ID: 1169148747

View in Genome Browser
Species Human (GRCh38)
Location 20:3272522-3272544
Sequence CTGAAAATCCTAATGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169148747 Original CRISPR CTGAAAATCCTAATGAAGCT GGG (reversed) Intronic
901766940 1:11507278-11507300 TTGAAAATCCTAGAGAATCTAGG - Intronic
903513106 1:23891321-23891343 CTGAAAATCCAAATCAGGCCAGG + Intronic
906454059 1:45978216-45978238 ATGAAAATGCAAAAGAAGCTGGG + Intronic
906930903 1:50168281-50168303 GGGAGGATCCTAATGAAGCTGGG - Intronic
908287783 1:62627469-62627491 CAGAAAATCCTAAAAAATCTGGG + Intronic
908986630 1:70031770-70031792 AAGAAAATCCTTGTGAAGCTGGG - Intronic
910864781 1:91778135-91778157 CTGTAAATCCTACTTAATCTAGG + Intronic
910990266 1:93048810-93048832 GTGAAAATAATAATGAGGCTGGG + Intergenic
911324728 1:96456772-96456794 CTGAAAACACTGATGAAGCCTGG - Intergenic
913420463 1:118661750-118661772 CTTAAAAGCAAAATGAAGCTAGG + Intergenic
914895203 1:151664588-151664610 CTGAAAATTCTGATCAAGTTAGG - Intronic
915444768 1:155968327-155968349 CTGTAAATCCCTATGAAACTTGG - Intronic
915454315 1:156029257-156029279 TTGAAAGTCATAAAGAAGCTAGG - Intergenic
915728308 1:158034423-158034445 CTCAGAATCCTATTGAAGCTTGG - Intronic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
917997794 1:180459459-180459481 ATGAACATCCTGATGAAGATAGG + Intronic
918962216 1:191295629-191295651 ATGAAATCCCTAATGAAGCCTGG + Intergenic
920540294 1:206773101-206773123 CTGAGAATCCTAATGAAATCGGG - Intergenic
1064579482 10:16779307-16779329 CTGAAATTCCTCAAGAATCTGGG - Intronic
1066163650 10:32761798-32761820 GGGAAGATCCTAATGAAGCTAGG + Intronic
1066691809 10:38036274-38036296 CTAAAAATACTAAATAAGCTGGG + Intronic
1067467028 10:46508762-46508784 CTGTAAATGCTGATGAGGCTGGG + Intergenic
1067620158 10:47875843-47875865 CTGTAAATGCTGATGAGGCTGGG - Intergenic
1071750956 10:88475202-88475224 GTGAAAATCCCAATGAAATTGGG - Intronic
1072772705 10:98154882-98154904 CTGATAATCCTAATTAAGCAAGG - Intronic
1074400869 10:113140504-113140526 ATGAAATTCCTAATGAATCAGGG + Intronic
1074532706 10:114307858-114307880 CTGAGCAACCTAATGAATCTGGG - Exonic
1075452236 10:122559333-122559355 CTGAGAATGATAATGCAGCTGGG - Intergenic
1077419229 11:2441848-2441870 CTGAAAATCCAAAATTAGCTGGG - Intergenic
1078398884 11:11006295-11006317 CTGAAAATCCTAATGCCCTTGGG - Intergenic
1081034466 11:38124816-38124838 CTGAAAACCATAATCAACCTTGG - Intergenic
1081821102 11:45995897-45995919 CTGAAAATAATAATGAATTTGGG - Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1087822668 11:102729685-102729707 CTGAAAATACAAAATAAGCTGGG + Intergenic
1089473710 11:118741508-118741530 CTCAAAAGCAGAATGAAGCTGGG + Intergenic
1089548323 11:119248565-119248587 GTGAAAATCTTCATGAATCTTGG + Intronic
1090319795 11:125832362-125832384 CTGAAAATGTTGAAGAAGCTTGG - Intergenic
1095273608 12:40252573-40252595 CTGAAAATTGTAAAGAAGCAAGG - Intronic
1096335439 12:50751814-50751836 CTGAAAATACAAATTCAGCTGGG + Intergenic
1096987605 12:55771335-55771357 TTCAAATTCCTAATGATGCTTGG - Intronic
