACTGG - Intergenic
968202775 3:196769688-196769710 GCGCCTGCAGTTCCAGCTACTGG + Intronic
968627187 4:1631249-1631271 ACCGCTGCTATTGCAGCTCCCGG - Intronic
968749178 4:2378212-2378234 ACGCCTGCAGTCCCAGCTGCCGG + Intronic
968810281 4:2796698-2796720 GCTCCTGCTGAGCCTGCTCCAGG + Intronic
968835224 4:2958866-2958888 TTTCCTCCTCTTCCAGCTCCTGG - Intronic
968886288 4:3335533-3335555 ACTCCTGCCTTGCCAGCTCCGGG - Intronic
969494708 4:7519975-7519997 GCTCCTGCTCTGCCAGTTCCAGG + Intronic
969677147 4:8620426-8620448 ACTTCTGCTGTTGAAGCGCCAGG - Intergenic
969678100 4:8626065-8626087 ACTTCTGCTGTTGAAGCGCCAGG - Intergenic
969679055 4:8631702-8631724 ACTTCTGCTGTTGAAGCGCCAGG - Intergenic
970413651 4:15835502-15835524 ACACCTGCAGTCCCAGCTACTGG - Intronic
970909366 4:21256470-21256492 ACACCTGTAGTTCCAGCTACTGG + Intronic
971117804 4:23668270-23668292 ACTCATGCTGTCTCATCTCCAGG - Intergenic
972464777 4:39344658-39344680 ACGCCTGTGGTTCCAGCTACAGG + Intronic
973777111 4:54253809-54253831 ACTCCTGTAGTTCCAGCTACTGG - Intronic
976012562 4:80508683-80508705 ACTCCTGGAGTCCCAGCTACTGG - Intronic
976227869 4:82810804-82810826 ACGCCTGCAGTCCCAGCTACTGG - Intergenic
977197219 4:94078377-94078399 GCTCCTGCAGTCCCAGCTACTGG - Intergenic
978531714 4:109721446-109721468 ACTCCTGTAATTCCAGCTACTGG - Intronic
978792835 4:112680398-112680420 ACACCTGTAGTTCCAGCTACTGG + Intergenic
979256454 4:118612049-118612071 ACGCCTGTAGTTCCAGCTACTGG - Intergenic
979331898 4:119428488-119428510 ACGCCTGTAGTTCCAGCTACTGG + Intergenic
979516147 4:121612564-121612586 ACACCTGTAGTTCCAGCTCAGGG + Intergenic
980840626 4:138256381-138256403 ACTCCTGCTCGTCAAGCTACAGG + Intergenic
980877030 4:138671934-138671956 TCTCCTGCTGCTCCAGCTCTCGG - Intergenic
982130803 4:152227153-152227175 TGTCCTGCTGTGGCAGCTCCTGG + Intergenic
982249787 4:153392991-153393013 ACACCTGCAGTCCCAGCTACTGG + Intronic
983951435 4:173647171-173647193 ACACCTGTAGTTCCAGCTACTGG - Intergenic
984234182 4:177136436-177136458 GCACCTGTGGTTCCAGCTCCTGG + Intergenic
985134036 4:186767347-186767369 ATGCCTGCTGTCCCAGCTACTGG - Intergenic
985820732 5:2158332-2158354 ACACATCCCGTTCCAGCTCCAGG - Intergenic
985827609 5:2204703-2204725 ACTCTTGCATTTGCAGCTCCTGG - Intergenic
986010649 5:3711819-3711841 ACTCCAGGTGTCCCAGCTCCAGG - Intergenic
986179062 5:5376456-5376478 CCTCCTGCTGGTCCAGCGCTGGG - Intergenic
987290309 5:16502401-16502423 ACTGATGCTGTCCCAGCTTCTGG + Intronic
987321101 5:16770103-16770125 ACACCTGCAGTCCCAGCTCCTGG + Intronic
988797723 5:34667361-34667383 ACACCTGTAGTGCCAGCTCCAGG - Intronic
990115134 5:52380624-52380646 ACTCCTGCCGTTCTAGCTATGGG - Intergenic
990169898 5:53036452-53036474 ACTCATTCTGTTCCAGCCACAGG + Intronic
991408460 5:66324360-66324382 TATCCTGCTGCTCCACCTCCTGG + Intergenic
991906307 5:71515790-71515812 TCTCCTCCTCTTCCAGCTCCTGG + Intronic
995275116 5:110268969-110268991 ATTCCATCTGTCCCAGCTCCAGG + Intergenic