1098027185 12:66216064-66216086 CGGCAGCTCCTAATGAAGCTGGG + Intronic
1099022276 12:77421476-77421498 CTGAAAAAGCTAATGATGATAGG - Intergenic
1099525397 12:83712384-83712406 CAGAAAAACCTAAAGAAACTAGG - Intergenic
1100230723 12:92603975-92603997 CTGAAAATCCAAATGTTGCTTGG - Intergenic
1101122873 12:101601851-101601873 CTAAAAATTTTAATGAATCTTGG + Intronic
1102138311 12:110593677-110593699 CTAAAAATCCTAAATTAGCTGGG - Intergenic
1107050713 13:36045734-36045756 CTCAGCATCCTAATGTAGCTGGG - Intronic
1109732411 13:66431824-66431846 ATAAAAACCCTAATGAATCTTGG - Intronic
1111127748 13:83934328-83934350 ATGAAAATCCAAAAGAGGCTGGG + Intergenic
1111572853 13:90109194-90109216 CGGGAAATTCTAAAGAAGCTGGG + Intergenic
1113209983 13:107966280-107966302 ATTAAAATCAAAATGAAGCTGGG + Intergenic
1113418702 13:110152764-110152786 CTTTAAACTCTAATGAAGCTGGG - Intronic
1115179413 14:30605055-30605077 CTGAAAATACAAAATAAGCTGGG - Intronic
1117621826 14:57595043-57595065 GTGAAAATCCAAATAAAGTTTGG - Intronic
1119090595 14:71777574-71777596 CTGAAAATGCCTATGAAGCAAGG + Intergenic
1120056544 14:79930726-79930748 GGGAAGATCCTGATGAAGCTGGG - Intergenic
1120182023 14:81353673-81353695 TTGAGAATCCTAAGGAAGCTGGG - Intronic
1120605584 14:86572865-86572887 CTGAACAAACTAATAAAGCTTGG - Intergenic
1121757937 14:96418812-96418834 ATGAAAATCCTACTGAGGCTAGG - Intronic
1121979108 14:98438293-98438315 AAGAAAATCTTAATGAAGCATGG + Intergenic
1121982931 14:98470501-98470523 CTCAAAATCAAAATGATGCTGGG - Intergenic
1125166184 15:36707647-36707669 CTGAAAAGGTTGATGAAGCTAGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135625673 16:23992848-23992870 ATGAAGACCCTAATGAAGCTGGG + Intronic
1137718769 16:50614919-50614941 ATGAAGAAGCTAATGAAGCTAGG - Intronic
1140395057 16:74619205-74619227 TTAAAAATACTAATAAAGCTTGG - Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1143580121 17:7820545-7820567 CTGAAAACTCTACTGCAGCTTGG + Intronic
1144688402 17:17242344-17242366 ATGAAAATCCTCACCAAGCTTGG + Intergenic
1149972160 17:61229791-61229813 CTGAAAATTCTCCTGAAGCTAGG + Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1153157900 18:2169666-2169688 CTGGAAATCCTAAGGAAAATGGG - Intergenic
1154367273 18:13722559-13722581 GGGAACATCCTGATGAAGCTGGG - Intronic
1154402385 18:14053214-14053236 TTAAAAATCTTAAAGAAGCTCGG - Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155455927 18:26013014-26013036 CTGAAAATCCAAAATTAGCTGGG - Intergenic
1156133969 18:34013489-34013511 TTGAATATCCTTTTGAAGCTTGG - Intronic
1156507360 18:37606463-37606485 CTGAACATGCTAAAGGAGCTGGG - Intergenic
1156537426 18:37877853-37877875 GGGAAAACCCTGATGAAGCTGGG + Intergenic
1157894677 18:51454433-51454455 ATGAATATCATAAAGAAGCTGGG + Intergenic
1157957098 18:52110809-52110831 TTGAAAATCCTAATGATGGCAGG + Intergenic
1160135549 18:76268128-76268150 CTGAAAATACTAACCATGCTGGG - Intergenic
1162936097 19:13982352-13982374 CTGACAGCCCTGATGAAGCTCGG + Intronic
1163485775 19:17584653-17584675 CAGAAAATCCAAATGCAACTGGG - Intergenic