995524443 5:113039308-113039330 ACACCTGGAGTTCCAGCTACTGG - Intronic
996607010 5:125335043-125335065 ACTCCAGCTGCTCCATCTCCTGG - Intergenic
997968979 5:138384785-138384807 ACACCTGTAGTCCCAGCTCCTGG + Intronic
998028109 5:138838025-138838047 ACACCTGCAGTCCCAGCTACTGG - Intronic
998121093 5:139578577-139578599 ACACCTGCTGTCCCAGCTACTGG - Intronic
998668802 5:144330284-144330306 ACTCCTGTAGTCCCAGCTACTGG + Intronic
1000220348 5:159208935-159208957 GCCCCCTCTGTTCCAGCTCCCGG - Intronic
1000705530 5:164506042-164506064 TCTCCTGCTGCTGCAGCACCGGG + Intergenic
1001047406 5:168385341-168385363 ACTCCTGCTGTGCAAGCTCCAGG - Exonic
1001067371 5:168547225-168547247 ACACCTGTAGTTCCAGCTACTGG - Intergenic
1001800018 5:174534904-174534926 ACGACTGTAGTTCCAGCTCCTGG - Intergenic
1001880434 5:175239250-175239272 ACACCTGCTGTTCCCTCTGCTGG + Intergenic
1002066961 5:176656696-176656718 AGCCCTGCTGCTCCAGCTCCTGG - Exonic
1002132530 5:177090409-177090431 GCTCCTGCTCTTGCTGCTCCAGG - Exonic
1002925847 6:1605261-1605283 ACGCCTTCTGCTCCAGCCCCAGG + Intergenic
1003355468 6:5365454-5365476 ACACCTGCAGTCCCAGCTACTGG - Intronic
1003844697 6:10161026-10161048 ACACCTGCTGTTCCATCTGCTGG - Intronic
1004813825 6:19290386-19290408 ACGCATGCTGTTTCAGCTCAGGG + Intergenic
1005054221 6:21714828-21714850 ACACCTGTTGTCCCAGCTACTGG + Intergenic
1005161159 6:22865672-22865694 ACGCCTGCTGATTCAGTTCCTGG + Intergenic
1005576855 6:27197959-27197981 ACGCCTGTAGTTCCAGCTACTGG + Intergenic
1005931209 6:30485738-30485760 ACACATGTTGTTCCAGCTACTGG + Intergenic
1006111880 6:31751970-31751992 ACACCTGTAGTTCCAGCTGCTGG + Intronic
1006290842 6:33135381-33135403 ACACCTGCAGTTCCAGCTACTGG - Intergenic
1006438667 6:34040122-34040144 ACTCACGCAGTTCCAGCCCCTGG - Intronic
1006886551 6:37386773-37386795 ACTGCTCATGTTCCATCTCCAGG - Intronic
1007324791 6:41051733-41051755 TCTGCTGCTGTTCCGGCTCAGGG + Intronic
1007385102 6:41515238-41515260 ACTCCTGTAGTCCCAGCTACTGG + Intergenic
1007645749 6:43379426-43379448 AGTCCTGCAGTCCCAGCTACTGG + Intergenic
1007729011 6:43934577-43934599 CCTCCTGCCATCCCAGCTCCAGG + Intergenic
1010376962 6:75181967-75181989 ACTCCTGTAGTTCCAGCTACTGG + Intronic
1010438102 6:75859424-75859446 ACGCCTGTTGTCCCAGCTACTGG - Intronic
1012980457 6:105824582-105824604 ACTCCAGCTCTTCCAGTTCTAGG + Intergenic
1015012737 6:128371746-128371768 ACACCTGTAGTTCCAGCTACTGG + Intronic
1015051950 6:128852180-128852202 ACTCCTGCTATTGCTGCCCCTGG - Intergenic
1015129456 6:129793315-129793337 ACACCTGCGGTCCCAGCTACTGG + Intergenic
1016830245 6:148426549-148426571 ACTCCTTCTGTTCGGGCACCAGG - Intronic
1016904931 6:149138787-149138809 ACGCCTCCTGCTCCAGCCCCCGG + Intergenic
1017035086 6:150259835-150259857 ACAGCTGCAGTTCCAGCTACTGG + Intergenic
1017145251 6:151229010-151229032 ACACCTGTAGTTCCAGCTGCTGG - Intergenic
1017146256 6:151238434-151238456 CTTCCTGCTCTTCCAACTCCTGG + Intergenic
1018186477 6:161269512-161269534 ACGCCTGCAGTCCCAGCTGCTGG + Intronic
1018243953 6:161804031-161804053 TCTCCTGCTGTGGCAGCTGCAGG - Intronic
1018394700 6:163369315-163369337 GCTGCTGCTTCTCCAGCTCCTGG - Intergenic
1018529442 6:164747321-164747343 ACTCCTGCACTTTCAGCTCTAGG + Intergenic
1018855108 6:167669383-167669405 ACGCCTCCTGTCCCAGCTCATGG - Intergenic
1019385827 7:755603-755625 GCACCTGTGGTTCCAGCTCCCGG + Intronic
1019606120 7:1911092-1911114 ACTCCCACAGTTCCCGCTCCTGG + Intronic
1019785161 7:2972122-2972144 ACATCTGCGGTCCCAGCTCCTGG - Intronic
1020650341 7:10867342-10867364 ACTCCTACTGTTACAACTCATGG + Intergenic
1022069858 7:26902226-26902248 ACACCTGTAGTTCCAGCTACTGG + Intronic
1022810925 7:33868300-33868322 GCTGCTGCTGTTTCACCTCCAGG + Intergenic
1023223976 7:37949949-37949971 ATTCCTCCTCTCCCAGCTCCTGG - Intronic
1023235472 7:38081693-38081715 GTCCCAGCTGTTCCAGCTCCAGG - Intergenic
1023377706 7:39575131-39575153 ACTCTGGCTGTGCCAGCTCTGGG - Intronic
1023398097 7:39770591-39770613 ACACCTGTTGTCCCAGCTACTGG + Intergenic
1023484886 7:40675694-40675716 CCTGATGCTTTTCCAGCTCCAGG - Intronic
1023967403 7:44970069-44970091 ACTCTTCCTGTTCCTGCTTCAGG + Exonic
1023971695 7:44996304-44996326 ACACCTGTGGTTCCAGCTACTGG + Intergenic
1024349223 7:48346876-48346898 ACCCCTGCTGTCACTGCTCCAGG - Intronic
1025969183 7:66306424-66306446 TCACCTGCTGTTTCTGCTCCAGG + Intronic
1026234918 7:68519166-68519188 ACGCCTGTAGTTCCAGCTACAGG + Intergenic
1026597827 7:71749213-71749235 AGTTCTGATGTTGCAGCTCCTGG - Intergenic
1026688589 7:72533492-72533514 TCTCCTCCTGCTCCAGCTGCTGG + Intergenic
1026704260 7:72676563-72676585 GCTGCTGCTCTTCCAGCACCTGG - Intronic
1026723821 7:72855389-72855411 TCTCCTCCTGCTCCAGCTGCTGG + Intergenic
1027939032 7:84649018-84649040 AGTCAAGCTGTTCTAGCTCCTGG - Intergenic
1029170700 7:98627461-98627483 CCTGCAGCTGTTCCTGCTCCCGG + Intronic
1029378982 7:100200301-100200323 CCCCCTGCTGCCCCAGCTCCTGG + Exonic
1029733905 7:102455054-102455076 ACGCCTGTAGTTCCAGCTACTGG + Exonic
1030233233 7:107229975-107229997 ACACCTGTAGTTCCAGCTACTGG - Intronic
1031851719 7:126872775-126872797 ACTCCTCTTGGTCCACCTCCGGG + Intronic
1032048763 7:128632797-128632819 ACGCCTGTAGTTCCAGCTACTGG - Intergenic
1032249985 7:130247649-130247671 ACTCCTGTAGTCCCAGCTACTGG - Intergenic
1032290859 7:130589544-130589566 ACACCTGTAGTTCCAGCTACTGG - Intronic
1032453154 7:132051995-132052017 ACTCCTGCTGCTCCTGGGCCTGG - Intergenic
1034074341 7:148217406-148217428 TCTCCTCCTGTGCCAGGTCCGGG - Exonic
1034202686 7:149292440-149292462 ACTGCTCCTCTTCCTGCTCCAGG - Intronic
1034309969 7:150078852-150078874 TCCTCTGCTGTCCCAGCTCCTGG - Intergenic
1034341925 7:150362910-150362932 ATTCCTCTGGTTCCAGCTCCAGG + Intergenic
1034441717 7:151089017-151089039 AGCCCTGCTGTTCCCACTCCTGG + Intronic
1034905274 7:154939244-154939266 ACTCCTGTTTTGCCAGCTCATGG + Intronic