1165442991 19:35841556-35841578 CTGAAAATCCTAATGGAGACTGG - Intronic
1165809288 19:38601108-38601130 CTAAAAATACAAAAGAAGCTAGG - Intronic
1167864861 19:52316523-52316545 CTGAAAAACAAAAAGAAGCTGGG - Intronic
1168053777 19:53849398-53849420 CTGGAGATCCTAAGGAAGCCTGG - Intergenic
925142153 2:1557993-1558015 CTGAAGATCCTCAGGTAGCTGGG + Intergenic
925861245 2:8178374-8178396 TTTAAAATCCAAATGAAACTTGG + Intergenic
927381204 2:22481022-22481044 CTGAAAATCAAAATCATGCTGGG + Intergenic
927511861 2:23649058-23649080 CTGTAAATCCTAAAGATTCTTGG + Intronic
928116332 2:28547567-28547589 CTGAAAATCCTCATGGAGGTTGG + Intronic
928230754 2:29496973-29496995 CTTAAAATCCTGATGAGGCCAGG + Intronic
929598057 2:43188408-43188430 GTGAAAATCCTAAAGACCCTTGG - Intergenic
932712230 2:74075163-74075185 ATTAAAATACTAATGCAGCTGGG - Intronic
934854363 2:97719640-97719662 CTAAAAATGCTAATGAAAATAGG - Intronic
935037760 2:99395681-99395703 CTGAAAAACCAAATAAAGCAGGG + Intronic
935870416 2:107442140-107442162 CTGGAAATCAGACTGAAGCTGGG - Intergenic
936610340 2:113996361-113996383 ATGAAAATCCCAATGTGGCTGGG + Intergenic
937741078 2:125354868-125354890 CTGCAATTGCTAATGAAGTTGGG - Intergenic
938440286 2:131324285-131324307 CTGAAAATACTTAAGAAACTTGG - Intronic
939233574 2:139463064-139463086 CTGGAAATATTAATGAAGCAAGG - Intergenic
939553996 2:143651889-143651911 CGTAAAATCCTAATAAAACTGGG - Intronic
944108089 2:196101148-196101170 CTGAACATCCAAACAAAGCTAGG - Intergenic
945261767 2:207850229-207850251 CAGAAAATCTTGCTGAAGCTTGG - Intronic
947000331 2:225448010-225448032 GTGAAAAAGCTAATGAACCTGGG + Intronic
947850087 2:233280015-233280037 TTGAAAATCTTAAGAAAGCTAGG + Intronic
948594717 2:239072559-239072581 CTGAAAATCCATATGAAGGGAGG - Intronic
1169148747 20:3272522-3272544 CTGAAAATCCTAATGAAGCTGGG - Intronic
1170963024 20:21042130-21042152 CTTAAAATGCAAATGATGCTAGG + Intergenic
1171005426 20:21460885-21460907 CTGAAAATACAAAAGTAGCTGGG + Intergenic
1177378545 21:20306247-20306269 CTGTAAAGCATAATGAAGTTAGG - Intergenic
1177631509 21:23734932-23734954 CTGAAAATCCTAAGGAATCCAGG - Intergenic
1177996013 21:28098720-28098742 CTGAAAATACAAAAGTAGCTGGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1181935434 22:26434937-26434959 CTGGACATCATTATGAAGCTCGG - Intronic
1182166716 22:28182174-28182196 TTGAAAATGCTTATGAAGCTAGG - Intronic
1184239083 22:43202394-43202416 CTGAAAATCCCAAGGAACCTGGG - Exonic
951812763 3:26719043-26719065 GGAAAATTCCTAATGAAGCTGGG - Intergenic
955178478 3:56642247-56642269 CTTAAATTCATAATGAAGCTAGG + Intronic
956589875 3:70903424-70903446 CTGAATATCCAAATGAAAGTAGG - Intergenic
956924573 3:73970259-73970281 CTGAAAATCCCAAGGAAATTTGG - Intergenic
959568121 3:107853415-107853437 CTGAAAATGCAAATGGGGCTGGG - Intergenic
959596988 3:108139575-108139597 CAGGACATCCTAATGAAGATAGG - Intergenic
959865435 3:111263857-111263879 CAGAAAATCCTAAAGATTCTGGG + Intronic
960291050 3:115885360-115885382 CTCATAATCATAATGAACCTTGG - Intronic