1035354690 7:158270113-158270135 TCTCCTGATGGTCCAGCTCTGGG - Intronic
1035388894 7:158491944-158491966 CCTCCTGCTGTTCAAGTGCCAGG - Intronic
1035714366 8:1742725-1742747 ACTCCTGCTGTCCCAGTCCCAGG + Intergenic
1037582344 8:20253120-20253142 ACAGCTTCTGCTCCAGCTCCTGG + Exonic
1037647950 8:20810760-20810782 ACACCTGCAGTCCCAGCTACTGG + Intergenic
1038203644 8:25441873-25441895 ACATCTGCAGTCCCAGCTCCTGG + Intronic
1038227968 8:25674083-25674105 ACTCCTGCCATCCCAGCTCCCGG - Intergenic
1038821618 8:30957298-30957320 ACACCTGCAGTCCCAGCTACTGG - Intergenic
1039595491 8:38787247-38787269 ACCTCTGCTGCTCCCGCTCCCGG - Exonic
1040415290 8:47189456-47189478 TCACCTGCTTTTCCAGGTCCAGG + Intergenic
1042281884 8:67064395-67064417 TGTCATGCTGTTCCCGCTCCAGG + Exonic
1042390931 8:68232742-68232764 ACACCTGTAGTCCCAGCTCCTGG - Exonic
1042824857 8:72969812-72969834 ACTCCAGCGGTTTCTGCTCCAGG - Intergenic
1043032988 8:75161681-75161703 GTTCTTGCTTTTCCAGCTCCTGG + Intergenic
1043944495 8:86233938-86233960 CCTTCAGCTTTTCCAGCTCCTGG + Intronic
1044572581 8:93736103-93736125 ACCCCTGATGTCCCAGATCCTGG + Exonic
1045043905 8:98256148-98256170 ACGCCTGTGGTTCCAGCTACTGG - Intronic
1046762143 8:118032229-118032251 GCTCCTGCTGTTTCTGCTCCGGG - Intronic
1047401702 8:124553636-124553658 ACTCCTGCTGATCTGCCTCCTGG + Exonic
1047522938 8:125609415-125609437 GCTCCTCCTGTGCCAGCTGCTGG + Intergenic
1048653769 8:136512092-136512114 TCTGCTGCTGTTCCTGCTGCTGG - Intergenic
1048730439 8:137434364-137434386 GCCCATGCTGCTCCAGCTCCCGG + Intergenic
1048812114 8:138297987-138298009 AGTCCAGATGGTCCAGCTCCCGG - Intronic
1048944132 8:139428812-139428834 CCTCCCTCTGTGCCAGCTCCAGG + Intergenic
1049680826 8:143917295-143917317 ACTCCTGCTCGGACAGCTCCAGG + Exonic
1049763766 8:144343443-144343465 CTTCCTGCTGTCCCAGCTGCTGG + Intergenic
1050137029 9:2476761-2476783 ACGCCTGCAGTTCCAGCTACCGG - Intergenic
1050433342 9:5584328-5584350 ACGCCTGCAGTCCCAGCTACTGG + Intergenic
1050750949 9:8936282-8936304 ATGCCTGTAGTTCCAGCTCCTGG + Intronic
1051636455 9:19184987-19185009 ACTCCTGTAGTCCCAGCTACTGG - Intergenic
1052181141 9:25529791-25529813 GCTCCTGCAGTTCCAGGTACTGG + Intergenic
1052749407 9:32474073-32474095 ACACCTGCAGTCCCAGCTACTGG + Intronic
1053196622 9:36124914-36124936 GGTCCTGATGTTCCAGTTCCAGG + Intergenic
1053504653 9:38631290-38631312 ACTCCTGTGGTCCCAGCTACTGG - Intergenic
1055038659 9:71845486-71845508 ACACCTGTAGTTCCAGCTACAGG - Intergenic
1055577490 9:77674801-77674823 ACCCCTGTAGTTCCAGCTACTGG + Intergenic
1056048093 9:82740033-82740055 ACTCCTGATGTTCTAGCTTTAGG + Intergenic
1057070308 9:92092606-92092628 ACACCTGTAGTTCCAGCTACTGG + Intronic
1057353801 9:94319630-94319652 CTTCCTCCTGCTCCAGCTCCTGG + Exonic
1057354586 9:94323057-94323079 GCTCCTGCTCCTCAAGCTCCAGG - Intronic
1057548071 9:96032690-96032712 TCTCCAGCTCTGCCAGCTCCGGG - Intergenic
1057653171 9:96934578-96934600 GCTCCTGCTCCTCAAGCTCCAGG + Intronic
1057653950 9:96937962-96937984 CTTCCTCCTGCTCCAGCTCCTGG - Exonic
1057731233 9:97610480-97610502 AGTCTTGCTGTCCCATCTCCAGG + Intronic
1058979347 9:110155010-110155032 ACTCCTGCTCTTCCAGTACTTGG - Intronic
1059903557 9:118955816-118955838 ACTCTTACTGTTCCCTCTCCAGG + Intergenic
1060212255 9:121717799-121717821 CTTCCTGCTGTTCCTGGTCCAGG + Intronic
1060965912 9:127712220-127712242 CCTGCTGCTGCTCCAGCTGCAGG - Exonic
1061447408 9:130648189-130648211 ACACCTGTAGTTCCAGCTGCTGG - Intergenic
1061551058 9:131334960-131334982 AGTCCTTCTGTTCCAGCCCCTGG - Intergenic
1061761306 9:132853657-132853679 ACACCTGCAGTTCCAGCTACTGG + Intronic
1061799613 9:133106748-133106770 CCTCCTGCTCTTCCCGCCCCAGG - Exonic
1062084709 9:134642549-134642571 CCTCCTGCTGATCCAGCCCTCGG - Intronic
1062192046 9:135253132-135253154 TTTCCTGCTCCTCCAGCTCCAGG - Intergenic
1062192681 9:135255910-135255932 AACGCTGCTGTTCCTGCTCCCGG - Intergenic
1062369105 9:136227850-136227872 ACACCTGCGGTCCCAGCTACTGG + Intronic
1062378640 9:136276286-136276308 GCTTCTGCTGGTCCAGCTGCAGG + Intergenic
1185561392 X:1062961-1062983 AGTGCTGCTGGTTCAGCTCCTGG - Intergenic
1185807038 X:3067583-3067605 ACTCCTGCTGCCCCAAGTCCTGG - Intronic
1185873121 X:3680945-3680967 ACTCCTGCAGTCCCAGCTACTGG + Intronic
1186089479 X:6029174-6029196 AATCCTGTTATTCCAGTTCCTGG - Intronic
1186224865 X:7387881-7387903 ACACCTGCTGTCTCAGCTACTGG + Intergenic
1186405092 X:9294905-9294927 ACTCCTGTAGTCCCAGCTACAGG + Intergenic
1187859496 X:23667642-23667664 GCTACTGCTGTTCCTGCTGCCGG + Exonic
1188252276 X:27911758-27911780 ACTCCTGCTGTCATAGCTCATGG - Intergenic
1188518562 X:31013114-31013136 GCGCCTGCAGTTCCAGCTACTGG + Intergenic
1188546015 X:31308131-31308153 CCTCCTGCTGTTCCAGTCCATGG + Intronic
1188889217 X:35589111-35589133 ACTCCTGTAGTCCCAGCTACAGG - Intergenic
1189500355 X:41550782-41550804 ACGCCTGTTGTCCCAGCTACTGG + Intronic
1190631231 X:52388689-52388711 ACACCTGTAGTTCCAGCTCCTGG + Intergenic
1191214014 X:57916969-57916991 TCTGCTGCTGATCCAGCTGCAGG - Intergenic
1194800514 X:98267268-98267290 ATTCTTGCTTTTCCAGTTCCTGG - Intergenic
1195089132 X:101441829-101441851 ACTACTGATGTTCCTGGTCCAGG - Intronic
1195107646 X:101616455-101616477 GCTCCTCCTCATCCAGCTCCTGG + Exonic
1195708624 X:107756836-107756858 ACTCCAGCTGATGCAGCCCCTGG - Intronic
1196626783 X:117885875-117885897 ACTCCAGATGGTCCAGCTCTAGG + Intergenic
1196797197 X:119512038-119512060 ACGCCTGTAGTTCCAGCTACTGG - Intergenic
1198546704 X:137700106-137700128 ACACCTGTAGTTCCAGCTACTGG - Intergenic
1199076337 X:143530548-143530570 GCTCTTGCTCTTCCAGCTTCCGG + Intergenic
1199955434 X:152738086-152738108 ACACCTTCTATTCCAGCCCCAGG - Intergenic
1201265226 Y:12199717-12199739 CCTCCTGCAATTCCAGCTCTCGG + Intergenic
1201342132 Y:12945788-12945810 GCTCCTGCAGTCCCAGCTACTGG - Intergenic