963920733 3:150902409-150902431 CTTGAAATCATAATGAAACTCGG - Intronic
964777033 3:160290117-160290139 CTGAAAGTCCTAATGGGGCCGGG + Intronic
965391619 3:168111109-168111131 AAGAAGAGCCTAATGAAGCTGGG - Intergenic
969067587 4:4500044-4500066 CTAAAAATCCCATTGAAGATAGG - Intronic
969904840 4:10384218-10384240 CTGTGAATCCTAATGAAGGCTGG + Intergenic
971523810 4:27590270-27590292 AGAAAAATCCTAATGAAGCTTGG + Intergenic
971632455 4:29011296-29011318 CTGAAATTCTTCATGAAACTTGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
975089476 4:70384964-70384986 CTGATACTCTTATTGAAGCTTGG - Intronic
976108301 4:81643097-81643119 CTGAAAATCAAATTGAAGCATGG + Intronic
976460323 4:85303088-85303110 CAGACAATCCTAATCAGGCTGGG + Intergenic
977217524 4:94299359-94299381 GTGAAAATCTTAGTGGAGCTGGG + Exonic
977390644 4:96405335-96405357 TTGTAAATTCTAATGAAGGTTGG - Intergenic
977398659 4:96503331-96503353 CTTAAACTCCTAATGAAGGCTGG - Intergenic
979023576 4:115537154-115537176 TTGATAATACTAATGAAGCTTGG + Intergenic
980062518 4:128147146-128147168 CTGAGAATCATAAAGAATCTGGG - Intronic
980120562 4:128723839-128723861 CTGAAAATGCAAATTTAGCTGGG + Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
982111052 4:152054872-152054894 TTTAAAATCCTAATGAAATTTGG + Intergenic
982888721 4:160819402-160819424 ATAAAAATCCTAATCAAGCTGGG - Intergenic
984281232 4:177673103-177673125 CTAAAAAACCAAATGAAGCCCGG - Intergenic
984601577 4:181733067-181733089 CTGAAAATGCAGATGAAGGTTGG + Intergenic
986069275 5:4266150-4266172 CTGAAAATGCAAATGGTGCTGGG - Intergenic
987742891 5:21933307-21933329 CTGTATATCCTAATGAGACTTGG + Intronic
992294475 5:75313899-75313921 CTGAAAATACAAAATAAGCTGGG - Intergenic
993546725 5:89221109-89221131 CTGAACATCCTACTCTAGCTTGG - Intergenic
994226779 5:97261556-97261578 ATGAAACTCATGATGAAGCTTGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
996392625 5:122978543-122978565 CTGAAAACACTAAAAAAGCTGGG - Intronic
998649815 5:144105996-144106018 TTTAAAATCCAAATGAAGATGGG - Intergenic
1000521100 5:162295495-162295517 CTAAATATCTTAATGAAGGTAGG - Intergenic
1000748935 5:165070938-165070960 CTGAAAATCCTTATGGTCCTGGG + Intergenic
1002660540 5:180788412-180788434 CTGAGAATCCAAGTGCAGCTGGG + Intergenic
1002983431 6:2164589-2164611 GGGAAGATCCTGATGAAGCTGGG - Intronic
1004366822 6:15019864-15019886 CTGAAAATCCAAAATTAGCTGGG - Intergenic
1004452748 6:15762180-15762202 CTGAAAATTCAAATGTAACTGGG - Intergenic
1006061993 6:31430477-31430499 GGGAGGATCCTAATGAAGCTGGG + Intergenic
1006524875 6:34595603-34595625 CTGAAATTCCTAATGAAAAAAGG + Intronic
1009281441 6:61756553-61756575 CTAAAATTCATAATGAGGCTGGG - Intronic
1010267435 6:73882833-73882855 CTGAAAACCCTACTGCAGATGGG - Intergenic
1011468620 6:87685564-87685586 CTGATAATACAAGTGAAGCTTGG - Intronic
1012157249 6:95834848-95834870 CTCAAAATGCTAATACAGCTTGG - Intergenic
1012374566 6:98546187-98546209 CTGAAAATCTTTTTGATGCTGGG - Intergenic
1012922402 6:105233783-105233805 CTGAAAGTGCTAAGGAAGCTGGG - Intergenic
1013716771 6:112971272-112971294 TTAAAAACCCTAATGAATCTGGG + Intergenic
1014473038 6:121839272-121839294 CTGTAAATCTTAATAAAGGTTGG + Intergenic
1015676461 6:135755529-135755551 CAGAAAAACCTAATGAAGACAGG - Intergenic
1017315358 6:153024774-153024796 CGTACATTCCTAATGAAGCTTGG + Intronic
1017350324 6:153433434-153433456 CTGAAAATTCTCAGAAAGCTGGG + Intergenic
1017485904 6:154901512-154901534 CTGAGAATCCAAGTGATGCTCGG - Intronic
1018136645 6:160784382-160784404 CTGAAAATGCTCAGGAAGCTGGG - Intergenic
1024462578 7:49673510-49673532 CTTAAAATCATAATGTGGCTAGG + Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1027957863 7:84904820-84904842 GTGACAATCTTAATGAAGCTAGG - Intergenic
1030949488 7:115771708-115771730 CTGATATTCCTAATGAAGGAAGG - Intergenic
1032416832 7:131742067-131742089 CTGAAAATCCAGATAAAGATGGG + Intergenic
1032886648 7:136147188-136147210 CTGAAAGTTCTTTTGAAGCTAGG - Intergenic
1033165283 7:139034865-139034887 CTGAAAATTCAAATGACCCTGGG - Intronic
1034690487 7:153009801-153009823 ATTAAAATCTTAATGAGGCTAGG - Intergenic
1038947302 8:32375271-32375293 CTAAAAATGCTGATGAGGCTGGG - Intronic
1039113564 8:34067054-34067076 CAGAAAATCCTAATAATTCTAGG - Intergenic
1041546220 8:59046393-59046415 CTGAAAGTGTTAATGCAGCTTGG - Intronic
1043232781 8:77823546-77823568 CAAAAGACCCTAATGAAGCTGGG - Intergenic
1043586892 8:81780475-81780497 ATGAATATCCTGATGGAGCTAGG + Intergenic
1044230144 8:89765345-89765367 CTGAATATCCTGATGTTGCTTGG + Exonic
1045837480 8:106539509-106539531 ATGAAAATCAAAATTAAGCTCGG + Intronic
1046216914 8:111160752-111160774 GGGAAGATCCTAATGAAGGTGGG + Intergenic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1048522639 8:135171040-135171062 CAGAAAATCAGAATGAAACTTGG - Intergenic
1051081171 9:13295629-13295651 CTGCTAATCCTAATCAGGCTTGG + Intergenic
1051601776 9:18882163-18882185 CAGAAAATCCTAAGGCAGTTGGG + Intronic
1052777001 9:32742338-32742360 CTGAAATTCCTAATAATGCTGGG + Intergenic
1054863391 9:69975600-69975622 CTGAAAATCCAAAGGAAGGCCGG + Intergenic
1062450344 9:136612855-136612877 CGGAAAATCCTAAGGAAGAGAGG - Intergenic
1186053703 X:5626914-5626936 CTGCAAATCCTAATTAATATAGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1188101636 X:26095203-26095225 CAGAAAATCCTAAAGAATCACGG - Intergenic
1189274203 X:39772933-39772955 CAGAAATTCCTAATGATCCTGGG - Intergenic
1189356483 X:40313735-40313757 CTGAACATCATAAAGAAGCAGGG - Intergenic
1192345599 X:70301696-70301718 CTGAAGTTCCTAAGGAAGATTGG + Intronic
1192789666 X:74368960-74368982 GAGAAGATCCCAATGAAGCTGGG - Intergenic
1193531618 X:82661096-82661118 CAGAAAATCCTGATGAGGCTGGG - Intergenic
1194226824 X:91271098-91271120 ATGAAAATCCTAAAAAAACTGGG - Intergenic
1196190970 X:112794019-112794041 CTGAAAGTCCTAAGGGAGCAAGG + Intronic
1196837669 X:119828374-119828396 TTGAAAATCCATATGAGGCTGGG + Intergenic
1196846840 X:119902984-119903006 CTCAAAATCATAATGAGGCCCGG - Intronic
1197537269 X:127706579-127706601 GTGAGAACCCTAATGAAGCTGGG + Intergenic
1198307034 X:135393633-135393655 ATGAAAGTGATAATGAAGCTGGG + Intergenic